Nitrite Degradation by a Novel Marine Bacterial Strain Pseudomonas aeruginosa DM6: Characterization and Metabolic Pathway Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Strain Identification
2.3. Effects of Environmental Factors
2.4. Orthogonal Experimental Optimization
2.5. Nitrite Tolerance Test
2.6. Amplification of Denitrification Functional Genes
2.7. Data Analysis
3. Results
3.1. Strain Identification
3.2. Effects of Environmental Factors
3.2.1. Carbon Sources
3.2.2. C/N
3.2.3. pH
3.2.4. Salinity
3.2.5. Temperature
3.3. Orthogonal Experimental Optimization
3.4. Nitrite Tolerance Test
3.5. Amplification of Denitrification Functional Genes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gao, J.; Gao, D.; Liu, H.; Cai, J.; Zhang, J.; Qi, Z. Biopotentiality of High Efficient Aerobic Denitrifier Bacillus megaterium S379 for Intensive Aquaculture Water Quality Management. Environ. Manag. 2018, 222, 104–111. [Google Scholar] [CrossRef]
- Zheng, L.; Liu, Q.; Liu, J.; Xiao, J.; Xu, G. Pollution Control of Industrial Mariculture Wastewater: A Mini-Review. Water 2022, 14, 1390. [Google Scholar] [CrossRef]
- Siikavuopio, S.I.; Dale, T.; Christiansen, J.S.; Nevermo, I. Effects of chronic nitrite exposure on gonad growth in green sea urchin Strongylocentrotus droebachiensis. Aquaculture 2004, 242, 357–363. [Google Scholar] [CrossRef]
- Huang, M.; Xie, J.; Yu, Q.; Xu, C.; Zhou, L.; Qin, J.G.; Chen, L.; Li, E. Toxic effect of chronic nitrite exposure on growth and health in Pacific white shrimp Litopenaeus vannamei. Aquaculture 2020, 529, 735664. [Google Scholar] [CrossRef]
- Hu, D.; Wang, L.; Zhao, R.; Zeng, J.; Shao, Z. Core microbiome involved in nitrite removal in shrimp culture ponds. Aquac. Res. 2021, 53, 1663–1675. [Google Scholar] [CrossRef]
- Rout, P.R.; Bhunia, P.; Dash, R.R. Simultaneous removal of nitrogen and phosphorous from domestic wastewater using Bacillus cereus GS-5 strain exhibiting heterotrophic nitrification, aerobic denitrification and denitrifying phosphorous removal. Bioresour. Technol. 2017, 244, 484–495. [Google Scholar] [CrossRef]
- Cao, X.; Zhao, B.; Wu, Y.; Huang, J.; Wang, H.; Sun, X.; Li, S. Characterization of Alcaligenes aquatilis as a novel member of heterotrophic nitrifier-aerobic denitrifier and its performance in treating piggery wastewater. Bioresour. Technol. 2022, 354, 127176. [Google Scholar] [CrossRef] [PubMed]
- Duan, J.; Fang, H.; Su, B.; Chen, J.; Lin, J. Characterization of a halophilic heterotrophic nitrification-aerobic denitrification bacterium and its application on treatment of saline wastewater. Bioresour. Technol. 2015, 179, 421–428. [Google Scholar] [CrossRef]
- Yang, L.; Ren, Y.X.; Liang, X.; Zhao, S.-Q.; Wang, J.-P.; Xia, Z.-H. Nitrogen removal characteristics of a heterotrophic nitrifier Acinetobacter junii YB and its potential application for the treatment of high-strength nitrogenous wastewater. Bioresour. Technol. 2015, 193, 227–233. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.X.; Li, J.F.; Teng, Y.; Cui, Z.G.; Cui, H.W.; Liang, S.K.; Zhao, M.J. Denitrification characteristics of a salt-tolerant and cold-tolerant heterotrophic nitrification-aerobic denitrification bacteria. Environ. Sci. Technol. 2023, 46, 1–7. [Google Scholar] [CrossRef]
- An, Q.; Deng, S.; Xu, J.; Nan, H.; Li, Z.; Song, J.-L. Simultaneous reduction of nitrate and Cr (VI) by Pseudomonas aeruginosa strain G12 in wastewater. Ecotoxicol. Environ. Saf. 2020, 191, 110001. [Google Scholar] [CrossRef] [PubMed]
- Wei, R.; Hui, C.; Zhang, Y.; Jiang, H.; Zhao, Y.; Du, L. Nitrogen removal characteristics and predicted conversion pathways of a heterotrophic nitrification–aerobic denitrification bacterium, Pseudomonas aeruginosa P-1. Environ. Sci. Pollut. Res. 2020, 28, 7503–7514. [Google Scholar] [CrossRef] [PubMed]
- He, D.; Zheng, M.; Ma, T.; Li, C.; Ni, J. Interaction of Cr (VI) reduction and denitrification by strain Pseudomonas aeruginosa PCN-2 under aerobic conditions. Bioresour. Technol. 2015, 185, 346–352. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.Q.; Cui, Y.W.; Huang, J.L.; Sun, F.-L.; Chen, S. A novel Pseudomonas aeruginosa strain performs simultaneous heterotrophic nitrification-aerobic denitrification and aerobic phosphate removal. Water Res. 2022, 221, 118823. [Google Scholar] [CrossRef]
- Chen, Z.H.; Zhang, Y.H.; Wang, J.Y.; Zhang, Y.L.; Zhu, X.Y.; Sun, C.; Zhang, X.H. Exploring the diversity of cultivable bacteria in the Western Pacific Ocean using modified culture media. Acta Microbiol. Sin. 2021, 61, 845–861. [Google Scholar] [CrossRef]
- Greenberg, A.E.; Trussell, R.R.; Clesceri, L.S. Standard methods for the examination of water and wastewater: Supplement to the sixteenth edition. Am. J. Public Health Nations Health 2005, 56, 387. [Google Scholar] [CrossRef]
- Yang, J.R.; Wang, Y.; Chen, H.; Lyu, Y.-K. Ammonium removal characteristics of an acid-resistant bacterium Acinetobacter sp. JR1 from pharmaceutical wastewater capable of heterotrophic nitrification-aerobic denitrification. Bioresour. Technol. 2019, 274, 56–64. [Google Scholar] [CrossRef]
- Wang, Y.; Zou, Y.L.; Chen, H.; Lv, Y.-K. Nitrate removal performances of a new aerobic denitrifier, Acinetobacter haemolyticus ZYL, isolated from domestic wastewater. Bioprocess Biosyst. Eng. 2021, 44, 391–401. [Google Scholar] [CrossRef]
- Zhou, P.; Liu, Y.; Mu, X.T.; Su, X.; Wu, Y.H.; Han, R. Research progress of heterotrophic nitrification-aerobic denitrification bacteria in nitrogen removal of mariculture wastewater. J. Water Ecol. 2023, 44, 148–157. [Google Scholar] [CrossRef]
- Xia, Z.; Wang, Q.; She, Z.; Gao, M.; Zhao, Y.; Guo, L.; Jin, C. Nitrogen removal pathway and dynamics of microbial community with the increase of salinity in simultaneous nitrification and denitrification process. Sci. Total Environ. 2019, 697, 134047. [Google Scholar] [CrossRef]
- García-Ruiz, M.J.; Castellano-Hinojosa, A.; González-López, J.; Osorio, F. Effects of salinity on the nitrogen removal efficiency and bacterial community structure in fixed-bed biofilm CANON bioreactors. Chem. Eng. J. 2018, 347, 156–164. [Google Scholar] [CrossRef]
- Hou, D.M.; Zhang, L.; Li, C.C.; Chen, L.T.; Zou, J.P. Isolation, identification and nitrogen removal performance of a salt-tolerant heterotrophic nitrification-aerobic denitrification bacterium Rhodococcus sp. LS-2. J. Nanchang Hangkong Univ. 2023, 37, 50–58. [Google Scholar] [CrossRef]
- Yin, L.L.; Lv, J.; Wang, J.H.; Wu, J.; Zhang, C. Isolation, identification and performance study of a sucrose-preferred marine heterotrophic nitrification-aerobic denitrification bacteria. Mar. Environ. Sci. 2023, 42, 425–431. [Google Scholar]
- Ren, Y.X.; Yang, L.; Liang, X. The characteristics of a novel heterotrophic nitrifying and aerobic denitrifying bacterium, Acinetobacter junii YB. Bioresour. Technol. 2014, 171, 1–9. [Google Scholar] [CrossRef]
- Li, D.; Liang, X.; Jin, Y.; Wu, C.; Zhou, R. Isolation and Nitrogen Removal Characteristics of an Aerobic Heterotrophic Nitrifying-Denitrifying Bacterium, Klebsiella sp. TN-10. Appl. Biochem. Biotechnol. 2019, 188, 540–554. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Wang, W.; Feng, Y.; Zhu, X.; Zhou, H.; Tan, Z.; Li, X. Impact resistance of different factors on ammonia removal by heterotrophic nitrification-aerobic denitrification bacterium Aeromonas sp. HN-02. Bioresour. Technol. 2014, 167, 456–461. [Google Scholar] [CrossRef]
- He, T.; Ye, Q.; Sun, Q.; Cai, X.; Ni, J.; Li, Z.; Xie, D. Removal of Nitrate in Simulated Water at Low Temperature by a Novel Psychrotrophic and Aerobic Bacterium, Pseudomonas taiwanensis Strain J. BioMed Res. Int. 2018, 2018, 1–9. [Google Scholar] [CrossRef]
- Cao, Z.; Huang, F.; Zhang, R.; Zhao, X.; Wang, Y.; Wu, Y.; Liao, X.; Feng, Y.; Ma, J.; Lan, T. Nitrogen removal characteristics of heterotrophic nitrification-aerobic denitrification bacterium Acinetobacter ZQ-A1 and community characteristics analysis of its application in pig farm wastewater. Environ. Sci. Pollut. Res. 2023, 30, 104029–104042. [Google Scholar] [CrossRef]
- Liu, Y.Q.; Zhang, Y.Y.; Zhan, X.Q.; Li, Y.Y.; Chen, Y.Z.; Chen, Q.H. Screening and identification of a heterotrophic nitrification-aerobic denitrification strain L3 and its denitrification characteristics. Water Treat. Technol. 2023, 49, 94–100. [Google Scholar] [CrossRef]
- Chen, Z.; Jiang, Y.; Chang, Z.; Wang, J.; Song, X.; Huang, Z.; Chen, S.; Li, J. Denitrification characteristics and pathways of a facultative anaerobic denitrifying strain, Pseudomonas denitrificans G1. J. Biosci. Bioeng. 2020, 129, 715–722. [Google Scholar] [CrossRef]
- Liu, Y.; Ai, G.M.; Wu, M.R.; Li, S.-S.; Miao, L.-L.; Liu, Z.-P. Photobacterium sp. NNA4, an efficient hydroxylamine-transforming heterotrophic nitrifier/aerobic denitrifier. J. Biosci. Bioeng. 2019, 128, 64–71. [Google Scholar] [CrossRef]
- Zhang, Y.H.; Dong, X.B.; Liu, X.Y.; Xu, J.Q.; Xu, Z.L. Isolation and denitrification characteristics of a novel heterotrophic nitrification-aerobic denitrification bacteria Paracoccus sp. QD-19. Biotechnol. Bull. 2023, 39, 301–310. [Google Scholar] [CrossRef]
- Chen, J.; Xu, J.; Zhang, S.; Liu, F.; Peng, J.; Peng, Y.; Wu, J. Nitrogen removal characteristics of a novel heterotrophic nitrification and aerobic denitrification bacteria, Alcaligenes faecalis strain WT14. J. Environ. Manag. 2021, 282, 111961. [Google Scholar] [CrossRef]
- Lei, X.; Jia, Y.; Chen, Y.; Hu, Y. Simultaneous nitrification and denitrification without nitrite accumulation by a novel isolated Ochrobactrum anthropic LJ81. Bioresour. Technol. 2019, 272, 442–450. [Google Scholar] [CrossRef]
- Wei, B.; Luo, X.; Ma, W.; Lv, P. Biological nitrogen removal and metabolic characteristics of a novel cold-resistant heterotrophic nitrification and aerobic denitrification Rhizobium sp. WS7. Bioresour. Technol. 2022, 362, 127756. [Google Scholar] [CrossRef]
- Wu, L.; Ding, X.; Lin, Y.; Lu, X.; Lv, H.; Zhao, M.; Yu, R. Nitrogen removal by a novel heterotrophic nitrification and aerobic denitrification bacterium Acinetobacter calcoaceticus TY1 under low temperatures. Bioresour. Technol. 2022, 353, 127148. [Google Scholar] [CrossRef]
- Huang, F.; Pan, L.; Lv, N.; Tang, X. Characterization of novel Bacillus strain N31 from mariculture water capable of halophilic heterotrophic nitrification-aerobic denitrification. J. Biosci. Bioeng. 2017, 124, 564–571. [Google Scholar] [CrossRef]
- Gu, X.; Leng, J.; Zhu, J.; Wu, P.; Xing, Q.; Tang, K.; Li, X.; Hu, B. Influence mechanism of C/N ratio on heterotrophic nitrification- aerobic denitrification process. Bioresour. Technol. 2022, 343, 126116. [Google Scholar] [CrossRef]
- Yang, T.; Xin, Y.; Zhang, L.; Gu, Z.; Li, Y.; Ding, Z.; Shi, G. Characterization on the aerobic denitrification process of Bacillus strains. Biomass Bioenergy 2020, 140, 105677. [Google Scholar] [CrossRef]
- Xia, L.; Li, X.; Fan, W.; Wang, J. Heterotrophic nitrification and aerobic denitrification by a novel Acinetobacter sp. ND7 isolated from municipal activated sludge. Bioresour. Technol. 2020, 301, 122749. [Google Scholar] [CrossRef]
- Yang, Q.; Yang, T.; Shi, Y.; Xin, Y.; Zhang, L.; Gu, Z.; Li, Y.; Ding, Z.; Shi, G. The nitrogen removal characterization of a cold-adapted bacterium: Bacillus simplex H-b. Bioresour. Technol. 2021, 323, 124554. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Zeng, M.; Zou, W.; Jiang, W.; Kahaer, A.; Liu, S.; Hong, C.; Ye, Y.; Jiang, W.; Kang, J.; et al. A new strategy to simultaneous removal and recovery of nitrogen from wastewater without N2O emission by heterotrophic nitrogen-assimilating bacterium. Sci. Total Environ. 2023, 872, 162211. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, Y.; Fu, L.; Gao, Y.; Zhao, H.; Zhou, W. Aerobic-heterotrophic nitrogen removal through nitrate reduction and ammonium assimilation by marine bacterium Vibrio sp. Y1-5. Bioresour. Technol. 2017, 230, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Falcone, P.M.; Imbert, E. Tackling Uncertainty in the Bio-Based Economy. Int. J. Stand. Res. 2019, 17, 74–84. [Google Scholar] [CrossRef]








| Level | A | B | C | D |
|---|---|---|---|---|
| Temperature (°C) | Salinity (‰) | C/N | pH | |
| 1 | 30 | 13 | 10 | 7.0 |
| 2 | 35 | 16 | 20 | 8.0 |
| 3 | 40 | 19 | 30 | 9.0 |
| Gene | Primer Sequence (5′–3′) | Fragment Length (bp) |
|---|---|---|
| narG | narG-F: CGTGTTCATCGCCTACTACCTGAG | 4097 |
| narG-R: GGCTTGGTCTCGACGTTGTTGA | ||
| narH | narH-F: CAAGGACGGCATGGTGATGATGT | 2247 |
| narH-R: ACGGCAGCAGCGACAGGTAT | ||
| narI | narI-F: GGCGTCCACCGAACAACCATT | 884 |
| narI-R: TTGACCTTCAGTTGCGGCAGTT | ||
| nirS | nirS-F: CCACGCAGCCCTTGTTCTTGA | 2050 |
| nirS-R: CGCACGCTATTCACAGTTGGAAG | ||
| norB | norB-F: CCATGCCGCAGTTCCATCTCA | 1774 |
| norB-R: TCGCCGTTGAACCAGGACAC | ||
| nasC | nasC-F: CCTGATCTACGGCAAGCGAGTG | 3075 |
| nasC-R: CGGACGGACAGTGCTCCAGTAT | ||
| nasD | nasD-F: CTGCTTGGGTTCTCCCGACAATC | 2673 |
| nasD-R: ATATCCAGCCAGTTCATCGGTTCAC | ||
| nasE | nasE-F: ACAGCCGCAATTGAAGAAGGAGTT | 546 |
| nasE-R: TGTTCGATCAGGACGCCACAAC | ||
| glnA | glnA-F: CGGAGTGGCAGGTTCTGACGAA | 1579 |
| glnA-R: TTGGCGTTGGTGATTTGGCTGTT | ||
| gltB | gltB-F: TGGCGCAGCAGCTTCTTCTTC | 4654 |
| gltB-R: GCCTCCCTTTGCCTGTCGAAA | ||
| gltD | gltD-F: AAGGGCCGCTATTGTCGCAAAG | 1640 |
| gltD-R: CGTCGGTTCTGGCTGGTGAAAC | ||
| gdhB | gdhB-F: GCTTCTGCTGAACTTCATGGACG | 5063 |
| gdhB-R: ACCGCAAACACCGCAGGTT | ||
| gdhA | gdhA-F: AAGTGGAGAACATCGTCGCCTTC | 1569 |
| gdhA-R: CCGCCTGGCTTGTTAGAGTCAC |
| Experiment Number | A | B | C | D | Nitrite Degradation Efficiency (%) |
|---|---|---|---|---|---|
| 1 | 1 | 1 | 1 | 1 | 78.76 ± 0.51 |
| 2 | 1 | 2 | 2 | 2 | 92.38 ± 0.05 |
| 3 | 1 | 3 | 3 | 3 | 23.2 ± 7.37 |
| 4 | 2 | 1 | 2 | 3 | 91.56 ± 0.07 |
| 5 | 2 | 2 | 3 | 1 | 85.95 ± 5.25 |
| 6 | 2 | 3 | 1 | 2 | 74.04 ± 1.69 |
| 7 | 3 | 1 | 3 | 2 | 86.31 ± 0.89 |
| 8 | 3 | 2 | 1 | 3 | 47.79 ± 5.17 |
| 9 | 3 | 3 | 2 | 1 | 16.72 ± 7.05 |
| K1 | 64.78 | 85.54 | 66.86 | 60.48 | |
| K2 | 83.85 | 75.37 | 66.89 | 84.24 | |
| K3 | 50.27 | 37.99 | 65.15 | 54.18 | |
| R | 33.58 | 47.56 | 1.73 | 30.06 | |
| Priority of factors | B > A > D > C | ||||
| Optimal composition | A2 B1 C2 D2 | ||||
| Strain Name | Origin of Strains | Optimal Temperature (°C) | Optimal pH | Nitrite Concentration (mg/L) | Degradation Efficiency (%) | References |
|---|---|---|---|---|---|---|
| Pseudomonas aeruginosa DM6 | Aquaculture seawater | 30–35 | 7.0–10.0 | 350 | 50.54 | |
| 150 | 100 | |||||
| Acinetobacter bereziniae ZQ-A1 | Bioreactor | 25–35 | 8.0–9.0 | 200 | 87.13 | [28] |
| Pseudomonas qingdaonensis L3 | Pond sediment | 29.1 | 6.2 | 150 | 85.34 | [29] |
| Pseudomonas denitrificans G1 | Aquaculture ecosystem | 30 | 7.0–9.5 | 140 | 99.96 | [30] |
| Photobacterium ganghwense NNA4 | Aquaculture seawater | 30 | 7.0 | 139 | 100 | [31] |
| Klebsiella oxytoca TN-10 | Tanyard waste | 30 | 7.0 | 101 | 99.87 | [25] |
| Paracoccus pantotrophus QD-19 | Activated sludge | 30 | 7.0 | 100 | 99 | [32] |
| Acinetobacter junii YB | Activated sludge | 37 | 7.5 | 100 | 87.01 | [24] |
| Alcaligenes faecalis WT14 | Constructed wetland | 20.3 | 8.4 | 100 | 100 | [33] |
| Bacillus megaterium S379 | Aquaculture ponds | 20–40 | 7.0–9.0 | 65 | 96.82 | [1] |
| Pseudomonas aeruginosa P-1 | Sludge | 20–30 | 8.0 | 60 | 36.68 | [12] |
| Bacillus cereus GS-5 | Bioreactor | 35 | 7.5 | 50 | 83.8 | [6] |
| Ochrobactrum anthropic LJ81 | Living sludge | 30 | 5.0–9.0 | 50 | 99.8 | [34] |
| Rhicobium pusense WS7 | Activated sludge | 15–30 | 7.0 | 50 | 100 | [35] |
| Acinetobacter calcoaceticus TY1 | Activated sludge | 8 | 6.0–8.0 | 35 | 97.51 | [36] |
| Bacillus litoralis N31 | Shrimp aquatic water | 30 | 7.5–8.5 | 20 | 89.3 | [37] |
| Acinetobacter junii ZHG-1 | Landfill leachate | 30 | 9.0 | 50 | 96.7 | [38] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Z.; Yu, W.; Zhan, Y.; Chen, Z.; Han, T.; Song, W.; Zhou, Y. Nitrite Degradation by a Novel Marine Bacterial Strain Pseudomonas aeruginosa DM6: Characterization and Metabolic Pathway Analysis. Water 2024, 16, 784. https://doi.org/10.3390/w16050784
Chen Z, Yu W, Zhan Y, Chen Z, Han T, Song W, Zhou Y. Nitrite Degradation by a Novel Marine Bacterial Strain Pseudomonas aeruginosa DM6: Characterization and Metabolic Pathway Analysis. Water. 2024; 16(5):784. https://doi.org/10.3390/w16050784
Chicago/Turabian StyleChen, Zhe, Wenying Yu, Yingjian Zhan, Zheng Chen, Tengda Han, Weiwei Song, and Yueyue Zhou. 2024. "Nitrite Degradation by a Novel Marine Bacterial Strain Pseudomonas aeruginosa DM6: Characterization and Metabolic Pathway Analysis" Water 16, no. 5: 784. https://doi.org/10.3390/w16050784
APA StyleChen, Z., Yu, W., Zhan, Y., Chen, Z., Han, T., Song, W., & Zhou, Y. (2024). Nitrite Degradation by a Novel Marine Bacterial Strain Pseudomonas aeruginosa DM6: Characterization and Metabolic Pathway Analysis. Water, 16(5), 784. https://doi.org/10.3390/w16050784
