Variation in Immune-Related Gene Expression Provides Evidence of Local Adaptation in Porites astreoides (Lamarck, 1816) between Inshore and Offshore Meta-Populations Inhabiting the Lower Florida Reef Tract, USA
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials Study Organism, Collection, and Preparation
2.2. Sample Processing and RNA Isolation
2.3. Reverse Transcription
2.4. qRT-PCR Primer Validation and Genes of Interest (GOI)
2.5. Genes of Interest (GOI)
2.6. qRT-PCR Analysis
- Equation (1):count = gene + gene:TransplantationSite + gene:SeasonYear + gene:TranplantationSite:SeasonYear + [sample] + [gene:sample] + [gene:residual]
- Equation (2):count = gene + gene:CollectionSite + gene:SeasonYear + gene:CollectionSite:SeasonYear + [sample] + [gene:sample] + [gene:residual]
3. Results
3.1. Site Temperature Regime
3.2. Effects of Site and Season on Pooled Genes of Interest (GOI) Transcript Abundance
3.3. Specific Responses of the Genes of Interest (GOI)
3.3.1. TRAF3
3.3.2. eIF3H
3.3.3. ACAP2
3.3.4. Summary of Factors Affecting Host Gene Expression in Porites astreoides
4. Discussion
4.1. Activation of Host Coral Immune Pathways: TRAF3 Expression
4.2. Cellular Stress Response: eIF3H Expression
4.3. Adaptive Response to Immune System Activation: ACAP2 Expression
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Burge, C.A.; Eakin, C.M.; Friedman, C.S.; Froelich, B.; Hershberger, P.K.; Hofmann, E.E.; Petes, L.E.; Prager, K.C.; Weil, E.; Willis, B.L.; et al. Climate change influences on marine infectious diseases: Implications for management and society. Ann. Rev. Mar. Sci. 2014, 6, 249–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Groner, M.L.; Maynard, J.; Breyta, R.; Carnegie, R.B.; Dobson, A.; Friedman, C.S.; Froelich, B.; Garren, M.; Gulland, F.M.D.; Heron, S.F.; et al. Managing marine disease emergencies in an era of rapid change. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150364. [Google Scholar] [CrossRef] [Green Version]
- Aeby, G.S.; Shore, A.; Jensen, T.; Ziegler, M.; Work, T.; Voolstra, C.R. A comparative baseline of coral diesease across the central Red Sea. bioRxiv 2021. preprint. [Google Scholar] [CrossRef]
- Howells, E.J.; Vaughan, G.O.; Work, T.M.; Burt, J.A.; Abrego, D. Annual outbreaks of coral disease coincide with extreme seasonal warming. Coral Reefs 2020, 39, 771–781. [Google Scholar] [CrossRef]
- Hewson, I.; Button, J.B.; Gudenkauf, B.M.; Miner, B.; Newton, A.L.; Gaydos, J.K.; Wynne, J.; Groves, C.L.; Hendler, G.; Murray, M.; et al. Densovirus associated with sea-star wasting disease and mass mortality. Proc. Natl. Acad. Sci. USA 2014, 111, 17278–17283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lloyd, M.M.; Pespeni, M.H. Microbiome shifts with onset and progression of sea star wasting disease revealed through time course sampling. Sci. Rep. 2018, 8, 16476. [Google Scholar] [CrossRef] [Green Version]
- Aalto, E.A.; Lafferty, K.D.; Sokolow, S.H.; Grewelle, R.E.; Ben-Horin, T.; Boch, C.A.; Raimondi, P.T.; Bograd, S.J.; Hazen, E.L.; Jacox, M.G.; et al. Models with environmental drivers offer a plausible mechanism for the rapid spread of infectious disease outbreaks in marine organisms. Sci. Rep. 2020, 10, 5975. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Behringer, D.C.; Duermit-Moreau, E. Crustaceans, one health and the changing ocean. J. Invertebr. Pathol. 2020, in press. [Google Scholar] [CrossRef] [PubMed]
- Precht, W.F. Failure to respond to a coral disease epizootic in Florida: Causes and consequences. Rethink. Ecol. 2021, 6, 1–47. [Google Scholar] [CrossRef]
- Strychar, K.B.; Sammarco, P.W. Temperate Marine and Brackish Ecosystems. In Climate Change and Non-infectious Fish Disorders (CCNFD); Woo, P.T.K., Iwama, G.K., Eds.; CAB International: Wallingford, UK, 2020; pp. 1–24. ISBN 978-1786393982. [Google Scholar]
- Sheldon, B.C.; Verhulst, S. Ecological immunology: Costly parasite defences and trade-offs in evolutionary ecology. Trends Ecol. Evol. 1996, 11, 317–321. [Google Scholar] [CrossRef]
- Hawley, D.M.; Altizer, S.M. Disease ecology meets ecological immunology: Understanding the links between organismal immunity and infection dynamics in natural populations. Funct. Ecol. 2011, 25, 48–60. [Google Scholar] [CrossRef]
- Nicholson, L.B. The immune system. Essays Biochem. 2016, 60, 275–301. [Google Scholar] [CrossRef] [Green Version]
- Lirman, D.; Fong, P. Is proximity to land-based sources of coral stressors an appropriate measure of risk to coral reefs? An example from the Florida Reef Tract. Mar. Pollut. Bull. 2007, 54, 779–791. [Google Scholar] [CrossRef]
- Harvell, C.D.; Mitchell, C.E.; Ward, J.R.; Altizer, S.; Dobson, A.P.; Ostfeld, R.S.; Samuel, M.D. Climate warming and disease risks for terrestrial and marine biota. Science 2002, 296, 2158–2162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gleason, D.F. Differential effects of ultraviolet radiation on green and brown morphs of the Caribbean coral Porites astreoides. Limnol. Oceanogr. 1993, 38, 1452–1463. [Google Scholar] [CrossRef] [Green Version]
- Chornesky, E.A.; Peters, E.C. Sexual reproduction and colony growth in the scleractinian coral Porites astreoides. Biol. Bull. 1987, 172, 161–177. [Google Scholar] [CrossRef]
- Thomas, L.; Rose, N.H.; Bay, R.A.; López, E.H.; Morikawa, M.K.; Ruiz-Jones, L.; Palumbi, S.R. Mechanisms of thermal tolerance in reef-building corals across a fine-grained environmental mosaic: Lessons from Ofu, American Samoa. Front. Mar. Sci. 2018, 4, 434. [Google Scholar] [CrossRef] [Green Version]
- Kenkel, C.D.; Aglyamova, G.; Alamaru, A.; Bhagooli, R.; Capper, R.; Cunning, R.; deVillert, A.; Haslun, J.A. Development of gene expression markers of acute heat-light stress in reef-building corals of the genus Porites. PLoS ONE 2011, 6, e26914. [Google Scholar] [CrossRef] [Green Version]
- Kenkel, C.D.; Meyer, E.; Matz, M.V. Gene expression under chronic heat stress in populations of the mustard hill coral (Porites astreoides) from different thermal environments. Mol. Ecol. 2013, 22, 4322–4334. [Google Scholar] [CrossRef]
- Haslun, J.A.; Strychar, K.B.; Buck, G.; Sammarco, P.W. Coral bleaching susceptibility is decreased following short-term (1–3 year) prior temperature exposure and evolutionary history. J. Mar. Biol. 2011, 2011, 1–13. [Google Scholar] [CrossRef]
- Haslun, J.A.; Hauff, B.; Strychar, K.B.; Cervino, J.M. Decoupled seasonal stress as an indication of chronic stress and site dependent responses in Montastraea cavernosa and Porites astreoides inhabiting the Florida Reef Tract. Int. J. Mar. Sci. 2016, 6, 1–20. [Google Scholar] [CrossRef]
- Kenkel, C.D.; Goodbody-Gringley, G.; Caillaud, D.; Davies, S.W.; Bartels, E.; Matz, M.V. Evidence for a host role in thermotolerance divergence between populations of the mustard hill coral (Porites astreoides) from different reef environments. Mol. Ecol. 2013, 22, 4335–4348. [Google Scholar] [CrossRef]
- Guest, J.R.; Baird, A.H.; Maynard, J.A.; Muttaqin, E.; Edwards, A.J.; Campbell, S.J.; Yewdall, K.; Affendi, Y.A.; Chou, L.M. Contrasting patterns of coral bleaching susceptibility in 2010 suggest an adaptive response to thermal stress. PLoS ONE 2012, 7, e33353. [Google Scholar] [CrossRef]
- Barshis, D.J.; Ladner, J.T.; Oliver, T.A.; Seneca, F.O.; Traylor-Knowles, N.; Palumbi, S.R. Genomic basis for coral resilience to climate change. Proc. Natl. Acad. Sci. USA 2013, 110, 1387–1392. [Google Scholar] [CrossRef] [Green Version]
- Howells, E.J.; Beltran, V.H.; Larsen, N.W.; Bay, L.K.; Willis, B.L.; Van Oppen, M.J.H. Coral thermal tolerance shaped by local adaptation of photosymbionts. Nat. Clim. Chang. 2012, 2, 116–120. [Google Scholar] [CrossRef]
- Middlebrook, R.; Hoegh-Guldberg, O.; Leggat, W. The effect of thermal history on the susceptibility of reef-building corals to thermal stress. J. Exp. Biol. 2008, 211, 1050–1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haslun, J.A.; Hauff-Salas, B.; Strychar, K.B.; Ostrom, P.; Cervino, J.M. Biotic stress contributes to seawater temperature induced stress in a site-specific manner for Porites asteroides. Mar. Biol. 2018, 165, 159–172. [Google Scholar] [CrossRef]
- Vollmer, S.V.; Kline, D.I. Natural disease resistance in threatened staghorn corals. PLoS ONE 2008, 3, e3718. [Google Scholar] [CrossRef]
- Campbell-Lendrum, D.H.; Pruss-Ustun, A.; Corvalan, C.F. How much disease could climate change cause? In Climate Change and Human Health—Risks and Responses; McMichael, A.J., Campbell-Lendrum, D.J., Corvalan, C.F., Ebi, K.L., Githeko, A., Scheraga, J.D., Woodward, A., Eds.; World Health Organization: Geneva, Switzerland; Elsevier Science: Amsterdam, The Netherlands, 2003; pp. 133–155. Available online: https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.1041.1884&rep=rep1&type=pdf (accessed on 29 July 2021).
- Rocklöv, J.; Dubrow, R. Climate change: An enduring challenge for vector-borne disease prevention and control. Nat. Immunol. 2020, 21, 479–483. [Google Scholar] [CrossRef] [PubMed]
- Manzello, D.P.; Enochs, I.C.; Kolodziej, G.; Carlton, R. Coral growth patterns of Montastraea cavernosa and Porites astreoides in the Florida Keys: The importance of thermal stress and inimical waters. J. Exp. Mar. Biol. Ecol. 2015, 471, 198–207. [Google Scholar] [CrossRef] [Green Version]
- Baird, A.H.; Marshall, P.A. Mortality, growth and reproduction in scleractinian corals following bleaching on the Great Barrier Reef. Mar. Ecol. Prog. Ser. 2002, 237, 133–141. [Google Scholar] [CrossRef]
- Gochfeld, D.J.; Olson, J.B.; Slattery, M. Colony versus population variation in susceptibility and resistance to dark spot syndrome in the Caribbean coral Siderastrea siderea. Dis. Aquat. Organ. 2006, 69, 53–65. [Google Scholar] [CrossRef] [Green Version]
- Richardson, L.L.; Goldberg, W.M.; Carlton, R.G.; Halas, J.C. Coral disease outbreak in the Florida Keys: Plague Type II. Rev. Biol. Trop. 1998, 46, 187–198. [Google Scholar]
- Oliver, T.A.; Palumbi, S.R. Do fluctuating temperature environments elevate coral thermal tolerance? Coral Reefs 2011, 30, 429–440. [Google Scholar] [CrossRef]
- Fuess, L.E.; Pinzón, C.J.H.; Weil, E.; Grinshpon, R.D.; Mydlarz, L.D. Life or death: Disease-tolerant coral species activate autophagy following immune challenge. Proc. R. Soc. B Biol. Sci. 2017, 284, 20170771. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cervino, J.; Goreau, T.J.; Nagelkerken, I.; Smith, G.W.; Hayes, R. Yellow band and dark spot syndromes in Caribbean corals: Distribution, rate of spread, cytology, and effects on abundance and division rate of zooxanthellae. Hydrobiologia 2001, 460, 53–63. [Google Scholar] [CrossRef]
- Bruckner, A.W.; Riegl, B. Yellow-band diseases. In Diseases in Coral; Woodley, C.M., Down, C.A., Bruckner, A.W., Porter, J., Sylvia, W., Galloway, B., Eds.; John Wiley and Sons Inc.: Hoboken, NJ, USA, 2015; pp. 376–386. ISBN 9781118828502. [Google Scholar] [CrossRef]
- Subhan, B.; Arafat, D.; Rahmawati, F.; Dasmasela, Y.H.; Royhan, Q.M.; Madduppa, H.; Santoso, P.; Prabowo, B. Coral disease at Mansuar Island, Raja Ampat, Indonesia. IOP Conf. Ser. Earth Environ. Sci. 2020, 429, 012027. [Google Scholar] [CrossRef]
- Côté, I.M.; Gill, J.A.; Gardner, T.A.; Watkinson, A.R. Measuring coral reef decline through meta-analyses. Philos. Trans. R. Soc. B. Biol. Sci. 2005, 360, 385–395. [Google Scholar] [CrossRef] [Green Version]
- Bruno, J.F.; Sweatman, H.; Precht, W.F.; Selig, E.R.; Schutte, V.G.W. Assessing evidence of phase shifts from coral to macroalgal dominance on coral reefs. Ecology 2009, 90, 1478–1484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moulding, A.L. Coral recruitment patterns in the Florida Keys. Rev. Biol. Trop. 2005, 53, 75–82. [Google Scholar]
- Miller, M.W.; Weil, E.; Szmant, A.M. Coral recruitment and juvenile mortality as structuring factors for reef benthic communities in Biscayne National Park, USA. Coral Reefs 2000, 19, 115–123. [Google Scholar] [CrossRef]
- Hauff, B.; Haslun, J.A.; Strychar, K.B.; Ostrom, P.; Cervino, J.M. Symbiont diversity of zooxanthellae (Symbiodinium spp.) in Porites astreoides and Montastraea cavernosa from a reciprocal transplant in the lower Florida Keys. Int. J. Biol. 2016, 8, 9–22. [Google Scholar] [CrossRef]
- Hauff-Salas, B.; Haslun, J.A.; Strychar, K.B.; Ostrom, P.H.; Cervino, J.M. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress. PLoS ONE 2017, 12, 1–19. [Google Scholar] [CrossRef]
- Fleige, S.; Pfaffl, M.W. RNA integrity and the effect on the real-time qRT-PCR performance. Mol. Asp. Med. 2006, 27, 126–139. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H.J. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. Available online: http://sourceforge.net/projects/primer3/ (accessed on 29 July 2021).
- Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Bagchi, A.; Herrup, E.A.; Warren, H.S.; Trigilio, J.; Shin, H.-S.; Valentine, C.; Hellman, J. MyD88-dependent and MyD88-independent pathways in synergy, priming, and tolerance between TLR agonists. J. Immunol. 2007, 178, 1164–1171. [Google Scholar] [CrossRef] [PubMed]
- Häcker, H.; Tseng, P.-H.; Karin, M. Expanding TRAF function: TRAF3 as a tri-faced immune regulator. Nat. Rev. Immunol. 2011, 11, 457–468. [Google Scholar] [CrossRef]
- Rowley, A.F.; Powell, A. Invertebrate immune systems specific, quasi-specific, or nonspecific? J. Immunol. 2007, 179, 7209–7214. [Google Scholar] [CrossRef] [Green Version]
- Medzhitov, R.; Janeway, C.A., Jr. Decoding the patterns of self and nonself by the innate immune system. Science 2002, 296, 298–300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.; Smit-McBride, Z.; Pan, X.; Rheinhardt, J.; Hershey, J.W.B. An oncogenic role for the phosphorylated h-subunit of human translation initiation factor eIF3. J. Biol. Chem. 2008, 283, 24047–24060. [Google Scholar] [CrossRef] [Green Version]
- Muñoz, A.; Castellano, M.M. Regulation of translation initiation under abiotic stress conditions in plants: Is it a conserved or not so conserved process among eukaryotes? Comp. Funct. Genom. 2012, 2012, 406357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, B.; Chauhan, H.; Khurana, J.P.; Khurana, P.; Singh, P. Evidence for the role of wheat eukaryotic translation initiation factor 3 subunit g (TaeIF3g) in abiotic stress tolerance. Gene 2013, 532, 177–185. [Google Scholar] [CrossRef]
- Shima, F.; Okada, T.; Kido, M.; Sen, H.; Tanaka, Y.; Tamada, M.; Hu, C.D.; Yamawaki-Kataoka, Y.; Kariya, K.; Kataoka, T. Association of yeast adenylyl cyclase with cyclase-associated protein CAP forms a second Ras-binding site which mediates its Ras-dependent activation. Mol. Cell. Biol. 2000, 20, 26–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shima, F.; Yamawaki-Kataoka, Y.; Yanagihara, C.; Tamada, M.; Okada, T.; Kariya, K.; Kataoka, T. Effect of association with adenylyl cyclase-associated protein on the interaction of yeast adenylyl cyclase with Ras protein. Mol. Cell. Biol. 1997, 17, 1057–1064. [Google Scholar] [CrossRef] [Green Version]
- Montminy, M. Transcriptional regulation by cyclic AMP. Annu. Rev. Biochem. 1997, 66, 807–822. [Google Scholar] [CrossRef] [PubMed]
- Serezani, C.H.; Ballinger, M.N.; Aronoff, D.M.; Peters-Golden, M. Cyclic AMP: Master regulator of innate immune cell function. Am. J. Respir. Cell. Mol. Biol. 2008, 39, 127–132. [Google Scholar] [CrossRef]
- Matz, M.V.; Wright, R.M.; Scott, J.G. No control genes required: Bayesian analysis of qRT-PCR data. PLoS ONE 2013, 8, e71448. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Strychar, K.B.; Sammarco, P.W. Exaptation in corals to high seawater temperatures: Low concentrations of apoptotic and necrotic cells in host coral tissue under bleaching conditions. J. Exp. Mar. Biol. Ecol. 2009, 369, 31–42. [Google Scholar] [CrossRef]
- Sammarco, P.W.; Strychar, K.B. Effects of climate change/global warming on coral reefs: Exaptation in corals, evolution in zooxanthellae, and biogeographic shifts. Environ. BioIndic. 2009, 4, 9–45. [Google Scholar] [CrossRef]
- Price, P.B.; Sowers, T. Temperature dependence of metabolic rates for microbial growth, maintenance, and survival. Proc. Natl. Acad. Sci. USA 2004, 101, 4631–4636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abirami, G.; Radhakrishnan, M.; Kumaran, S.; Wilson, A. Impacts of global warming on marine microbial communities. Sci. Total Environ. 2021, 791, 147905. [Google Scholar] [CrossRef]
- Bruno, J.F.; Selig, E.R.; Casey, K.S.; Page, C.A.; Willis, B.L.; Harvell, C.D.; Sweatman, H.; Melendy, A.M. Thermal stress and coral cover as drivers of coral disease outbreaks. PLoS Biol. 2007, 5, 1220–1227. [Google Scholar] [CrossRef]
- Cerrano, C.; Bavestrello, G.; Bianchi, C.N.; Cattaneo-Vietti, R.; Bava, S.; Morganti, C.; Morri, C.; Picco, P.; Sara, G.; Schiaparelli, S.; et al. A catastrophic mass-mortality episode of gorgonians and other organisms in the Ligurian Sea (North-Western Mediterranean), summer 1999. Ecol. Lett. 2000, 3, 284–293. [Google Scholar] [CrossRef]
- Sussman, M.; Loya, Y.; Fine, M.; Rosenberg, E. The marine fireworm Hermodice carunculata is a winter reservoir and spring-summer vector for the coral-bleaching pathogen Vibrio Shiloi. Environ. Microbiol. 2003, 5, 250–255. [Google Scholar] [CrossRef]
- Gilbert, J.A.; Steele, J.A.; Caporaso, J.G.; Steinbrück, L.; Reeder, J.; Temperton, B.; Huse, S.; Huse, S.; McHardy, A.C.; Knight, R.; et al. Defining seasonal marine microbial community dynamics. ISME J. 2012, 6, 298–308. [Google Scholar] [CrossRef] [Green Version]
- Fuhrman, J.A.; Cram, J.A.; Needham, D.M. Marine microbial community dynamics and their ecological interpretation. Nat. Rev. Microbiol. 2015, 13, 133–146. [Google Scholar] [CrossRef] [PubMed]
- Cavicchioli, R.; Ripple, W.J.; Timmis, K.N.; Azam, F.; Bakken, R.R.; Baylis, M.; Behrenfeld, M.J.; Boetius, A.; Boyd, P.W.; Classen, A.T.; et al. Scientists’ warning to humanity: Microorganisms and climate change. Nat. Rev. Microbiol. 2019, 17, 569–586. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kenkel, C.D.; Sheridan, C.; Leal, M.C.; Bhagooli, S.R.; Castillo, K.D.; Kurata, N.; McGinty, E.; Goulet, T.L.; Matz, M.V. Diagnostic gene expression of coral thermal stress. Mol. Ecol. Resour. 2014, 14, 667–678. [Google Scholar] [CrossRef]
- Louis, D.Y.; Bhagooli, R.; Kenkel, C.D.; Baker, A.C.; Dyall, S.D. Gener expression biomarkers of heat stress in scleractinian corals: Promises and limitations. Comp. Biochem. Physiol. C. 2017, 191, 63–77. [Google Scholar] [CrossRef] [Green Version]
- Gibbs, J.B.; Marshall, M.S. The ras oncogene--an important regulatory element in lower eucaryotic organisms. Microbiol. Rev. 1989, 53, 171–185. [Google Scholar] [CrossRef]
- Kawecki, T.J.; Ebert, D. Conceptual issues in local adaptation. Ecol. Lett. 2004, 7, 1225–1241. [Google Scholar] [CrossRef] [Green Version]
- Sammarco, P.W.; Andrews, J.C. Localized dispersal and recruitment in great barrier reef corals: The helix experiment. Science 1988, 239, 1422–1424. [Google Scholar] [CrossRef] [PubMed]
- Sammarco, P.W.; Andrews, J.C. The Helix experiment: Differential localized dispersal and recruitment patterns in Great Barrier Reef corals. Limnol. Oceanogr. 1989, 34, 896–912. [Google Scholar] [CrossRef]
- Sanford, E.; Kelly, M.W. Local adaptation in marine invertebrates. Annu. Rev. Mar. Sci. 2011, 3, 509–535. [Google Scholar] [CrossRef] [PubMed]
- Moret, Y.; Siva-Jothy, M.T. Adaptive innate immunity? Responsive-mode prophylaxis in the mealworm beetle, Tenebrio molitor. Proc. Biol Sci. 2003, 270, 2475–2480. [Google Scholar] [CrossRef] [Green Version]
- Armitage, S.A.O.; Thompson, J.J.W.; Rolff, J.; Siva-Jothy, M.T. Examining costs of induced and constitutive immune investment in Tenebrio molitor. J. Evol. Biol. 2003, 16, 1038–1044. [Google Scholar] [CrossRef] [Green Version]
- Lochmiller, R.L.; Deerenberg, C. Trade-offs in evolutionary immunology: Just what is the cost of immunity? Oikos 2000, 88, 87–98. [Google Scholar] [CrossRef] [Green Version]
- Porter, J.W.; Dustan, P.; Jaap, W.C.; Patterson, K.L.; Kosmynin, V.; Meier, O.W.; Patterson, M.E.; Parsons, M. Patterns of spread of coral disease in the Florida Keys. In The Ecology and Etiology of Newly Emerging Marine Diseases; Porter, J.W., Ed.; Springer: Dordrecht, The Netherlands, 2001; pp. 1–24. ISBN 978-94-017-3284-0. [Google Scholar] [CrossRef]
- Sammarco, P.W.; Strychar, K.B. Ecological and evolutionary considerations regarding corals in a rapidly changing environment. In The Cnidaria, Past, Present and Future; Goffredo, S., Dubinsky, Z., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 553–573. ISBN 978-3319313030. [Google Scholar] [CrossRef]
- Bay, R.A.; Rose, N.H.; Logan, C.A.; Palumbi, S.R. Genomic models predict successful coral adaptation if future ocean warming rates are reduced. Sci. Adv. 2017, 3, e1701413. [Google Scholar] [CrossRef] [Green Version]
- Fine, M.; Hoegh-Guldberg, O.; Meroz-Fine, E.; Dove, S. Ecological changes over 90 years at Low Isles on the Great Barrier Reef. Nat. Commun. 2019, 10, 4409. [Google Scholar] [CrossRef] [Green Version]
Primer Selection Parameter | Criteria |
---|---|
Product size | 50–150 |
Number of results returned | 5 |
Max repeat mispriming | 12 |
Max template mispriming | 12 |
Max 3′ stability | 9 |
Pair max repeat mispriming | 24 |
Pair max template mispriming | 24 |
Primer size | 18 < 20 > 22 |
Primer Tm | 57 < 59 > 61 |
Max Tm difference | 1 |
Primer GC% | 20 < 50 > 80 |
Max self-complementarity | 2 |
Max # N’s | 0 |
First base index | 1 |
Max 3′ self-complementarity | 3 |
Max poly-X | 4 |
Genes of Interest (GOI) | Abbreviation | Primer Sequence (5′−3′) | Efficiency |
---|---|---|---|
Adenylate cyclase associated protein 2 | ACAP2 | F: TCGTCTGGAGTCTGCTGCT R: TCTGCCACTTTGCCGTTTA | 2.04 |
Eukaryotic initiation factor 3, subunit H | EIF3H | F: TTGATTGATACCAGCCCACA R: ACAAACTGCTTTGCTTTCCC | 1.97 |
TNF receptor-associated factor 3 | TRAF3 | F: GTCTGGCTCCTCCCATCTTT R: GCCTCCAGCATTCTAACCTG | 2.03 |
Control Genes | |||
60S ribosomal protein L11 | RPL11 | F: TTTCAAGCCCTTCTCCAAGA R: GACCCGTGCTGCTAAAGTTC | 1.94 |
Cathepsin L | CATL | F: GGAAGGATTACTGGCTGGTC R: GGATAGATGGCGTTTGTGG | 2 |
Field Site | Date (Year-Month) | SWT at Collection (°C) | One-Week SWT Slope | Regression p-Value |
---|---|---|---|---|
Acer24 Reef | 1st W | 24.5 | 0.06592 | 0.0377 * |
1st S | 30.6 | −0.08914 | 0.418 | |
2nd W | 22.9 | −0.49137 | 0.000467 *** | |
2nd S | 30.0 | −0.01571 | 0.513 | |
Birthday Reef | 1st W | 25.2 | 0.19554 | 0.0024 ** |
1st S | 31.5 | 0.04378 | 0.244 | |
2nd W | 22.0 | −0.59509 | 0.00115 ** | |
2nd S | 30.3 | −0.05640 | 0.0765 |
GOI | Comparison | Posterior Mean | Lower 95% CI | Upper 95% CI | pMCMC |
---|---|---|---|---|---|
ACAP2 | Birthday | −0.435 | −0.937 | 0.029 | 0.086 |
1st W | −0.03757 | −0.49681 | 0.44522 | 0.926 | |
1st S | 0.019 | −0.372 | 0.5 | 0.938 | |
2nd S | −0.14493 | −0.61418 | 0.36624 | 0.576 | |
Birthday: 1st W | 0.49994 | −0.21072 | 1.17273 | 0.132 | |
Birthday: 1st S | 0.40865 | −0.24205 | 1.04486 | 0.21 | |
Birthday: 2nd S | −0.30511 | −0.86000 | 0.25533 | 0.312 | |
eIF3H | Birthday | −0.208 | −0.637 | −0.173 | 0.342 |
1st W | −0.08121 | −0.50590 | 0.24429 | 0.7 | |
1st S | 0.34064 | −0.02892 | 0.7423 | 0.076 | |
2nd S | −0.14893 | −0.59086 | 0.29031 | 0.508 | |
Birthday: 1st W | 0.06488 | −0.42012 | 0.68499 | 0.828 | |
Birthday: 1st S | −0.30511 | −0.86000 | 0.25533 | 0.312 | |
Birthday: 2nd S | 1.00556 | 0.43073 | 1.65886 | <0.001 *** | |
TRAF3 | Birthday | 0.76547 | 0.15549 | 1.40063 | 0.010 * |
1st W | 1.3774 | 0.73687 | 2.0328 | <0.001 *** | |
1st S | 1.80851 | 1.19198 | 2.48163 | <0.001 *** | |
2nd S | 1.20155 | 0.50582 | 1.96071 | <0.001 *** | |
Birthday: 1st W | −0.60505 | −1.45238 | 0.40027 | 0.182 | |
Birthday: 1st S | −1.21753 | −2.07043 | −0.28946 | 0.008 ** | |
Birthday: 2nd S | −1.81851 | −2.85665 | −0.86877 | <0.001 *** |
GOI | Comparison | Posterior Mean | Lower 95% CI | Upper 95% CI | pMCMC |
---|---|---|---|---|---|
ACAP2 | Birthday | −1.147154 | −1.670249 | −0.666332 | <0.001 *** |
1st W | −0.013090 | −0.446707 | 0.396193 | 0.958 | |
1st S | 0.277053 | −0.157765 | 0.713639 | 0.200 | |
2nd S | 0.119924 | −0.364999 | 0.552681 | 0.618 | |
Birthday: 1st W | 0.394370 | −0.243777 | 1.033281 | 0.234 | |
Birthday: 1st S | −0.193949 | −0.824670 | 0.472759 | 0.582 | |
Birthday: 2nd S | 0.351856 | −0.372941 | 1.128164 | 0.374 | |
eIF3H | Birthday | −0.586846 | −1.032692 | −0.112198 | 0.018 * |
1st W | −0.266735 | −0.671877 | 0.103723 | 0.184 | |
1st S | −0.002953 | −0.389189 | 0.347585 | 1.000 | |
2nd S | 0.082943 | −0.337972 | 0.471331 | 0.678 | |
Birthday: 1st W | 0.488955 | −0.150934 | 1.031597 | 0.108 | |
Birthday: 1st S | 0.460195 | −0.172337 | 0.984013 | 0.124 | |
Birthday: 2nd S | 0.839239 | 0.196500 | 1.522053 | 0.022 * | |
TRAF3 | Birthday | 0.362722 | −0.420370 | 1.282007 | 0.394 |
1st W | 1.473018 | 0.761331 | 2.084224 | <0.001 *** | |
1st S | 1.666734 | 0.975813 | 2.272533 | <0.001 *** | |
2nd S | 0.614901 | −0.094805 | 1.261963 | 0.086 | |
Birthday: 1st W | −0.852657 | −1.759411 | 0.160360 | 0.086 | |
Birthday: 1st S | −0.985686 | −1.978128 | −0.025191 | 0.054 | |
Birthday: 2nd S | −0.930772 | −1.904549 | 0.089161 | 0.072 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Haslun, J.A.; Hauff-Salas, B.; Strychar, K.B.; Cervino, J.M.; Ostrom, N.E. Variation in Immune-Related Gene Expression Provides Evidence of Local Adaptation in Porites astreoides (Lamarck, 1816) between Inshore and Offshore Meta-Populations Inhabiting the Lower Florida Reef Tract, USA. Water 2021, 13, 2107. https://doi.org/10.3390/w13152107
Haslun JA, Hauff-Salas B, Strychar KB, Cervino JM, Ostrom NE. Variation in Immune-Related Gene Expression Provides Evidence of Local Adaptation in Porites astreoides (Lamarck, 1816) between Inshore and Offshore Meta-Populations Inhabiting the Lower Florida Reef Tract, USA. Water. 2021; 13(15):2107. https://doi.org/10.3390/w13152107
Chicago/Turabian StyleHaslun, Joshua A., Briana Hauff-Salas, Kevin B. Strychar, James M. Cervino, and Nathaniel E. Ostrom. 2021. "Variation in Immune-Related Gene Expression Provides Evidence of Local Adaptation in Porites astreoides (Lamarck, 1816) between Inshore and Offshore Meta-Populations Inhabiting the Lower Florida Reef Tract, USA" Water 13, no. 15: 2107. https://doi.org/10.3390/w13152107