Next Article in Journal
Aquatic Mercury Pollution from Artisanal and Small-Scale Gold Mining in Sub-Saharan Africa: Status, Impacts, and Interventions
Next Article in Special Issue
Optimizing Reverse Osmosis Feed Spacer Design for Enhanced Dimethylphenol Removal from Wastewater: A Study of Hydrodynamics and Performance Indicators
Previous Article in Journal
Analyses of Morphological Differences between Geographically Distinct Populations of Gymnodiptychus dybowskii
Previous Article in Special Issue
The Identification of Selective Pathogenic Microbial Community Biofilms in Different Distribution Pipeline Materials and Their Disinfection Kinetics
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 16
Issue 5
10.3390/w16050757
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nitrogen Removal Mechanism and Microbial Community Changes of the MBR Bioaugmented with Two Novel Fungi Pichia kudriavzevii N7 and Candida tropicalis N9

by
Minglei Ma
1,
Qiang Gui
1,
Weisheng Zheng
1,
Yingjie Zhang
2 and
Kai Wang
2,*
1
China Construction Eighth Engineering Division Corp., Ltd., Shanghai 200112, China
2
School of Marine Science and Technology, Harbin Institute of Technology, Weihai 264209, China
*
Author to whom correspondence should be addressed.
Water 2024, 16(5), 757; https://doi.org/10.3390/w16050757
Submission received: 30 January 2024 / Revised: 21 February 2024 / Accepted: 26 February 2024 / Published: 2 March 2024
(This article belongs to the Special Issue Advanced Technologies for Wastewater Treatment and Water Reuse)
Browse Figures
Versions Notes

Abstract

:
Ammonia nitrogen wastewater causes dissolved oxygen concentrations to decrease and the content of harmful substances to increase. To characterize the application properties of two novel strains of highly efficient ammonium transforming fungi—Pichia kudriavzevii N7 and Candida tropicalis N9—this study used both as compound microbial agents to treat nitrogenous wastewater. Here, we investigated the bioaugmentation effect of compound fungi N7 and N9 in the MBR bioreactor and the effect of N7 and N9 on the fungal and bacterial microbial communities in the system. The results revealed that in the first week after inoculation of N7 and N9, the average removal rate of ammonium in the experimental and control groups were 89.43% and 82.86%, respectively, and the NO3−-N accumulation concentrations were 12.56 mg·L−1 and 17.73 mg·L−1, respectively. The average transformation rate of total nitrogen in the experimental and control groups were 46.32% and 30.6%, respectively. ITS sequencing results indicated that N9 could be a dominant fungus in the complex MBR system. The results of 16S rRNA sequencing showed that the dominant bacterial communities in the system were changed by the inoculation of compound fungi. Therefore, the compound fungi can be applied to strengthen the treatment of nitrogenous wastewater due to its compatibility.

1. Introduction

Increasing economic development and urbanization have prompted humanity to enjoy unprecedented material satisfaction. At the same time, however, sustained population growth and rapid industrial development in many countries have put increasing pressure on the environment. Multiple pollutants produced by industrial activities are often harmful and even carcinogenic and mutagenic [1]. Although ammonium is a nutrient in nature, excessive amounts of it in water—which is discharged directly with domestic sewage into sewers, rivers and oceans in some areas—poses a serious threat to the entire ecosystem [2,3]. This kind of pollutant is toxic to some aquatic plants and fish and also rapidly consumes dissolved oxygen in water that is then used by algae, leading to eutrophication of water bodies [4,5]. Excessive nitrogen in the environment also causes changes in the nutrient cycle in nature [6,7]. Therefore, it is necessary to remove ammonium from the environment.
Presently, denitrification systems, nitrification, biosorption, biofiltration, ion exchange and absorption are applied for ammonium elimination from wastewater. The biological treatment systems are always considered to be economically and efficiently in the existing denitrification method for ammonium removal [8]. The current mainstream processes of biological treatments are activated sludge and biofilm. However, the limited types of indigenous microorganisms capable of transforming ammonium in a treatment system or polluted environment can lead to unsatisfactory effluent quality, especially for livestock and poultry wastewater because of its large amount of excess nutrients. Bioaugmentation—a technique to introduce microorganisms with specific functions into bioreactors or contaminated areas to help remove specific pollutants [9]—makes up for this shortcoming. Bioaugmentation technology has been widely researched and applied in various environmental remediation. Han et al. summarized the main strategies of accelerating the formation of aerobic granular sludge, wherein bioaugmentation technology showed great potentials in accelerating granulation [10]. Yang et al. used bacterial consortium targeting NPEO and NP for bioaugmentation to control endocrine disrupting toxicity; here, enriched bacterial consortia acclimated using NPEO and NP were added into activated sludge to investigate the toxicity controlling effect. The results showed the bacterial consortia could remove more than 98% of NPEO and NP (both 10 mg L−1) after 48 h [11]. Boonnorat et al. compared the biodegradation efficiency of organic compounds in two-stage activated sludge systems with (bioaugmented) and without aged sludge bioaugmentation (non-bioaugmented). They reported that both systems had good capacity of degrading the organic compounds but that the efficiency of bioaugmented system was higher than that of the non-bioaugmented one [12]. It is suggested bioaugmentation is a feasible and reasonable strategy to enhance the treatment of ammonium-contaminated wastewater.
Most of the microorganisms used for bioaugmentation are screened out from the environment. Ammonium transformation bacteria, with the advantages of wide distribution and easy isolation from natural environment, have previously been focuses of bioaugmentation, such as Rhodococcus [13], Acinetobacter [14], Bacillus methylotrophicus [15], Pseudomonas and Aeromonas [16]. Moreover, their diversity and function in wastewater treatment have been investigated intensively.
However, the ecology, abundance and role of fungi have often been neglected; only a limited number of studies have been carried out to research the application of fungi for bioaugmentation. Djelal et al. discovered that both removal of COD and the wastewater biodegradability were enhanced through bioaugmentation of fungal consortia containing Galactomyces geotrichum, Mucor hiemalis and Aspergillus niger [17]. Compared with bacteria, fungi have the merits of strong adaptability to the unfavorable environment (such as low pH, fluctuating hydraulic load, etc.) as well as a faster reaction rate [18,19]. They can also secrete large amounts of enzymes function to degrade a wide variety of environmental pollutants [20]. Therefore, it is demonstrated that bioaugmentation of fungi can effectively promote treatment efficiency and adaptability of an external environment, such as activated sludge. However, due to the limited technologies of screening optimal fungi and keeping them active in the complex wastewater environment, fungi still cannot be applied widely in practical wastewater treatment. Meanwhile, the mechanism relevant to the target pollutant removal is also in its infancy [21]. Lately, bioaugmentation of constructing fungi-bacteria mixed consortia was proposed, which could solve and improve nitrogen removal efficiency in MBR by embedding selected strains or mixed cultures into reactors to enhance the catabolism of specific compounds [22,23,24]. Therefore, it is necessary to study the biological enhancement of fungi-bacteria mixed consortia in nitrogenous wastewater treatment.
In this study, two novel high-efficiency ammonium-transforming fungi, N7 and N9, were inoculated into the nitrogen-containing wastewater in the MBR system for bioaugmentation through immobilizing on the polypropylene materials, with the aim of enhancing the nitrogen removal efficiency of the whole system. This was the first time embedding mixed yeasts of N7 and N9 into the MBR system to improve the efficiency of nitrogen removal while their feasibility and bioaugmentation performance in this complex system were examined. Moreover, the changes of microbial communities due to extraneous organisms during the experiment were also monitored. In fact, there is still a long way to apply a specific function and efficient strain to wastewater treatment by biofortification. Therefore, it is of great practical significance to study the processing properties of these new strains and their adaptability in indigenous microbial communities.

2. Materials and Methods

2.1. Inoculum Sludge and Synthetic Wastewater

The activated sludge used in this experiment was collected from a municipal wastewater treatment plant (WWTP) in Weihai, China. The samples of activated sludge were cultivated in a sequencing batch reactor (SBR) to increase biomass content.
The experimental wastewater used in the MBR systems was synthetic wastewater containing the following: 0.4124 g glucose, 0.25 g (NH4)2SO4, 0.03 g KH2PO4, 0.045 g NaCl, 0.05 g NaHCO3, 0.11 g Na2CO3, 0.055 g MgSO4·7H2O, 0.2·10−3 g ZnSO4·7H2O, 0.2·10−3 g FeSO4·7H2O, 0.2·10−3 g CuSO4·5H2O, pH 7.5–8.5 and 1 L tap water. The main reagents used in the study were produced by Sinopharm Chemical Reagent Co. Ltd., Shanghai, China.

2.2. MBR Systems Description

Two lab-scale MBR devices, each with a volume of 11 L, were built in the laboratory (Figure 1). Firstly, the experimental water was supplied in an inlet tank and pumped into the MBR reactors by submersible pumps. Then, the simulated wastewater was treated by microorganisms in the MBR systems before finally being extracted by peristaltic pumps (Baoding Chuangrui Pump Industry Co., Ltd., Baoding, China) through the membrane modules. MBR systems adopted the intermittent operation mode of 8 min operation and 2 min suspension to maintain the membrane modules [25]. An aerator was arranged at the bottom of the bioreactor to provide dissolved oxygen (DO). Polyvinylidene fluoride (PVDF) hollow fiber membrane was used as membrane modules in the reactor while a pressure gauge for monitoring the transmembrane pressure (TMP) was being installed. When the value of it reached 30 KPa, the membrane was washed. Samples from the influent and effluent were taken daily to measure the concentration of ammonium, nitrate, nitrite and total nitrogen. The operational parameters adopted in the MBR system are presented in Table 1. Additionally, polypropylene carrier was determined to be seeded into the MBR system together with the compound strains for forming biofilm to promote the removal rate of ammonium nitrogen.

2.3. Screening and Identification of Ammonium Transforming Strains

Two sediment samples were collected in July 2022 from the sewage outlets of the international beach in Weihai, China (E 122.0749°/N 37.5407° and E 122.0750°/N 37.5407). In the enrichment medium, 5% ammonium sulfate solution was added every day to eliminate the strain that could not utilize NH4+. After enrichment, the optimal enrichment culture solution was used for strain isolation, wherein a single colony was purified and obtained on the ammonia nitrogen-isolation solid medium. Then, the Nessler’s reagent colorimetric method was used to calculate the ammonium nitrogen transformation rate of the strain [26].
According to comparison of the ammonium nitrogen transformation efficiency, 3 bacterial strains with the highest capacity were selected. After DNA extraction, PCR amplification (ITS1: TCCGTAGGTGAACCTGCGG as forward and ITS4: TCCTCCGCTTATTGATATGC as reverse primer) and sequencing were completed by Shanghai Sangon Biotech company (Shanghai, China). The sequences were contrasted to available sequences in the EzBioCloud database and GenBank database to find model strains with the highest proportion of similarity and completeness.

2.4. Construction of Compound Bioflocculant and Preparation of Inoculating Strains

Three strains with the best ammonium nitrogen removal performance were selected, mixed and co-cultured at the volume ratios of 1:1 and 1:1:1 in the same medium. After 2-day cultivation in a shaker at 28 °C, 120 rpm, the optical density (OD600) of the culture reached 1.0, and the number of the strains was calculated using the colony counting method. The best combination of strains was obtained by contrasting their final ammonium nitrogen removal rates. The optimal ratio of this combination was investigated in the same way as the former.
To remove the existing nitrogen, the cell suspension of the compound strains from their 2-day-cultivation mixed-culture medium was centrifuged at 3000 rpm for 10 min, followed by washing with normal saline and centrifuged for 3 times. Finally, the above cell suspension was seeded into the MBR reactors. The polypropylene carrier was seeded into the MBR system together with the compound strains for forming biofilm to promote the removal rate of ammonium nitrogen.

2.5. Analytical Methods for Water Quality

The daily samples of influent and effluent were collected and analyzed directly. The concentrations of nitrogen species (total nitrogen, NH4+-N, NO3−-N and NO2−-N) and chemical oxygen demand (COD) were monitored in accordance with the standard methods [27], while DO and pH were determined using a pH meter (STARTER 3100, Ohaus Instruments Co., Ltd., Shanghai, China) and a DO meter (Multi 3620 JDS, German WTW Instrument Co., Ltd., Munich, Germany), respectively. MLSS and SV30 were measured according to the weight method and 30-min settlement method [26].

2.6. Microbial Community Analysis

The community structure of bacteria and fungi was analyzed by 16S rRNA and ITS gene amplicon sequencing. Five sludge samples were collected from the reactors on day 2 and day 16 to determine the effect of the addition of fungi N7 and N9 on the evolution of community structures. The samples were marked as C2 and C16 (from control MBR), E2 and ES16 (suspended biomass from experimental MBR), and EA16 (attached biofilm from experimental MBR). All sequencing was conducted by Shanghai Majorbio Bio-pharm Technology Co., Ltd., Shanghai, China.
Different levels of the microbial community structure were analyzed on a platform of Majorbio I-Sanger Cloud Platform (www.i-sanger.com) on 1 March 2023. The question sequences were eliminated using the default parameters and the 16S rRNA and ITS sequences were clustered into operational taxonomic units (OTUs) by setting a distance limit of 3%. The alpha diversity (including Shannon, Simpson, Ace, Chao and Coverage, etc.) was used to reflect the richness and diversity of microbial community and the sequencing date depth [28]. The similarity and diversity of microbial composition structure was evaluated based on beta diversity, which was visualized through principal coordinate analysis (PCoA) [29]. The minimum sequence number from samples was chosen as the normalization standard to compare the alpha and beta diversity of different microbe population [30].

3. Results and Discussion

3.1. Strain Screening and Identification

In total, 62 strains were isolated from the coastal zone sediment and screened for the ammonium nitrogen removal ability. Among them, three strains with the best ammonium nitrogen removal performance were selected to construct the compound strains in further study, which were named N6T, N7 and N9, respectively. The DNA fragments of these strains were sequenced and submitted to NCBI GenBank Database under the accession numbers MH368485–MH368487. As contrasted in the EzBioCloud database, the strains N7 and N9 shared 100% sequence identity with Pichia kudriavzevii (KY014444.1) and Candida tropicalis (MG599234.1) separately, while the strain N6T shared 99% sequence identity with Candida sp. (JF896569.1).

3.2. Construction of Compound Strains

The ammonium nitrogen removal rates of strains are largely influenced by the culture environment, which means that mixed culture may increase the microbial diversity in a culture medium, with the possibility of the promotion of the adaptive capacity as well as the activity of these strains [31]. Therefore, it is essential to investigate the symbiotic combination of various microbes to gain the optimal combination of mixed culture with the best ammonium nitrogen removal performance in the MBR system [32,33].
Table 2 presents the ammonium nitrogen removal rates of single strain and compound strains. It shows that when the strain N6T and the strain N7 were mixed in the medium, their compound strains presented lower ammonium nitrogen removal rates than any single strain, probably because of the antagonism or mutual competition among these organisms, which affected their growth and metabolism. Meanwhile, the combination of N7 and N9 showed the best performance, which could be ascribed to the mutual promotion among them as previous study [34]. It has been reported that in the co-culture environment, some strains would present the capacity of synthesizing the nutrients for other organisms while secreting some enzymes to contribute themselves to meet their nutrient demands in the complex culture medium, reaching a higher level of biological activity than single strain [32].
Based on the former experimental results, the combination of N7 and N9 was selected and their optimal ratio of mixed culture was also explored (Table 2). It was found that the ammonium nitrogen removal efficiency was lower with the increasing proportion of the strain N7, and the best efficiency was obtained with the ratio of 2:1 (N9:N7), which would be chosen as the compound strains to be inoculated into a MBR system as a kind of functional organisms of bioaugmentation.

3.3. Ammonium Nitrogen

The influent ammonium concentration was 49–52 mg·L−1. From Figure 2A, it can be seen that, within the first week, the ammonium nitrogen removal rate of the experimental system through bioaugmentation was enhanced compared with the control system. Therefore, the process of bioaugmentation was divided into two stages and the first week was determined as stage 1. After the application of the bioaugmentation, the favorable ammonium removal rate was monitored in the experimental system during stage 1, with an average of 90.11%, resulting in the ammonium nitrogen concentration ranging from 1.14 to 7.14 mg·L−1. The enhancement of ammonium nitrogen removal could be connected to the addition of the inoculated compound strains (N7 and N9). Therefore, it was reasonable to conclude that these compound strains, along with the strategy of biofilm carriers, effectively improved the ammonium nitrogen transformation of the system. Similarly, previous studies illustrated that the application of bioaugmentation in various reactors obtained a better rate of ammonium nitrogen removal than the control systems [35,36,37].
In stage 2, although the performance of the experimental group was still better than control group, there was little difference between their ammonium nitrogen rates, with an average of 82.35% and 81.39%, respectively. Li et al. built complex fora with ammonium nitrogen transforming bacteria and flocculant producing bacteria; the ammonium nitrogen transformation rate was 85.43–89.84% [38]. Similar results indicated that bioaugmentation with ammonium nitrogen transforming bacteria was an effective method to remove nitrogen from wastewater [39,40,41].
Through the figures of this experiments from the 10th to 14th day of the experimental group, it was found that the ability of ammonium nitrogen transformation reduced gradually. It could be inferred that the weakening of the inoculated strains also happened gradually, which might be relevant to the competition among the inoculated strains [42] and indigenous organisms, as well as the loss of dominant strains, leading to the transformation performance being leveled off. Therefore, it is suggested that dosage of the compound strains every 8 days may be helpful to keep the activity of MBR system.

3.4. Nitrate Nitrogen

Although low concentration of NO3−-N was measured in the effluent, ranging from 2 to 6 mg·L−1, Figure 2B illustrates upward trends in both systems because of the accumulation of nitrate, demonstrating the existence of denitrification. For instance, the average accumulation concentration of nitrate in the whole experiment and in stage 1 was about 19.71 mg·L−1 and 12.56 mg·L−1, respectively. The advantageous capacity of the inoculated strains to mitigate the accumulation of NO3−-N decreased gradually, which totally disappeared in the 10th day. Therefore, we considered that the bioaugmentation strains might be answerable for the higher NO3−-N removal rate to some extent in stage 1. To date, massive novel microorganisms with great ability to remove NO3−-N in wastewater have been researched, such as Janthinobacterium [43], Pseudomonas nicosulfuronedens D1-1 [44] and Pseudomonas tolaasii Y-11 [45], but the species of yeasts were relatively less. Thus, the results of this study could provide a certain reference value. The mechanism of yeast denitrification is also worth further investigation.

3.5. Total Nitrogen

According to Figure 2C, the total nitrogen in both systems has a certain fluctuation, but the treatment effect of the experimental group was generally better than that of the control group, probably because the inoculated fungi had the capacity of a nitrification-promoted NH4+ removal rate so that the accumulation of NO3−-N simulated the efficiency of denitrification process [46]. On the other hand, the biofilm formed by compound fungi and indigenous microorganisms also played a major role in removing total nitrogen. The depth of biofilm limited the dissolved oxygen (DO) and resulted in the formation of DO gradients. Therefore, DO concentration in the inner layer was lower than that of the outside system, providing excellent anaerobic environment for denitrification [47]. However, the distribution of DO in MBR system was not uneven, leading to unstable anaerobic zone that correspondingly caused dissimilar levels of denitrification and led to violent fluctuation, as illustrated in Figure 2C [48]. Moreover, the effluent concentration and transformation rate of total nitrogen in the experimental group were approximately 22.82 mg·L−1 and 46.32%, respectively, while the average total nitrogen removal rate was 30.6% in the control group. Combined with Figure 2A, the total nitrogen efficiency in the experimental system might result from N7 and N9’s rapid transformation of ammonium nitrogen. The effluent of both the systems had not reached the first-class requirement of wastewater (15 mg·L−1). Therefore, it is considered that the addition of a special anaerobic zone might tackle this problem because this MBR system was an aerobic reactor.

3.6. COD

The degradation of COD by the experimental system was satisfactory as shown Figure 2D. Whether the compound strains were seeded into the MBR systems, the effluent could meet the first-class standard (50 mg·L−1), indicating that the indigenous microorganisms and the membrane had the capacity of removing organic pollutants. Moreover, the performance of COD elimination in the experimental system was slightly better than in the control system, which could be induced that carbon source was vital to degrade nitrogen so that the higher ammonium removal performance correspondingly caused better COD removal rate.

3.7. Microbial Community Analysis

3.7.1. Diversity of Fungal and Bacterial Communities in the MBR Systems

To obtain the diversity of fungal and bacterial communities, 16S rRNA and ITS gene amplicon sequencing of five samples (C2, E2, C16, ES16 and EA16) collected from two MBR systems were conducted. Additionally, 1861 operational taxonomic units (OTUs) were obtained at 97% sequence similarity, containing 326 OUTs from 16S rRNA sequencing and 1535 OTUs from ITS OTUs. Coverage indices of all samples were more than 0.99, which demonstrates favorable coverage of the sample libraries (Table 3).
With the addition of N7 and N9, the Chao and Ace indices rose in the fungal community at the beginning before decreasing after 16 days. This indicates that inoculated fungi N7 and N9 competed with native microbes in a relatively poorer position so that the richness of wastewater was damaged, which was similar to the decrease of microbial community diversity and richness in a constructed wetland through bioaugmentation [49]. This might correspondingly prove why the former assume that ammonium nitrogen transformation tends to be balanced in the system, as shown in Figure 3a. The indices of bacterial community also demonstrated the same changes, which was similar to the findings of Ou et al. [50] and Liang et al. [51] despite the inoculated microorganisms being fungi. Previous studies assumed that certain fungi would interfere with some bacterial growth [52] and, therefore, they induced a kind of interaction between bacteria and inoculated strains in the experimental system. However, the Shannon Diversity Index illustrated a distinct trend in the fungal and bacterial communities: upward and downward, respectively. This means that the abundance of fungi species was distributed evenly while the bacterial abundance presented the opposite. Moreover, the diversity and richness of biofilm was lower than the suspended biomass, probably because of the aerobic and anoxic region on the biofilm carrier [53] filtered certain microorganisms to subsist.
As shown in Figure 3a the PCoA of fungal communities illustrated that there was a significant difference in the fungal communities (samples E2 and E16) after inoculation with N7 and N9 in contrast to the control group’s communities (samples C2 and C16). In the experimental group, the communities of suspended fungi were similar to the attached fungal communities (samples ES16 and EA16). Among the five samples, the bacterial community was significantly different except for samples ES16 and EA16, as shown in Figure 3b. The composition of the bacterial communities in suspended and attached organisms was similar, which accounted for how they were located close together in the coordinates. These distinguished fungal and bacterial communities indicated that the strategy of inoculating strains had a great impact on the whole community structure in this bioreactor.

3.7.2. Microbial Community Composition in the MBR Systems

The community structure of the five samples (including fungi community and bacteria community) collected from the experimental and control MBR bioreactors were studied using Illumina high throughput sequencing. The results are shown in Figure 4 and Figure 5.
ITS gene sequences identified 4our major fungi phyla and 11 classes in the five samples. The phyla with a richness greater than 1% are exhibited in Figure 4a. At the phylum level, the unclassified sequences took the first place in most of these samples, especially in C2 and C6 (more than 90%), and Basidiomycota, Ascomycota and Zygomycota accounted for the remaining proportion. Specifically, Basidiomycota, reported as a key bacteria group in conventional wastewater treatment, occupied the first place in the classified fungi class in the control system; it was only in the second place in experimental group, where Ascomycota dominated the classified fungi class [54]. This might be directly caused by the introduction of the compound fungi, indicating that the alien microorganism N9 can grow and reproduce well in the system. Moreover, possibly due to the large proportion of indigenous microorganisms and their competitive advantages, Basidiomycota decreased over time. This was consistent with the trend of ammonium transformation over time in the experimental MBR system displayed in Figure 2A. Therefore, in combination with Figure 2A and Figure 4a, it can be concluded that increasing the inoculation amount of N7 and N9, or inoculating at regular intervals, can be considered in practical applications.
It can be seen from Figure 4b that most fungal genera sequences were not classified at the genus level. ITS gene sequencing detected 26 fungal genera in all samples. Of the sequences that have been classified, only Candida, Tichosporon, unclassified-Nectriaceae and Mortierella exhibit a relative abundance over 1%. Furthermore, there were also some differences in the abundances among these five samples. For example, Tichosporon, which possesses the outstanding capacity of degrading complex containments through using extracellular enzymes [55,56] and is frequently isolated from a wide range of substrates, such as the active sludge, biofilms and soil [57,58,59,60], was the dominant classified species in the system without embedding bioaugmentation. Moreover, an increase of this genera was observed after a two-week culture. However, Candida, as another one of the most common identified fungal pathogens in activated sludge, occupied the most proportion of the whole system in E2, ES16 and EA16. Although many reports have indicated that the relative abundance of Candida in activated sludges may mainly derive from municipal wastewater [53], it is reasonable to hypothesize that its presence in the experimental system was largely because of bioaugmentation and its ability to reduce ammonium and nitrates that consisted of higher ammonium transformation rates at early stages of this system (Figure 2). Trichosporon occupied a relatively high proportion in the control MBR system. It seems that Pichia kudriavzevii has not been found through ITS gene sequences, probably because N7 contributes to the transformation of N9. Still, it fails to compete with indigenous microbes in the system and thereby cannot become a dominant genus. It can be inferred from Figure 4 that the fortified microorganisms can also adhered to the carriers to form biofilm together with the indigenous microorganisms. It is further verified by the relative abundance at the genus level of fungi in the experimental system that N7 and N9 can adapt to the complex MBR system and exert its transformation ability, which has the potential to the treatment of nitrogenous wastewater.
It can be analyzed from Figure 5 that there is a notable difference in the sample’s bacterial community. A total of 25 different bacterial phyla was found in the five samples, with relative abundance greater than 1%, including proteobacteria, Bacteroidetes, Parcubacteria, Actinobacteria, Saccharibacteria, Acidobacteria, Verrucomicrobia, Gemmatimonadetes, Chloroflexi, Planctomycetes and Cyanobacteria. There were obvious differences in the bacterial communities in the MBR system between the control and experimental groups at the phylum level (Figure 5a). The bacterial phyla Proteobacteria and Bacteroidetes were dominant in all systems, which almost accounts for more than 50% in all samples. Proteobacteria and Bacteroidetes are common dominant categories in wastewater treatment. It has been reported that Proteobacteria plays an important role in the removal of organic substances [61]. Bacteroidetes was conducive to promoting the hydrolysis of macromolecules into small molecules [62]. Actinabacteria (about 20–30%) was also a dominant phylum in the control MBR system, while accounting accounts for less than 10% of the experimental system. Parcubacteria was the unique dominant bacteria at the phylum level in the experimental system. The addition of alien microbes presumably promoted the growth of the Parcubacteria and inhibited the Actinabacteria from the bacterial community bar plot at the phylum level.
At the class level, 46 different bacterial classes were identified in all samples. Among the classes, Sphingobacteriia, Actinobacteria, Gammaproteobacteria, Beteproteobacteria, Alphaproteobacteria and no rank Saccharibacteria had the highest relative abundance in the five samples. In particular, no rank Parcubacteria was a unique class in the experimental MBR system. Actinobacteria accounted for a small component in the experimental group.
A total of 208 different bacterial genera were detected in the five samples. The bar plot of bacterial communities at the genus level is presented in Figure 4b. Samples C2, E2, C16, ES16 and EA16 discovered 176, 193, 181, 172 and 178 genera, respectively, via 16s rRNA gene sequences. This suggests that biofortification with N7 and N9 may stimulate increased diversity of bacterial communities in water treatment. However, how long the influence of compound fungi on the bacterial community can be maintained needs to be further studied. The dominant genera were different between the experimental system and control system. The most abundant genus in the experimental MBR system were norank-Parcubacteria, Ferruginibacter, Rhizabacter and no rank Saccharibacteria, while Nakamurella, no rank Saccharibacteria, Candidatus-Alysiosphaera and Rhodanobacter were the most abundant in the control MBR system.

4. Conclusions

Through bioaugmentation, the compound fungi N7 and N9 have a positive application value in the treatment of nitrogen-containing wastewater. In this study, the transformation of ammonium and total nitrogen in the MBR bioreactor was accelerated by the novel compound fungi N7 and N9, and the accumulation of nitrate could be controlled. The results demonstrate the feasibility of N7 and N9 treatment of nitrogenous wastewater using bioaugmentation.
(1)
In the first week of the experiment, the ammonium removal rate of the MBR system inoculated with N7 and N9 increased and the effluent concentration of NO3−-N was reduced compared to the MBR system without inoculation of the compound fungi.
(2)
Through ITS gene sequencing, it was observed that N9 could survive in MBR-containing activated sludge for a long time, Moreover, N9 was also observed to form biofilm with other microorganisms and maintain the population advantage, demonstrating good adaptability.
(3)
High throughput sequencing results illustrated that the addition of N7 and N9 caused the original community structure to be altered, enriching the fungal communities. It should not be ignored that N7 and N9 also have an important impact on the change of bacterial community structure in the MBR system.
(4)
Combined with the results of ITS gene sequencing and ammonium transformation characteristics, it is speculated that the compound fungi N7 and N9 inoculated every 8 days might achieve better results in practical application.

Author Contributions

Conceptualization, Y.Z. and K.W.; methodology, W.Z.; validation, Q.G.; resources, M.M.; data curation, K.W.; writing—original draft preparation, M.M.; writing—review and editing, K.W.; supervision, Q.G.; project administration, M.M.; funding acquisition, K.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Science and Technology Research of China Construction Eighth Engineering Division, grant number 2023-4-04.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare that this study received funding from China Construction Eighth Engineering Division Corp., Ltd. The funder had the following involvement with the study: writing—original draft preparation; methodology; validation and supervision.

Abbreviations

MBRmembrane bioreactor
DOdissolved oxygen
HRThydraulic retention time
CODchemical oxygen demand
MLSSmixed liquor suspended solids
ITSinternal transcribed spacer

References

  1. Bernet, N.; Delgenes, N.; Akunna, J.C.; Delgenes, J.P.; Moletta, R. Combined anaerobic–aerobic sbr for the treatment of piggery wastewater. Water Res. 2000, 34, 611–619. [Google Scholar] [CrossRef]
  2. Zou, J.L.; Dai, Y.; Sun, T.H.; Li, Y.H.; Li, G.B.; Li, Q.Y. Effect of amended soil and hydraulic load on enhanced biological nitrogen removal in lab-scale SWIS. J. Hazard. Mater. 2009, 163, 816–822. [Google Scholar] [CrossRef] [PubMed]
  3. Sarioglu, O.F.; Yasa, A.O.; Celebioglu, A.A. Efficient ammonium removal from aquatic environments by Acinetobacter calcoaceticus STB1 immobilized on an electrospun cellulose acetate nanofibrous web. Green. Chem. 2013, 15, 2566–2572. [Google Scholar] [CrossRef]
  4. Obaja, D.; Macé, S.; Costa, J.; Sans, C.; Mata-Alvarez, J. Nitrification, denitrification and biological phosphorus removal in piggery wastewater using a sequencing batch reactor. Bioresour. Technol. 2003, 87, 103–111. [Google Scholar] [CrossRef] [PubMed]
  5. Wang, W.; Ding, Y.; Wang, Y.; Song, X.; Ambrose, R.F.; Ullman, J.L.; Winfrey, B.K.; Wang, J.; Gong, J. Treatment of rich ammonia nitrogen wastewater with polyvinyl alcohol immobilized nitrifier biofortified constructed wetlands. Ecol. Eng. 2016, 94, 7–11. [Google Scholar] [CrossRef]
  6. Okaiyeto, K.; Nwodo, U.U.; Mabinya, L.V.; Okoh, A.I. Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo. Int. J. Environ. Res. Public. Health 2013, 10, 5097–5110. [Google Scholar] [CrossRef]
  7. Fenn, M.E.; Poth, M.A.; Aber, J.D.; Baron, J.S.; Stottlemyer, R. Nitrogen Excess in North American Ecosystems: Predisposing Factors, Ecosystem Responses, and Management Strategies. Ecol. Appl. 1998, 8, 706–733. [Google Scholar] [CrossRef]
  8. Gu, Y.; Zhang, X.; Deal, B.; Han, L. Biological systems for treatment and valorization of wastewater generated from hydrothermal liquefaction of biomass and systems thinking: A review. Bioresour. Technol. 2019, 278, 329–345. [Google Scholar] [CrossRef]
  9. Ma, F.; Guo, J.; Zhao, L.; Chang, C.; Cui, D. Application of bioaugmentation to improve the activated sludge system into the contact oxidation system treating petrochemical wastewater. Bioresour. Technol. 2009, 100, 597–602. [Google Scholar] [CrossRef]
  10. Han, X.; Jin, Y.; Yu, J. Rapid formation of aerobic granular sludge by bioaugmentation technology: A review. Chem. Eng. J. 2022, 437, 134971. [Google Scholar] [CrossRef]
  11. Yang, R.; He, X.W.; Gan, X.; Qi, Z.D.; Zhang, X.X.; Ren, H.Q. Study on Reducing Endocrine Disrupting Toxicity of NPEO by Bioaugmentation of Bacteria Consortium. Res. Environ. Sci. 2023, 36, 345–353. [Google Scholar] [CrossRef]
  12. Boonnorat, J.; Techkarnjanaruk, S.; Honda, R.; Angthong, S.; Boonapatcharoen, N.; Muenmee, S.; Prachanurak, P. Use of aged sludge bioaugmentation in two-stage activated sludge system to enhance the biodegradation of toxic organic compounds in high strength wastewater. Chemosphere 2018, 202, 208–217. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, P.; Li, J.; Li, Q.X.; Wang, Y.; Li, S.; Ren, T.; Wang, L. Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp. CPZ24. Bioresour. Technol. 2012, 116, 266–270. [Google Scholar] [CrossRef] [PubMed]
  14. Liu, Y.X.; Hu, T.T.; Song, Y.J.; Chen, H.P.; Lv, Y.K. Heterotrophic nitrogen removal by Acinetobacter sp. Y1 isolated from coke plant wastewater. J. Biosci. Bioeng. 2015, 120, 549–554. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, Q.L.; Liu, Y.; Ai, G.; Zheng, H.; Liu, Z. The characteristics of a novel heterotrophic nitrification–aerobic denitrification bacterium, Bacillus methylotrophicus strain L7. Bioresour. Technol. 2012, 108, 35–44. [Google Scholar] [CrossRef]
  16. Schmalenberger, A.; Fox, A. Bacterial Mobilization of Nutrients from Biochar-Amended Soils. Adv. Appl. Microbiol. 2016, 94, 109–159. [Google Scholar] [CrossRef] [PubMed]
  17. Djelal, H.; Amrane, A. Biodegradation by bioaugmentation of dairy wastewater by fungal consortium on a bioreactor lab-scale and on a pilot-scale. J. Environ. Sci. 2013, 25, 1906–1912. [Google Scholar] [CrossRef]
  18. Liu, Y.; Hu, T.; Song, Y.; Chen, H.; Lv, Y. Simultaneous removal of carbon and nitrogen by mycelial pellets of a heterotrophic nitrifying fungus-Penicillium sp. L1. J. Biosci. Bioeng. 2017, 123, 223–229. [Google Scholar] [CrossRef]
  19. Wang, W.; Cao, L.; Tan, H.; Zhang, R. Nitrogen removal from synthetic wastewater using single and mixed culture systems of denitrifying fungi, bacteria, and actinobacteria. Appl. Microbiol. Biol. 2016, 100, 9699–9707. [Google Scholar] [CrossRef]
  20. Espinosa-Ortiz, E.J.; Rene, E.R.; Pakshirajan, K.; Hullebusch, E.D.V.; Lens, P.N.L. Fungal pelleted reactors in wastewater treatment: Applications and perspectives. Chem. Eng. J. 2016, 283, 553–571. [Google Scholar] [CrossRef]
  21. Vantamuri, A.B.; Kaliwal, B.B. Decolourization and biodegradation of Navy blue HER (Reactive Blue 171) dye from Marasmiussp. BBKAV79. Biotechnology 2017, 7, 48. [Google Scholar] [CrossRef]
  22. Mrozik, A.; Piotrowska-Seget, Z. Bioaugmentation as a strategy for cleaning up of soils contaminated with aromatic compounds. Microbiol. Res. 2010, 165, 363–375. [Google Scholar] [CrossRef]
  23. Shi, S.; Fang, M.; Sun, T.; Li, A.; Zhou, J.; Qu, Y. Mineralization and Kinetics of Reactive Brilliant Red X-3B by a Combined Anaerobic–Aerobic Bioprocess Inoculated with the Coculture of Fungus and Bacterium. Appl. Biochem. Biotech. 2014, 172, 1106–1120. [Google Scholar] [CrossRef]
  24. Novotny, E.; Svobodová, K.I.; Benada, O.I.; Kofroňová, O.; Heissenberger, A.; Fuchs, W. Potential of combined fungal and bacterial treatment for color removal in textile wastewater. Bioresour. Technol. 2011, 102, 879–888. [Google Scholar] [CrossRef]
  25. Zsirai, T.; Buzatu, P.; Aerts, P. Efficacy of relaxation, backflushing, chemical cleaning and clogging removal for an immersed hollow fibre membrane bioreactor. Water Res. 2012, 46, 4499–4507. [Google Scholar] [CrossRef]
  26. Balci; Behzat; Ergan, B.; Erkurt, F.E. Magnetite/activated sludge hybrid process for the treatment of dye containing simulated textile wastewater. Desalin. Water Treat. 2023, 286, 101–114. [Google Scholar] [CrossRef]
  27. DZ/T 0064-2021; Methods for Analysis of Groundwater Quality. Ministry of Natural Re-Sources of the People’s Republic of China: Beijing, China, 2021.
  28. Liu, C.; Xie, J.; Song, M.; Gao, Z.; Zheng, D.; Liu, X.; Ning, G.; Cheng, X.; Bruning, H. Nitrogen removal performance and microbial community changes in subsurface wastewater infiltration systems (SWISs) at low temperature with different bioaugmentation strategies. Bioresour. Technol. 2017, 250, 603–610. [Google Scholar] [CrossRef]
  29. Morimura, S.; Zeng, X.; Noboru, N.; Hosono, T. Changes to the microbial communities within groundwater in response to a large crustal earthquake in Kumamoto, southern Japan. J. Hydrol. 2020, 581, 124341. [Google Scholar] [CrossRef]
  30. Du, P.; Du, R.; Ren, W.; Lu, Z.; Zhang, Y.; Fu, P. Variations Variations of bacteria and fungi in PM2.5 in Beijing, China. Atmos. Environ. 2018, 172, 55–64. [Google Scholar] [CrossRef]
  31. Kleerebezem, R.; van Loosdrecht, M.C. Mixed culture biotechnology for bioenergy production. Curr. Opin. Biotech. 2007, 18, 207–212. [Google Scholar] [CrossRef] [PubMed]
  32. More, T.T.; Yadav, J.S.S.; Yan, S.; Tyagi, R.D.; Surampalli, R.Y. Extracellular polymeric substances of bacteria and their potential environmental applications. J. Environ. Manag. 2014, 144, 1–25. [Google Scholar] [CrossRef]
  33. Yin, C.; Meng, F.; Chen, G.H. Spectroscopic characterization of extracellular polymeric substances from a mixed culture dominated by ammonia-oxidizing bacteria. Water Res. 2015, 68, 740–749. [Google Scholar] [CrossRef]
  34. Racz, L.A.; Datta, T.; Goel, R. Effect of organic carbon on ammonia oxidizing bacteria in a mixed culture. Bioresour. Technol. 2010, 101, 6454–6460. [Google Scholar] [CrossRef] [PubMed]
  35. Chen, Q.; Ni, J.; Ma, T.; Liu, T.; Zheng, M. Bioaugmentation treatment of municipal wastewater with heterotrophic-aerobic nitrogen removal bacteria in a pilot-scale SBR. Bioresour. Technol. 2015, 183, 25–32. [Google Scholar] [CrossRef] [PubMed]
  36. Vdovina, T.V.; Sirotkin, A.S.; Kobeleva, Y.V.; Gorshkova, E.S. Bioaugmentation of nitrifying microorganisms to increase the efficiency of the oxidation of nitrogen compounds during wastewater biofiltration. Appl. Biochem. Micro. 2020, 56(9), 948–955. [Google Scholar] [CrossRef]
  37. Motamedi, H.; Jafari, M. Screening Heterotrophic Ammonia Removal and Aerobic Denitrifying Bacteria from Wastewater of Ammonia Production Units of a Petrochemical Industry. Curr. Microbiol. 2020, 77, 2207–2214. [Google Scholar] [CrossRef] [PubMed]
  38. Li, R.; Xiao, X.; Zhao, Y.; Tu, B.; Zhang, Y. Screening of efficient ammonia-nitrogen degrading bacteria and its application in livestock wastewater. Biomass Convers. Biol. 2022, 4, 1–9. [Google Scholar] [CrossRef]
  39. Liang, D.H.; Hu, Y.; Liang, D.; Chenga, J.; Chena, Y. Bioaugmentation of moving bed biofilm reactor (mbbr) with achromobacter jl9 for enhanced sulfamethoxazole (smx) degradation in aquaculture wastewater. Ecotox Environ. Saf. 2020, 207, 111258. [Google Scholar] [CrossRef] [PubMed]
  40. Hong, P.; Yang, K.; Shu, Y.; Xiao, B.; Wu, X. Efficacy of auto-aggregating aerobic denitrifiers with coaggregation traits for bioaugmentation performance in biofilm-formation and nitrogen-removal. Bioresour. Technol. 2021, 337, 125391. [Google Scholar] [CrossRef] [PubMed]
  41. Chen, Y.; Wang, S.; Geng, N.; Wu, Z.; Xiong, W.; Su, H. Artificially constructing mixed bacteria system for bioaugmentation of nitrogen removal from saline wastewater at low temperature. J. Environ. Manag. 2022, 324, 116351. [Google Scholar] [CrossRef]
  42. Bouchez, T.; Patureau, D.; Dabert, P.; Juretschko, S.; Doré, J.; Delgenès, P.; Moletta, R.; Wagner, M. Ecological study of a bioaugmentation failure. Environ. Microbiol. 2010, 2, 179–190. [Google Scholar] [CrossRef]
  43. Yang, M.; Lu, D.; Qin, B.; Liu, Q.; Zhao, Y.; Liu, H.; Ma, J. Highly efficient nitrogen removal of a coldness-resistant and low nutrient needed bacterium, Janthinobacterium sp. M-11. Bioresour. Technol. 2015, 256, 366–373. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, A.; Luo, X.; Li, X.; Huang, D.; Huang, Q.; Zhang, X.X.; Chen, W. Bioaugmentation of woodchip bioreactors by pseudomonas nicosulfuronedens d1-1 with functional species enrichment. Bioresour. Technol. 2023, 385, 129309. [Google Scholar] [CrossRef] [PubMed]
  45. He, T.; Li, Z.; Sun, Q.; Xu, Y.; Ye, Q. Heterotrophic nitrification and aerobic denitrification by Pseudomonas tolaasii Y-11 without nitrite accumulation during nitrogen conversion. Bioresour. Technol. 2015, 200, 493–499. [Google Scholar] [CrossRef] [PubMed]
  46. Patureau, D.; Bernet, N.; Moletta, R. Combined nitrification and denitrification in a single aerated reactor using the aerobic denitrifier Commonas sp. strain SGLY2. Water Res. 1997, 31, 1363–1370. [Google Scholar] [CrossRef]
  47. Zhang, X.; Liang, Y.; Ma, Y.; Du, J.; Pang, L.; Zhang, H. Ammonia removal and microbial characteristics of partial nitrification in biofilm and activated sludge treating low strength sewage at low temperature. Ecol. Eng. 2016, 93, 104–111. [Google Scholar] [CrossRef]
  48. Wang, X.; Tian, Y.; Zhao, X.; Peng, S.; Wu, Q.; Yan, L. Effects of aeration position on organics, nitrogen and phosphorus removal in combined oxidation pond-constructed wetland systems. Bioresour. Technol. 2015, 198, 7–15. [Google Scholar] [CrossRef] [PubMed]
  49. Zhao, X.; Yang, J.; Bai, S.; Ma, F.; Wang, L. Microbial population dynamics in response to bioaugmentation in a constructed wetland system under 10 °C. Bioresour. Technol. 2016, 205, 166–173. [Google Scholar] [CrossRef]
  50. Ou, D.; Li, H.; Li, W.; Wu, X.; Wang, Y.; Liu, Y. Salt-tolerance aerobic granular sludge: Formation and microbial community characteristics. Bioresour. Technol. 2018, 249, 132–138. [Google Scholar] [CrossRef]
  51. Liang, J.; Wang, Q.; Li, Q.X.; Jiang, L.; Kong, J.; Ke, M.; Arslan, M.; El-Din, M.G.; Chen, C. Aerobic sludge granulation in shale gas flowback water treatment: Assessment of the bacterial community dynamics and modeling of bioreactor performance using artificial neural network. Bioresour. Technol. 2020, 313, 123687. [Google Scholar] [CrossRef]
  52. Mcfrederick, Q.S.; Mueller, U.G.; James, R.R. Interactions between fungi and bacteria influence microbial community structure in the Megachile rotundata larval gut. Proc. Soc. B-Biol. Sci. 2014, 281, 20132653. [Google Scholar] [CrossRef]
  53. Zheng, G.; Liu, S.; Yang, F.; Han, B.; Furukawa, K. Characterization of functional microbial community in a membrane-aerated biofilm reactor operated for completely autotrophic nitrogen removal. Bioresour. Technol. 2008, 99, 2749–2756. [Google Scholar] [CrossRef]
  54. Niu, L.; Li, Y.; Xu, L.; Wang, P.; Wang, L. Ignored fungal community in activated sludge wastewater treatment plants: Diversity and altitudinal characteristics. Environ. Sci. Pollut. Res. 2016, 24, 1–9. [Google Scholar] [CrossRef]
  55. Felczak, A.; Bernat, P.A.; Alska, S.R.; Lisowska, K. Quinoline biodegradation by filamentous fungus Cunninghamella elegans and adaptive modifications of the fungal membrane composition. Environ. Sci. Pollut. Res. 2016, 23, 8872–8880. [Google Scholar] [CrossRef]
  56. Merlin, C.; Devers, M.; Crouzet, O. Characterization of chlordecone-tolerant fungal populations isolated from long-term polluted tropical volcanic soil in the French West Indies. Environ. Sci. Pollut. Res. 2014, 21, 4914–4927. [Google Scholar] [CrossRef]
  57. Cho, O.; Matsukura, M.; Sugita, T. Molecular evidence that the opportunistic fungal pathogen Trichosporon asahii is part of the normal fungal microbiota of the human gut based on rRNA genotyping. Int. J. Infect. Dis. 2015, 39, 87–88. [Google Scholar] [CrossRef]
  58. Evans, T.N.; Seviour, R.J. Estimating Biodiversity of Fungi in Activated Sludge Communities Using Culture-Independent Methods. Microb. Ecol. 2012, 63, 773–786. [Google Scholar] [CrossRef] [PubMed]
  59. Le, N.C.; Mai, C.T.N.; Minh, N.N.; Ha, H.P.; Lien, D.T.; Tuan, D.V.; Dong, V.Q.; Ike, M.; Uyen, D.T.T. Degradation of sec-hexylbenzene and its metabolites by a biofilm-forming yeast Trichosporon asahii B1 isolated from oil-contaminated sediments in Quangninh coastal zone, Vietnam. J. Environ. Sci. Health A 2016, 51, 267–275. [Google Scholar] [CrossRef]
  60. Liu, Y.-R.; Zheng, Y.-M.; He, J.-Z. Toxicity of profenofos to the springtail, Folsomia candida, and ammonia-oxidizers in two agricultural soils. Ecotoxicology 2012, 21, 1126–1134. [Google Scholar] [CrossRef] [PubMed]
  61. Zheng, D.; Yu, J.S.; Hui, J.L.; Si, D.L.; Ming, J.S.; Wei, X.S. Multistage A-O Activated Sludge Process for Paraformaldehyde Wastewater Treatment and Microbial Community Structure Analysis. J. Chem. 2016, 2016, 2746715. [Google Scholar] [CrossRef]
  62. Luo, X.; Yuan, X.; Wang, S.; Sun, F.; Hou, Z.; Hu, Q.; Zhai, L.; Cui, Z.; Zou, Y. Methane production and characteristics of the microbial community in the co-digestion of spent mushroom substrate with dairy manure. Bioresour. Technol. 2018, 250, 611–620. [Google Scholar] [CrossRef] [PubMed]
Water 16 00757 g001
Figure 1. Schematic diagram of the MBR reactor. (1) Influent tank; (2) submersible pump; (3) aerator; (4) MBR; (5) membrane module; (6) pressure gauge (7) peristaltic pump; (8) effluent tank.
Figure 1. Schematic diagram of the MBR reactor. (1) Influent tank; (2) submersible pump; (3) aerator; (4) MBR; (5) membrane module; (6) pressure gauge (7) peristaltic pump; (8) effluent tank.
Water 16 00757 g001
Water 16 00757 g002
Figure 2. Characteristics of (A) ammonium, (B) nitrate, (C) total nitrogen and (D) COD in the MBR systems.
Figure 2. Characteristics of (A) ammonium, (B) nitrate, (C) total nitrogen and (D) COD in the MBR systems.
Water 16 00757 g002
Water 16 00757 g003
Figure 3. PCoA analysis of communities: (a) fungal community; (b) bacterial community.
Figure 3. PCoA analysis of communities: (a) fungal community; (b) bacterial community.
Water 16 00757 g003
Water 16 00757 g004
Figure 4. The fungal communities at the class level (a) and the genus level (b).
Figure 4. The fungal communities at the class level (a) and the genus level (b).
Water 16 00757 g004
Water 16 00757 g005
Figure 5. Taxonomic classification of bacterial communities at the phylum (a) and genus (b) level.
Figure 5. Taxonomic classification of bacterial communities at the phylum (a) and genus (b) level.
Water 16 00757 g005
Table 1. Operating parameters in MBR systems.
Table 1. Operating parameters in MBR systems.
ParameterUnitsValue
DOmg·L−13–4
HRTh12
CODmg·L−1400
NH4+-Nmg·L−150
MLSSmg·L−14500
Temperature°C30
Table 2. Ammonium nitrogen removal rates of single strains and mixed-culture strains.
Table 2. Ammonium nitrogen removal rates of single strains and mixed-culture strains.
StrainsAmmonium Nitrogen Removal Rate (%)Compound Strains (N9:N7)Ammonium Nitrogen Removal Rate (%)
N6T a75.2 ± 0.8 **1:187.9 ± 1.6 **
N9 b82.1 ± 1.3 **1:286.3 ± 0.9 **
N7 c80.3 ± 0.1 **1:383.9 ± 1.5
N6T + N980.8 ± 0.83:190.2 ± 1.6 **
N6T + N779.7 ± 1.72:194.0 ± 0.6 **
N9 + N788.1 ± 0.4 **
N6T + N9 + N782.7 ± 1.6 **
Notes: a: The strain N6T identified as Candida sp. b: The strain N9 identified as Candida tropicalis. c: The strain N7 identified as Pichia kudriavzevii. **: The data is significant at the 0.01 level.
Table 3. Alpha diversity of the fungal and bacterial communities.
Table 3. Alpha diversity of the fungal and bacterial communities.
FungiChaoAceShannonSimpsonCoverage
C263.9167.561.070.630.99
E268.6773.121.090.520.99
C1697.50125.301.370.510.99
ES1671.8672.722.090.270.99
EA1662.5062.951.660.410.99
BacteriaChaoAceShannonSimpsonCoverage
C2313.55312.123.380.100.99
E2344.63342.903.760.060.99
C16331.89324.403.830.050.99
ES16320.75316.183.400.100.99
EA16319.32319.713.560.070.99
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, M.; Gui, Q.; Zheng, W.; Zhang, Y.; Wang, K. Nitrogen Removal Mechanism and Microbial Community Changes of the MBR Bioaugmented with Two Novel Fungi Pichia kudriavzevii N7 and Candida tropicalis N9. Water 2024, 16, 757. https://doi.org/10.3390/w16050757

AMA Style

Ma M, Gui Q, Zheng W, Zhang Y, Wang K. Nitrogen Removal Mechanism and Microbial Community Changes of the MBR Bioaugmented with Two Novel Fungi Pichia kudriavzevii N7 and Candida tropicalis N9. Water. 2024; 16(5):757. https://doi.org/10.3390/w16050757

Chicago/Turabian Style

Ma, Minglei, Qiang Gui, Weisheng Zheng, Yingjie Zhang, and Kai Wang. 2024. "Nitrogen Removal Mechanism and Microbial Community Changes of the MBR Bioaugmented with Two Novel Fungi Pichia kudriavzevii N7 and Candida tropicalis N9" Water 16, no. 5: 757. https://doi.org/10.3390/w16050757

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop