Differential Expression of the Androgen Receptor, Splice Variants and Relaxin 2 in Renal Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Tissues and Serum Samples
2.2. Cell Lines
2.3. RNA Isolation and Quantitative RT-PCR
2.4. Serum Protein Analysis
2.5. Statistical Analyses
3. Results
3.1. Androgen Receptor (AR) in RCC
3.2. Association Between Expression of AR and RLN2 and RXFP1 Receptor
3.3. Secreted Proteins
4. Discussion
5. Conclusions
6. Limitations
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Ciarimboli, G.; Theil, G.; Bialek, J.; Edemir, B. Contribution and Expression of Organic Cation Transporters and Aquaporin Water Channels in Renal Cancer. Reviews of Physiology, Biochemistry and Pharmacology; Springer: Berlin/Heidelberg, Germany, 2020; pp. 1–24. Available online: link.springer.com/chapter/10.1007%2F112_2020_34#citeas (accessed on 16 July 2021).
- Makhov, P.; Joshi, S.; Ghatalia, P.; Kutikov, A.; Uzzo, R.G.; Kolenko, V.M. Resistance to Systemic Therapies in Clear Cell Renal Cell Carcinoma: Mechanisms and Management Strategies. Mol. Cancer Ther. 2018, 17, 1355–1364. [Google Scholar] [CrossRef]
- Muglia, V.F.; Prando, A. Renal cell carcinoma: Histological classification and correlation with imaging findings. Radiol. Bras. 2015, 48, 166–174. [Google Scholar] [CrossRef] [PubMed]
- Bennett, N.C.; Rajandram, R.; Ng, K.L.; Gobe, G.C. Evaluation of steroid hormones and their receptors in development and progression of renal cell carcinoma. J. Kidney Cancer VHL 2014, 1, 17–25. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhu, G.; Liang, L.; Li, L.; Dang, Q.; Song, W.; Yeh, S.; He, D.; Chang, C. The expression and evaluation of androgen receptor in human renal cell carcinoma. Urology 2014, 1, 510e19–510e24. [Google Scholar] [CrossRef]
- Langner, C.; Ratschek, M.; Rehak, P.; Schips, L.; Zigeuner, R. Steroid Hormone Receptor Expression in Renal Cell Carcinoma: An Immunohistochemical Analysis of 182 Tumors. J. Urol. 2004, 171, 611–614. [Google Scholar] [CrossRef]
- The Human Protein Atlas. Available online: https://www.proteinatlas.org (accessed on 19 December 2019).
- GENT2. Available online: http://gent2.appex.kr/gent2/ (accessed on 13 July 2021).
- Hu, R.; Lu, C.; Mostaghel, E.A.; Yegnasubramanian, S.; Gurel, M.; Tannahill, C.; Edwards, J.; Isaacs, W.B.; Nelson, P.S.; Bluemn, E.; et al. Distinct Transcriptional Programs Mediated by the Ligand-Dependent Full-Length Androgen Receptor and Its Splice Variants in Castration-Resistant Prostate Cancer. Cancer Res. 2012, 72, 3457–3462. [Google Scholar] [CrossRef]
- Pisano, C.; Tucci, M.; Di Stefano, R.F.; Turco, F.; Scagliotti, G.V.; Di Maio, M.; Buttigliero, C. Interactions between androgen receptor signaling and other molecular pathways in prostate can-cer progression: Current and future clinical implications. Crit. Rev. Oncol. Hematol. 2021, 157, 103185. [Google Scholar] [CrossRef]
- Boorjian, S.; Ugras, S.; Mongan, N.; Gudas, L.J.; You, X.; Tickoo, S.K.; Scherr, D. Androgen receptor expression is inversely correlated with pathologic tumor stage in bladder cancer. Urology 2004, 64, 383–388. [Google Scholar] [CrossRef]
- Gonzalez, L.O.; Corte, M.D.; Vazquez, J.; Junquera, S.; Sanchez, R.; Alvarez, A.C.; Rodriguez, M.L.; Lamelas, M.L.; Vizoso, F.J. Androgen receptor expresion in breast cancer: Relationship with clinicopathological char-acteristics of the tumors, prognosis, and expression of metalloproteases and their inhibitors. BMC Cancer 2008, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Corbishley, T.P.; Iqbal, M.J.; Wilkinson, M.L.; Williams, R. Androgen receptor in human normal and malignant pancreatic tissue and cell lines. Cancer 1986, 57, 1992–1995. [Google Scholar] [CrossRef]
- Zhang, H.; Li, X.X.; Yang, Y.; Zhang, Y.; Wang, H.Y.; Zheng, X.F.S. Significance and mechanism of androgen receptor overexpression and androgen recep-tor/mechanistic target of rapamycin cross-talk in hepatocellular carcinoma. Hepatology 2018, 67, 2271–2286. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Zheng, L.; Zhu, X.; Hu, X.; Sun, L.; Zhu, X. The role of the androgen receptor in ovarian cancer carcinogenesis and its clinical implications. Oncotarget 2017, 8, 29395–29405. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Lee, J.S.; Yost, S.E.; Frankel, P.H.; Ruel, C.; Egelston, C.A.; Guo, W.; Gillece, J.D.; Folkerts, M.; Reining, L.; et al. A Phase II Clinical Trial of Pembrolizumab and Enobosarm in Patients with Androgen Recep-tor-Positive Metastatic Triple-Negative Breast Cancer. Oncologist 2021, 26, 99–e217. [Google Scholar]
- Gul, A.; Rini, B.I. Adjuvant therapy in renal cell carcinoma. Cancer 2019, 125, 2935–2944. [Google Scholar] [CrossRef]
- Lai, Y.; Tang, F.; Huang, Y.; He, C.; Chen, C.; Zhao, J.; Wu, W.; He, Z. The tumour microenvironment and metabolism in renal cell carcinoma targeted or immune therapy. J. Cell. Physiol. 2021, 236, 1616–1627. [Google Scholar] [CrossRef]
- Wach, S.; Taubert, H.; Cronauer, M. Role of androgen receptor splice variants, their clinical relevance and treatment options. World J. Urol. 2020, 38, 647–656. [Google Scholar] [CrossRef]
- Fujita, K.; Nonomura, N. Role of Androgen Receptor in Prostate Cancer: A Review. World J. Mens Health 2019, 37, 288–295. [Google Scholar] [CrossRef]
- Theil, G.; Fornara, P.; Bialek, J. Position of Circulating Tumor Cells in the Clinical Routine in Prostate Cancer and Breast Cancer Patients. Cancers 2020, 12, 3782. [Google Scholar] [CrossRef]
- Hickey, T.; Irvine, C.M.; Dvinge, H.; Tarulli, G.; Hanson, A.R.; Ryan, N.K.; Pickering, M.A.; Birrell, S.N.; Hu, D.G.; Mackenzie, P.; et al. Expression of androgen receptor splice variants in clinical breast cancers. Oncotarget 2015, 6, 44728–44744. [Google Scholar] [CrossRef]
- Aceto, N.; Bardia, A.; Wittner, B.S.; Donaldson, M.C.; O’Keefe, R.; Engstrom, A.; Bersani, F.; Zheng, Y.; Comaills, V.; Niederhoffer, K.; et al. AR Expression in Breast Cancer CTCs Associates with Bone Metastases. Mol. Cancer Res. 2018, 16, 720–727. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Luo, J. Decoding the androgen receptor splice variants. Transl. Androl. Urol. 2013, 2, 178–186. [Google Scholar]
- Bernemann, C.; Humberg, V.; Thielen, B.; Steinestel, J.; Chen, X.; Duensing, S.; Schrader, A.J.; Boegemann, M. Comparative Analysis of AR Variant AR-V567es mRNA Detection Systems Reveals Em-inent Variability and Questions the Role as a Clinical Biomarker in Prostate Cancer. Clin. Cancer Res. 2019, 25, 3856–3864. [Google Scholar] [CrossRef] [PubMed]
- Neschadim, A.; Summerlee, A.J.; Silvertown, J.D. Targeting the relaxin hormonal pathway in prostate cancer. Int. J. Cancer 2015, 137, 2287–2295. [Google Scholar] [CrossRef] [PubMed]
- Jelinic, M.; Marshall, S.A.; Stewart, D.; Unemori, E.; Parry, L.J.; Leo, C.H. Peptide hormone relaxin: From bench to bedside. Am. J. Physiol. Integr. Comp. Physiol. 2018, 314, R753–R760. [Google Scholar] [CrossRef]
- Hombach-Klonisch, S.; Bialek, J.; Trojanowicz, B.; Weber, E.; Holzhausen, H.-J.; Silvertown, J.D.; Summerlee, A.J.; Dralle, H.; Hoang-Vu, C.; Klonisch, T. Relaxin Enhances the Oncogenic Potential of Human Thyroid Carcinoma Cells. Am. J. Pathol. 2006, 169, 617–632. [Google Scholar] [CrossRef]
- Bialek, J.; Kunanuvat, U.; Hombach-Klonisch, S.; Spens, A.; Stetefeld, J.; Sunley, K.; Lippert, D.; Wilkins, J.A.; Hoang-Vu, C.; Klonisch, T. Relaxin Enhances the Collagenolytic Activity and In Vitro Invasiveness by Upregulating Matrix Metalloproteinases in Human Thyroid Carcinoma Cells. Mol. Cancer Res. 2011, 9, 673–687. [Google Scholar] [CrossRef] [PubMed]
- Bigazzi, M.; Brandi, M.L.; Bani, G.; Sacchi, T.B. Relaxin influences the growth of MCF-7 breast cancer cells. Mitogenic and antimitogenic action depends on peptide concentration. Cancer 1992, 70, 639–643. [Google Scholar] [CrossRef]
- Giam, B.; Chu, P.-Y.; Kuruppu, S.; Smith, I.; Horlock, D.; Murali, A.; Kiriazis, H.; Du, X.-J.; Kaye, D.M.; Rajapakse, N. Serelaxin attenuates renal inflammation and fibrosis in a mouse model of dilated cardiomyopathy. Exp. Physiol. 2018, 103, 1593–1602. [Google Scholar] [CrossRef] [PubMed]
- Samuel, C.S.; Hewitson, T. Relaxin and the progression of kidney disease. Curr. Opin. Nephrol. Hypertens. 2009, 18, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Samuel, C.S.; Zhao, C.; Bond, C.P.; Hewitson, T.D.; Amento, E.P.; Summers, R.J. Relaxin-1–deficient mice develop an age-related progression of renal fibrosis. Kidney Int. 2004, 65, 2054–2064. [Google Scholar] [CrossRef]
- Hewitson, T.D.; Mookerjee, I.; Masterson, R.; Zhao, C.; Tregear, G.W.; Becker, G.J.; Samuel, C.S. Endogenous relaxin is a naturally occurring modulator of experimental renal tubulointer-stitial fibrosis. Endocrinology 2007, 148, 660–669. [Google Scholar] [CrossRef]
- Jeyabalan, A.; Shroff, S.G.; Novak, J.; Conrad, K.P. The Vascular Actions of Relaxin. Relaxin Relat. Pept. 2007, 612, 65–87. [Google Scholar]
- Samuel, C.S.; Hewitson, T.D.; Unemori, E.N.; Tang, M.L.-K. Drugs of the future: The hormone relaxin. Cell. Mol. Life Sci. 2007, 64, 1539–1557. [Google Scholar] [CrossRef]
- Bryant-Greenwood, G.D.; Yamamoto, S.Y.; Sadowsky, D.W.; Gravett, M.G.; Novy, M.J. Relaxin stimulates interleukin-6 and interleukin-8 secretion from the ex-traplacental chorionic cytotrophoblast. Placenta 2009, 30, 599–606. [Google Scholar] [CrossRef]
- Burston, H.E.; Kent, O.A.; Communal, L.; Udaskin, M.L.; Sun, R.X.; Brown, K.R.; Jung, E.; Francis, K.E.; La Rose, J.; Lowitz, J.K.; et al. Inhibition of relaxin autocrine signaling confers therapeutic vulnerability in ovarian cancer. J. Clin. Investig. 2021, 131, e142677. [Google Scholar] [CrossRef]
- Cabiati, M.; Botta, L.; Caselli, C.; Del Ry, S. Transcriptional evaluation of relaxin and endothelin-1 axis in heart failure patients: First evidence of its involvement during left ventricular assist device support. Int. J. Cardiol. 2020, 306, 109–115. [Google Scholar] [CrossRef]
- Kung, H.-J. Targeting Tyrosine Kinases and Autophagy in Prostate Cancer. Horm. Cancer 2011, 2, 38–46. [Google Scholar] [CrossRef]
- Parihar, J.S.; Tunuguntla, H.S.G.R. Role of Chemokines in Renal Cell Carcinoma. Rev. Urol. 2014, 16, 118–121. [Google Scholar]
- Gahan, J.C.; Gosalbez, M.; Yates, T.; Young, E.; Escudero, D.O.; Chi, A.; Garcia-Roig, M.; Satyanarayana, R.; Soloway, M.S.; Bird, V.G.; et al. Chemokine and Chemokine Receptor Expression in Kidney Tumors: Molecular Profiling of Histological Subtypes and Association With Metastasis. J. Urol. 2012, 187, 827–833. [Google Scholar] [CrossRef][Green Version]
- Favaro, D.; Santarosa, M.; Quaia, M.; Galligioni, E. Interleukin-6 and soluble intercellular adhesion molecule-1 in renal cancer patients and cul-tured renal cancer cells. Urol. Oncol. 1997, 3, 51–58. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, J.; Lv, P.; Gao, J.; Wang, M.; Wang, Y. IL-6 is involved in malignancy and doxorubicin sensitivity of renal carcinoma cells. Cell Adhes. Migr. 2018, 12, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Antonarakis, E.S.; Lu, C.; Wang, H.; Luber, B.; Nakazawa, M.; Roeser, J.C.; Chen, Y.; Mohammad, T.A.; Chen, Y.; Fedor, H.L.; et al. AR-V7 and Resistance to Enzalutamide and Abiraterone in Prostate Cancer. N. Engl. J. Med. 2014, 371, 1028–1038. [Google Scholar] [CrossRef]
- Sun, S.; Sprenger, C.C.; Vessella, R.L.; Haugk, K.; Soriano, K.; Mostaghel, E.A.; Page, S.T.; Coleman, I.M.; Nguyen, H.M.; Sun, H.; et al. Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant. J. Clin. Investig. 2010, 120, 2715–2730. [Google Scholar] [CrossRef]
- Glogowska, A.; Thanasupawat, T.; Beiko, J.; Pitz, M.; Hombach-Klonisch, S.; Klonisch, T. Novel CTRP8-RXFP1-JAK3-STAT3 axis promotes Cdc42-dependent actin remodel-ing for enhanced filopodia formation and motility in human glioblastoma cells. Mol. Oncol. 2021. [Google Scholar] [CrossRef]
- Xia, H.; Hu, C.; Bai, S.; Lyu, J.; Zhang, B.Y.; Yu, X.; Zhan, Y.; Zhao, L.; Dong, Y. Raddeanin A down-regulates androgen receptor and its splice variants in prostate cancer. J. Cell Mol Med. 2019, 23, 3656–3664. [Google Scholar] [CrossRef]
- Yuan, P.; Ge, Y.; Liu, X.; Wang, S.; Ye, Z.; Xu, H.; Chen, Z. The Association of Androgen Receptor Expression with Renal Cell Carcinoma Risk: A Systematic Re-view and Meta-Analysis. Pathol. Oncol. Res. 2020, 26, 605–614. [Google Scholar] [CrossRef]
- Noh, S.J.; Kang, M.J.; Kim, K.M.; Bae, J.S.; Park, H.S.; Moon, W.S.; Chung, M.J.; Lee, H.; Lee, D.G.; Jang, K.Y. Acetylation status of P53 and the expression of DBC1, SIRT1, and androgen receptor are associ-ated with survival in clear cell renal cell carcinoma patients. Pathology 2013, 45, 574–580. [Google Scholar] [CrossRef]
- Foersch, S.; Schindeldecker, M.; Keith, M.; Tagscherer, K.E.; Fernandez, A.; Stenzel, P.J.; Pahernik, S.; Hohenfellner, M.; Schirmacher, P.; Roth, W.; et al. Prognostic relevance of androgen receptor expression in renal cell carcinomas. Oncotarget 2017, 8, 78545–78555. [Google Scholar] [CrossRef]
- Zhao, H.; Leppert, J.; Peehl, D.M. A Protective Role for Androgen Receptor in Clear Cell Renal Cell Carcinoma Based on Mining TCGA Data. PLoS ONE 2016, 11, e0146505. [Google Scholar]
- Huang, Q.; Sun, Y.; Ma, X.; Gao, Y.; Li, X.; Niu, Y.; Zhang, X.; Chang, C. Androgen receptor increases hematogenous metastasis yet decreases lymphatic metastasis of renal cell carcinoma. Nat. Commun. 2017, 8, 1–15. [Google Scholar] [CrossRef]
- Liu, S.; Vinall, R.L.; Tepper, C.; Shi, X.B.; Xue, L.R.; Ma, A.H.; Wang, L.Y.; Fitzgerald, L.D.; Wu, Z.; Gandour-Edwards, R.; et al. Inappropriate activation of androgen receptor by relaxin via beta-catenin pathway. Oncogene 2008, 27, 499–505. [Google Scholar] [CrossRef] [PubMed]
- Dschietzig, T.; Bartsch, C.; Wessler, S.; Baumann, G.; Stangl, K. Autoregulation of human relaxin-2 gene expression critically involves relaxin and glucocor-ticoid receptor binding to glucocorticoid response half-sites in the relaxin-2 promoter. Regul. Pept. 2009, 155, 163–173. [Google Scholar] [CrossRef] [PubMed]
- Lessard, J.; Tchernof, A. Interaction of the Glucocorticoid and Androgen Receptors in Adipogenesis. Chem. Biol. 2012, 19, 1079–1080. [Google Scholar] [CrossRef]
- Hu, M.; Wang, Y.; Xu, L.; An, S.; Tang, Y.; Zhou, X.; Li, J.; Liu, R.; Huang, L. Relaxin gene delivery mitigates liver metastasis and synergizes with check point therapy. Nat. Commun. 2019, 10, 1–13. [Google Scholar] [CrossRef]
- Kalluri, R. The biology and function of fibroblasts in cancer. Nat. Rev. Cancer 2016, 16, 582–598. [Google Scholar] [CrossRef]
- Fallowfield, J.A.; Hayden, A.L.; Snowdon, V.K.; Aucott, R.L.; Stutchfield, B.M.; Mole, D.J.; Pellicoro, A.; Gordon-Walker, T.T.; Henke, A.; Schrader, J.; et al. Relaxin modulates human and rat hepatic myofibroblast function and ameliorates por-tal hypertension in vivo. Hepatology 2014, 59, 1492–1504. [Google Scholar] [CrossRef] [PubMed]
- Rizvi, S.; Gores, G.J. The Two Faces of Relaxin in Cancer: Antitumor or Protumor? Hepatology 2020, 71, 1117–1119. [Google Scholar] [CrossRef]
- Shafi, A.A.; Putluri, V.; Arnold, J.; Tsouko, E.; Maity, S.; Roberts, J.M.; Coarfa, C.; Frigo, D.; Putluri, N.; Sreekumar, A.; et al. Differential regulation of metabolic pathways by androgen receptor (AR) and its constitutively active splice variant, AR-V7, in prostate cancer cells. Oncotarget 2015, 6, 31997–32012. [Google Scholar] [CrossRef]
- Rana, M.; Dong, J.; Robertson, M.J.; Basil, P.; Coarfa, C.; Weigel, N.L. Androgen receptor and its splice variant, AR-V7, differentially induce mRNA splicing in prostate cancer cells. Sci. Rep. 2021, 11, 1–12. [Google Scholar]
- Zhan, Y.; Zhang, G.; Wang, X.; Qi, Y.; Bai, S.; Li, D.; Ma, T.; Sartor, O.; Flemington, E.K.; Zhang, H.; et al. Interplay between Cytoplasmic and Nuclear Androgen Receptor Splice Variants Mediates Castra-tion Resistance. Mol. Cancer Res. 2017, 15, 59–68. [Google Scholar] [CrossRef] [PubMed]
Tissue (n; Tissue/Serum) | Gender (n; Tissue/Serum) | pT (n; Tissue/Serum) |
---|---|---|
ccRCC (25/20) | M (19/13) | pT1 (6/6) |
pT2 (5/2) | ||
pT3 (6/4) | ||
pT4 (2/1) | ||
F (6/7) | pT1 (3/5) | |
pT2 (1/1) | ||
pT3 (2/1) | ||
pRCC (10/10) | M (8/7) | adenoma (1/0) |
pT1 (4/4) | ||
pT2 (2/2) | ||
pT3 (1/1) | ||
F (2/3) | pT1 (0/2) | |
pT2 (2/1) |
Target | Primer | Product Length (bp) |
---|---|---|
Relaxin | F: TTGCCACAGGAGCTGAAGTT R: TCTGCGGCTTCACTTTGTCT | 146 |
RXFP1 *** | F: AAAAGAGATGATCCTTGCCAAACG R: CCACCCAGATGAATGATGGAGC | 299 |
AR-FL * | F: CAGCCTATTGCGAGAGAGCTG R: GAAAGGATCTTGGGCACTTGC | 73 |
AR-V1 | F: AGGGAAAAAGGGCCGAGCTA R: TCCTCCGAGTCTTTAGCAGC | 185 |
AR-V3 | F: AAGAGCCGCTGAAGGGAAAC R: AGGCAAGTCAGCCTTTCTTCA | 199 |
AR-V4 | F: CTCTCAGCTGCTCATCCACA R: GGTTTTCAAATGCAGCCAGGA | 74 |
AR-V7 **** | F: AAAAGAGCCGCTGAAGGGAA R: GCCAACCCGGAATTTTTCTCC | 150 |
AR-V12 ** (ARv567es) | F: CCAAGGCCTTGCCTGATTGC R: TTGGGCACTTGCACAGAGAT | 120 |
β-Actin | F: ATTGCCGACAGGATGCAGAA R: GCTGATCCACATCTGCTGGAA | 150 |
ccRCC | AR-FL (n) | AR-V1 (n) | AR-V3 (n) | AR-V4 (n) | AR-V7 (n) |
---|---|---|---|---|---|
N > T | 56% (14) | 56% (14) | 52% (13) | 64% (16) | 48% (12) |
N = T | 12% (3) | 12% (3) | 8% (2) | 4% (1) | 8% (2) |
N < T | 32% (8) | 32% (8) | 40% (10) | 32% (8) | 44% (n1) |
Papillary adenoma | AR-FL (n) | AR-V1 (n) | AR-V3 (n) | AR-V4 (n) | AR-V7 (n) |
N < T (1) | N > T (1) | N = T (1) | N > T (1) | N > T (1) | |
pRCC | AR-FL (n) | AR-V1 (n) | AR-V3 (n) | AR-V4 (n) | AR-V7 (n) |
N > T | 44% (4) | 11% (1) | 44% (4) | 56% (5) | 56% (5) |
N = T | 0% (0) | 0% (0) | 0% (0) | 0% (0) | 0% (0) |
N < T | 56% (5) | 89% (8) | 56% (5) | 44% (4) | 44% (4) |
AR-FL | AR-V1 | AR-V3 | AR-V4 | AR-V7 | ||
---|---|---|---|---|---|---|
ccRCC | ||||||
RLN2 | r ≤ | 0.67 | 0.58 | 0.20 | 0.49 | 0.16 |
p ≤ | * 0.002 | * 0.01 | 0.42 | * 0.04 | 0.52 | |
pRCC | ||||||
RLN2 | r ≤ | −0.08 | 0.07 | 0.36 | 0.77 | 0.45 |
p ≤ | 0.84 | 0.88 | 0.34 | * 0.01 | 0.23 |
Sex/pT | Testosterone (nmol/L) | IL6 (pg/mL) | IL8 (pg/mL) |
---|---|---|---|
ccRCC | |||
M/pT1 | 15.60 (10.13–20.35) | 3 (<2.00–3.21) | 12.20 (8.93–25.60) |
F/pT1 | 0.64 (0.27–1.05) | 4.20 (<2.00–4.75) | 11.85 (<5.00–64.90) |
M/pT2 | 10.69 (6.51–14.87) | 3.37 (<2.00–3.37) | 7.35 (6.20–8.51) |
M/pT3 | 15.95 (8.39–20.72) | 3.715 (<2.00–4.54) | 10.9 (8.75–13.2) |
F/pT3 | 0.30 | 40.70 | 123 |
M/pT4 | 10.50 | 3.96 | 35.60 |
pRCC | |||
M/pT1 | 11.34 (6.90–15.66) | 22.60 (<2.00–41.1) | 13.19 (<5.00–18.90) |
F/pT1 | 0.46 (0.41–0.52) | <2.00 | 6.61 (6.46–6.77) |
M/pT2 | 13.97 (10.47–17.47) | 5.79 (<2.00–5.79) | 16.66 (8.63–24.70) |
F/pT2 | <0.24 | <2.00 | 7.24 |
M/pT3 | 12.42 | <2.00 | 6.67 |
Sex/pT (n) | Testosterone | IL6 | IL8 | ||||
---|---|---|---|---|---|---|---|
Positive % (n) | ND % (n) | Positive % (n) | ND % (n) | Positive % (n) | ND % (n) | ||
ccRCC | |||||||
M/pT1 (6) | 30 (6) | 0 (0) | 20 (4) | 10 (2) | 30 (6) | 0 (0) | |
F/pT1 (5) | 25 (5) | 0 (0) | 10 (2) | 15 (3) | 15 (3) | 10 (2) | |
M/pT2 (2) | 10 (2) | 0 (0) | 5 (1) | 5 (1) | 10 (2) | 0 (0) | |
F/pT2 (1) | 5 (1) | 0 (0) | 0 (0) | 5 (1) | 5 (1) | 0 (0) | |
M/pT3 (4) | 20 (4) | 0 (0) | 10 (2) | 10 (2) | 20 (4) | 0 (0) | |
F/pT3 (1) | 5 (1) | 0 (0) | 5 (1) | 0 (0) | 5 (1) | 0 (0) | |
M/pT4 (1) | 5 (1) | 0 (0) | 5 (1) | 0 (0) | 5 (1) | 0 (0) | |
Total 20 (100%) | 20/20 (100%) | 0/20 (0%) | 11/20 (55%) | 9/20 (45%) | 18/20 (90%) | 2/20 (10%) | |
pRCC | |||||||
M/pT1 (4) | 40 (4) | 0 (0) | 20 (2) | 20 (2) | 20 (2) | 20 (2) | |
F/pT1 (2) | 20 (2) | 0 (0) | 0 (0) | 20 (2) | 20 (2) | 0 (0) | |
M/pT2 (2) | 20 (2) | 0 (0) | 10 (1) | 10 (1) | 20 (2) | 0 (0) | |
F/pT2 (1) | 0 (0) | 10 (1) | 0 (0) | 10 (1) | 10 (1) | 0 (0) | |
M/pT3 (1) | 10 (1) | 0 (0) | 0 (0) | 10 (1) | 10 (1) | 0 (0) | |
Total 10 (100%) | 9/10 (90%) | 1/10 (10%) | 3/10 (30%) | 7/10 (70%) | 8/10 (80%) | 2/10 (20%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bialek, J.; Piwonka, M.; Kawan, F.; Fornara, P.; Theil, G. Differential Expression of the Androgen Receptor, Splice Variants and Relaxin 2 in Renal Cancer. Life 2021, 11, 731. https://doi.org/10.3390/life11080731
Bialek J, Piwonka M, Kawan F, Fornara P, Theil G. Differential Expression of the Androgen Receptor, Splice Variants and Relaxin 2 in Renal Cancer. Life. 2021; 11(8):731. https://doi.org/10.3390/life11080731
Chicago/Turabian StyleBialek, Joanna, Maria Piwonka, Felix Kawan, Paolo Fornara, and Gerit Theil. 2021. "Differential Expression of the Androgen Receptor, Splice Variants and Relaxin 2 in Renal Cancer" Life 11, no. 8: 731. https://doi.org/10.3390/life11080731
APA StyleBialek, J., Piwonka, M., Kawan, F., Fornara, P., & Theil, G. (2021). Differential Expression of the Androgen Receptor, Splice Variants and Relaxin 2 in Renal Cancer. Life, 11(8), 731. https://doi.org/10.3390/life11080731