Genetic Diversity Among Wild and Cultured Bighead Carp (Hypophthalmichthys nobilis) in the Middle Yangtze River by Microsatellite Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish Collection and DNA Extraction
2.2. Microsatellite Marker Selection and PCR Amplification
2.3. Microsatellite Size Determination and Analysis
3. Results
3.1. Polymorphism Information of Microsatellite loci
3.2. Genetic Diversity Within Populations
3.3. Genetic Differentiation and Genetic Distance Analysis Among Populations
4. Discussion
4.1. Levels of Genetic Diversity of Microsatellite loci in Populations
4.2. Genetic Diversity Analysis of Bighead Carp Populations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A

References
- Wang, S.Q. Genetic diversity and population structure of the endangered species Paeonia decomposita endemic to China and implications for its conservation. BMC Plant Biol. 2020, 20, 510. [Google Scholar] [CrossRef] [Scilit]
- Chistiakov, D.A.; Hellemans, B.; Haley, C.S.; Law, A.S.; Tsigenopoulos, C.S.; Kotoulas, G.; Bertotto, D.; Libertini, A.; Volckaert, F.A.M. A microsatellite linkage map of the European sea bass Dicentrarchus labrax L. Genetics 2005, 170, 1821–1826. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Tong, J.O.; Wang, J.R.; Yu, X.M. Development of microsatellite markers and genetic diversity in wild and cultured populations of black carp (Mylopharyngodon piceus) along the Yangtze River. Aquac. Int. 2020, 28, 1867–1882. [Google Scholar] [CrossRef] [Scilit]
- Skaala, O.; Hoyheim, B.; Glover, K.; Dahle, G. Microsatellite analysis in domesticated and wild Atlantic salmon (Salmo salar L.): Allelic diversity and identification of individuals. Aquaculture 2004, 240, 131–143. [Google Scholar] [CrossRef] [Scilit]
- Liao, X.L.; Yu, X.M.; Tan, D.Q.; Tong, J.G. Microsatellite DNA genetic diversity of grass carp in Yangtze River system. Acta Hydrobiol. Sin. 2005, 29, 113–119. [Google Scholar] [CrossRef] [Scilit]
- Sember, A.; Pelikanova, S.; de Bello Cioffi, M.; Slechtova, V.; Hatanaka, T.; Do Doan, H.; Knytl, M.; Rab, P. Taxonomic Diversity Not Associated with Gross Karyotype Differentiation: The Case of Bighead Carps, Genus Hypophthalmichthys (Teleostei, Cypriniformes, Xenocyprididae). Genes 2020, 11, 479. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Zhang, Y.; Duan, X.; Xu, X.; Wang, D. Genetic Diversity Analysis of Hypophthal michthys molitrix Between Wild and Stock Enhancement Based on Mitochondrial Control Region Sequences in the Poyang Lake Water System. Chin. Agric. Sci. Bull. 2013, 29, 89–95. [Google Scholar]
- Xie, P.; Chen, Y.Y. Threats to biodiversity in Chinese inland waters. Ambio 1999, 28, 674–681. [Google Scholar]
- Cheng, F.; Wu, Q.J.; Liu, M.; Radhakrishnan, K.V.; Murphy, B.R.; Xie, S.G. Impacts of hatchery release on genetic structure of rock carp Procypris rabaudi in the upper Yangtze River, China. Fish. Sci. 2011, 77, 765–771. [Google Scholar] [CrossRef] [Scilit]
- Guo, W.J.; Yu, X.M.; Tong, J.G. Development of 134 novel polynucleotide-repeat microsatellite markers in silver carp (Hypophthalmichthys molitrix). Conserv. Genet. Resour. 2013, 5, 525–528. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Guo, J.M.; Wang, Y.H.; Zhou, S.Y.; Li, J.L.; Xu, X.Y.; Shen, Y.B. Correlation analysis of growth qtl tightly linkage molecular markers and growth traits in black carp (Mylopharyngodon piceus). Acta Hydrobiol. Sin. 2024, 48, 1358–1364. [Google Scholar]
- Nei, M.; Li, W.H. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 1979, 76, 5269–5273. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
- Excoffier, L.; Laval, G.; Schneider, S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol. Bioinform. 2005, 1, 47–50. [Google Scholar] [CrossRef] [Scilit]
- Rice, W.R. Analyzing tables of statistical teses. Evolution 1989, 43, 223–225. [Google Scholar] [CrossRef] [Scilit]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
- Gastier, J.M.; Pulido, J.C.; Sunden, S.; Brody, T.; Buetow, K.H.; Murray, J.C.; Weber, J.L.; Hudson, T.J.; Sheffield, V.C.; Duyk, G.M. Survey of trinucleotide repeats in the human genome: Assessment of their utility as genetic markers. Hum. Mol. Genet. 1995, 4, 1829–1836. [Google Scholar] [CrossRef] [Scilit]
- Ohara, K.; Taniguchi, N. Preliminary study on genetic diversity evaluated by 11 microsatellite markers in Kuromejina Girella leoninaand Mejina Girella punctata. Fish. Sci. 2003, 69, 861–863. [Google Scholar] [CrossRef] [Scilit]
- Charlesworth, B. The population genetics of life-history evolution. In The Evolution of Population Biology; Cambridge University Press: Cambridge, UK, 2004; pp. 216–232. [Google Scholar]
- Takezaki, N.; Nei, M. Genetic distances and reconstruction of phylogenetic trees from microsatellite DNA. Genetics 1996, 144, 389–399. [Google Scholar] [CrossRef] [Scilit]
- Zhu, W.; Fu, J.; Luo, M.; Wang, L.; Wang, P.; Liu, Q.; Zaijie Dong, Z. Genetic diversity and population structure of bighead carp (Hypophthalmichthys nobilis) from the middle and lower reaches of the yangtze river revealed using microsatellite markers. Aquac. Rep. 2022, 27, 101377. [Google Scholar] [CrossRef] [Scilit]
- DeWoody, J.A.; Avise, J.C. Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. J. Fish Biol. 2000, 56, 461–473. [Google Scholar] [CrossRef]
- Li, L.; Lin, H.; Tang, W.; Liu, D.; Bao, B.; Yang, J. Population genetic structure in wild and aquaculture populations of Hemibarbus maculates inferred from microsatellites markers. Aquac. Fish. 2017, 2, 78–83. [Google Scholar] [CrossRef] [Scilit]
- Bohling, J.; Haffray, P.; Berrebi, P. Genetic diversity and population structure of domestic brown trout (Salmo trutta) in France. Aquaculture 2016, 462, 1–9. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Li, H.; Wang, X.; Zhu, Y.; Yang, D. Spatial temporal variation of fish community structure in Lake Changhu. Resour. Environ. Yangtze Basin 2016, 25, 265–273. [Google Scholar]
- Liao, X.; Yu, X.; Tong, J. Genetic diversity of common carp from two largest Chinese lakes and the Yangtze River revealed by microsatellite markers. Hydrobiologia 2006, 568, 445–453. [Google Scholar] [CrossRef] [Scilit]




| Population Number | Type of Populations | Population Abbreviations | Sample Location | Sample Size | Date |
|---|---|---|---|---|---|
| 1 | wild | ZX | Zhong District, Chongqing | 32 | 2013 |
| 2 | DTH | Northeastern Hunan Province’s Dongting Lake | 32 | 2013 | |
| 3 | SS | Shishou City, Jingzhou | 32 | 2019 | |
| 4 | WH | Five Lakes Fishery, Xiantao | 32 | 2019 | |
| 5 | Cultured (market collection or adult) | HH | Honghu Lake | 32 | 2019 |
| 6 | XZ | Xinzhou Fish Farms, Wuhan | 32 | 2019 | |
| 7 | Cultured (larvae) | CH | Changhu Fishery, Jingzhou | 32 | 2019 |
| 8 | QC | Herb County, Huanggang | 32 | 2019 | |
| 9 | CD | Caidian District, Wuhan | 32 | 2019 | |
| 10 | HG | Huanggang Fish Farms | 32 | 2019 |
| Locus | Repeat Motif | Primer Sequence (5′–3′) | Sequence Length (bp) | Annealing Temperature (°C) | Fluorochromes |
|---|---|---|---|---|---|
| Hysd6-1 | (AGAAT)12 | F:ATACAGCCATGACATGAACAC | 191–266 | 50 | HEX |
| R:AACAAAGGAAATCTGCGTG | |||||
| Hysd293-1 | (AAGAG)70 | F:AACGAACTCATTTCCAGACCAG | 115–220 | 49 | FAM |
| R:GCCAACATACATAAAGTACATCCC | |||||
| Hysd443-2 | (AAGAG)135 | F:TGACATTTATCCAAGTTTTA | 190–260 | 49 | FAM |
| R:GATTTAGTTCTCAAGCATTT | |||||
| Hysd792-1 | (GAAGA)45 | F:ATAACTGAATCATTCCATCGCC | 84–164 | 49 | FAM |
| R:AGCCTAACCTGCCCTTTACTTG | |||||
| Arsd12 | (TTTC)10 | F:CAGCCTAATGTTTCACAGTCTT | 210–306 | 50 | HEX |
| R:CAGGGTTTGTGCCTAGATGT | |||||
| Arsd23 | (TATC)13 | F:TTTAGCCTATGTGAACGATGTG | 201–254 | 48 | FAM |
| R:TGGGGAGAAACTTTAGCGAC | |||||
| Arsd26 | (TCTT)8 | F:CAAACTGTCAAACGACCACG | 259–303 | 50 | HEX |
| R:GAACCTTTCACTTCTCACGATG | |||||
| Arsd241-1 | (GATA)12 | F:AACAAAAGTTTCAACGCAGGT | 227–251 | 50 | HEX |
| R:GCCTCTCTGTGTCTGTGTAAGTG |
| Locus | Na | Ne | He | Ho | PIC | Fst |
|---|---|---|---|---|---|---|
| Hysd6 | 27 | 10 | 0.902 | 0.881 | 0.842 | 0.063 |
| Hysd293-1 | 35 | 14.7 | 0.934 | 0.865 | 0.852 | 0.072 |
| Arsd12 | 21 | 10 | 0.905 | 0.840 | 0.810 | 0.080 |
| Arsd23 | 10 | 6.9 | 0.856 | 0.754 | 0.693 | 0.156 |
| Arsd26 | 17 | 7.3 | 0.865 | 0.759 | 0.748 | 0.101 |
| Hysd443-2 | 18 | 11.6 | 0.915 | 0.831 | 0.830 | 0.072 |
| Arsd241 | 11 | 5.8 | 0.828 | 0.681 | 0.664 | 0.161 |
| Hysd792-1 | 20 | 7.6 | 0.870 | 0.802 | 0.796 | 0.057 |
| Average | 19.9 | 9.2 | 0.884 | 0.802 | 0.779 | 0.095 |
| Type of Populations | Population Abbreviations | Sample Size | Na | Ne | He | Ho | PIC |
|---|---|---|---|---|---|---|---|
| Wild | ZX | 32 | 11.88 | 7.23 | 0.871 | 0.822 | 0.842 |
| DTH | 32 | 12.75 | 8.06 | 0.882 | 0.827 | 0.853 | |
| SS | 32 | 12 | 7.31 | 0.865 | 0.760 | 0.834 | |
| WH | 32 | 12.38 | 6.83 | 0.857 | 0.845 | 0.827 | |
| Average | 32 | 12.253 | 7.358 | 0.869 | 0.814 | 0.839 | |
| Cultured | HH | 32 | 9.5 | 5.54 | 0.825 | 0.793 | 0.790 |
| XZ | 32 | 8.88 | 4.80 | 0.798 | 0.832 | 0.756 | |
| CH | 32 | 8.5 | 4.84 | 0.642 | 0.620 | 0.613 | |
| QC | 32 | 10.38 | 6.12 | 0.833 | 0.828 | 0.798 | |
| CD | 32 | 9.43 | 6.35 | 0.842 | 0.836 | 0.807 | |
| HG | 32 | 6.38 | 3.78 | 0.731 | 0.855 | 0.674 | |
| Average | 32 | 8.845 | 5.238 | 0.779 | 0.794 | 0.740 |
| Population | HH | XZ | CH | QC | CD | ZX | DTH | SS | WH | HG |
|---|---|---|---|---|---|---|---|---|---|---|
| Abbreviations | ||||||||||
| HH | 0.077 * | 0.228 * | 0.035 * | 0.053 * | 0.034 * | 0.037 * | 0.036 * | 0.028 * | 0.097 * | |
| XZ | 0.492 | 0.231 * | 0.074 * | 0.073 * | 0.067 * | 0.056 * | 0.064 * | 0.070 * | 0.171 * | |
| CH | 0.791 | 0.778 | 0.202 * | 0.212 * | 0.196 * | 0.171 * | 0.185 * | 0.187 * | 0.293 * | |
| QC | 0.265 | 0.484 | 0.782 | 0.038 * | 0.029 * | 0.020 * | 0.024 * | 0.038 * | 0.128 * | |
| CD | 0.399 | 0.495 | 0.789 | 0.306 | 0.026 * | 0.021 * | 0.019 * | 0.05 * | 0.108 * | |
| ZX | 0.284 | 0.477 | 0.783 | 0.263 | 0.253 | 0.011 * | 0.008 * | 0.032 * | 0.107 * | |
| DTH | 0.315 | 0.409 | 0.768 | 0.207 | 0.224 | 0.18 | 0.003 * | 0.021 * | 0.109 * | |
| SS | 0.295 | 0.452 | 0.774 | 0.23 | 0.201 | 0.146 | 0.122 | 0.025 * | 0.108 * | |
| WH | 0.239 | 0.495 | 0.776 | 0.321 | 0.431 | 0.323 | 0.251 | 0.261 | 0.119 * | |
| HG | 0.498 | 0.77 | 0.827 | 0.774 | 0.609 | 0.639 | 0.699 | 0.647 | 0.748 |
| Population | Parameter | Hysd6 | Hysd293-1 | Arsd12 | Arsd23 | Arsd26 | Hysd443-2 | Arsd241 | Hysd792-1 |
|---|---|---|---|---|---|---|---|---|---|
| HH | Na | 10 | 13 | 9 | 7 | 9 | 12 | 6 | 10 |
| Ne | 6.850 | 6.263 | 6.919 | 4.080 | 4.541 | 6.827 | 4.231 | 4.582 | |
| He | 0.878 | 0.854 | 0.869 | 0.767 | 0.792 | 0.867 | 0.776 | 0.794 | |
| Ho | 0.938 | 0.969 * | 0.938 | 0.781 * | 0.688 ** | 0.781 ** | 0.531 ** | 0.719 | |
| PIC | 0.850 | 0.823 | 0.839 | 0.719 | 0.754 | 0.839 | 0.736 | 0.759 | |
| XZ | Na | 11 | 11 | 9 | 7 | 10 | 9 | 6 | 8 |
| Ne | 5.404 | 6.759 | 5.971 | 5.007 | 4.267 | 3.828 | 3.309 | 3.835 | |
| He | 0.868 | 0.866 | 0.846 | 0.813 | 0.778 | 0.751 | 0.709 | 0.751 | |
| Ho | 1 ** | 0.969 ** | 1.000 | 0.844 ** | 0.719 ** | 0.688 ** | 0.719 * | 0.719 ** | |
| PIC | 0.838 | 0.835 | 0.811 | 0.772 | 0.733 | 0.710 | 0.657 | 0.698 | |
| CH | Na | 11 | 13 | 8 | 2 | 5 | 14 | 2 | 13 |
| Ne | 6.261 | 7.119 | 4.979 | 1.174 | 2.566 | 9.062 | 1.064 | 6.461 | |
| He | 0.854 | 0.874 | 0.812 | 0.151 | 0.620 | 0.904 | 0.062 | 0.859 | |
| Ho | 0.936 | 0.742 ** | 0.742 | 0.161 | 0.656 | 0.875 * | 0 * | 0.844 | |
| PIC | 0.821 | 0.845 | 0.771 | 0.137 | 0.562 | 0.880 | 0.059 | 0.829 | |
| QC | Na | 16 | 10 | 8 | 7 | 11 | 12 | 7 | 12 |
| Ne | 7.670 | 4.180 | 4.491 | 5.842 | 6.850 | 7.969 | 3.568 | 8.393 | |
| He | 0.883 | 0.773 | 0.788 | 0.842 | 0.868 | 0.888 | 0.732 | 0.888 | |
| Ho | 0.875 | 0.719 | 0.813 | 0.903 | 0.969 | 0.875 | 0.563 * | 0.903 | |
| PIC | 0.857 | 0.736 | 0.745 | 0.806 | 0.838 | 0.862 | 0.679 | 0.862 | |
| CD | Na | 11 | 11 | 10 | 6 | 12 | 6 | 10 | |
| Ne | 8.641 | 8.063 | 6.628 | 3.984 | 6.827 | 7.062 | 3.501 | 6.113 | |
| He | 0.909 | 0.890 | 0.863 | 0.761 | 0.867 | 0.872 | 0.726 | 0.850 | |
| Ho | 0.938 | 0.844 * | 0.813 | 0.906 | 0.844 | 0.688 ** | 0.750 | 0.906 * | |
| PIC | 0.886 | 0.864 | 0.832 | 0.707 | 0.836 | 0.843 | 0.667 | 0.819 | |
| ZX | Na | 13 | 18 | 12 | 8 | 12 | 12 | 9 | 11 |
| Ne | 6.282 | 11.838 | 7.066 | 6.322 | 6.006 | 9.615 | 5.309 | 5.361 | |
| He | 0.903 | 0.930 | 0.873 | 0.856 | 0.847 | 0.910 | 0.825 | 0.826 | |
| Ho | 0.719 ** | 0.875 * | 0.742 ** | 0.839 | 0.813 | 0.781 * | 0.968 | 0.844 | |
| PIC | 0.879 | 0.910 | 0.844 | 0.822 | 0.814 | 0.887 | 0.789 | 0.790 | |
| DTH | Na | 14 | 20 | 13 | 7 | 11 | 16 | 8 | 13 |
| Ne | 7.938 | 13.213 | 9.309 | 6.077 | 6.889 | 9.468 | 5.069 | 6.502 | |
| He | 0.907 | 0.939 | 0.907 | 0.849 | 0.869 | 0.909 | 0.816 | 0.860 | |
| Ho | 0.813 | 0.938 | 0.875 | 0.719 ** | 0.871 | 0.839 | 0.875 | 0.688 | |
| PIC | 0.883 | 0.919 | 0.883 | 0.814 | 0.838 | 0.885 | 0.776 | 0.828 | |
| SS | Na | 14 | 21 | 13 | 9 | 10 | 12 | 7 | 10 |
| Ne | 7.642 | 10.952 | 8.258 | 6.919 | 4.571 | 9.894 | 4.631 | 5.620 | |
| He | 0.899 | 0.923 | 0.893 | 0.869 | 0.794 | 0.913 | 0.797 | 0.836 | |
| Ho | 0.688 | 0.813 | 0.750 | 0.781 | 0.656 ** | 0.938 | 0.710 | 0.742 | |
| PIC | 0.874 | 0.902 | 0.867 | 0.839 | 0.752 | 0.890 | 0.751 | 0.801 | |
| WH | Na | 14 | 16 | 14 | 7 | 13 | 13 | 9 | 13 |
| Ne | 7.94 | 8.90 | 7.64 | 4.30 | 4.90 | 8.87 | 6.01 | 6.08 | |
| He | 0.89 | 0.90 | 0.88 | 0.78 | 0.81 | 0.90 | 0.85 | 0.85 | |
| Ho | 0.97 | 0.91 | 0.844 * | 0.906 ** | 0.75 | 0.91 | 0.719 ** | 0.75 ** | |
| PIC | 0.86 | 0.88 | 0.86 | 0.73 | 0.77 | 0.88 | 0.81 | 0.82 | |
| HG | Na | 6 | 14 | 5 | 5 | 4 | 5 | 6 | 6 |
| Ne | 3.562 | 5.769 | 3.419 | 2.731 | 2.764 | 3.246 | 3.988 | 4.746 | |
| He | 0.731 | 0.840 | 0.719 | 0.644 | 0.648 | 0.703 | 0.762 | 0.802 | |
| Ho | 0.906 ** | 0.875 | 0.875 * | 0.688 ** | 0.625 * | 0.938 ** | 1 ** | 0.936 ** | |
| PIC | 0.672 | 0.806 | 0.655 | 0.578 | 0.583 | 0.630 | 0.710 | 0.758 |
| Population Abbreviations | Sign Test | Wilcoxon Test | |||||||
|---|---|---|---|---|---|---|---|---|---|
| IAM | TPM | SMM | IAM | TPM | SMM | ||||
| He/Hd | p | He/Hd | p | He/Hd | p | p | p | p | |
| HH | 8/0 | 0.018 * | 3/5 | 0.574 | 3/5 | 0.188 | 0.004 ** | 0.250 | 0.313 |
| XZ | 8/0 | 0.017 * | 4/4 | 0.421 | 2/6 | 0.055 | 0.004 ** | 0.641 | 0.980 |
| CH | 6/2 | 0.212 | 5/3 | 0.486 | 2/6 | 0.065 | 0.055 | 0.844 | 0.020 * |
| QC | 8/0 | 0.017 * | 6/2 | 0.288 | 3/5 | 0.194 | 0.004 ** | 0.250 | 0.461 |
| CD | 8/0 | 0.018 * | 8/0 | 0.016 * | 5/3 | 0.572 | 0.004 ** | 0.004 ** | 0.195 |
| ZX | 8/0 | 0.017 * | 5/3 | 0.603 | 3/5 | 0.189 | 0.004 ** | 0.055 | 0.313 |
| DTH | 8/0 | 0.020 * | 7/1 | 0.105 | 4/4 | 0.431 | 0.004 ** | 0.011 * | 1.000 |
| SS | 8/0 | 0.019 * | 6/2 | 0.308 | 3/5 | 0.192 | 0.004 ** | 0.074 | 0.770 |
| WH | 7/1 | 0.113 | 6/2 | 0.315 | 2/6 | 0.058 | 0.012 * | 0.547 | 0.039 * |
| HG | 7/1 | 0.097 | 7/1 | 0.104 | 5/3 | 0.568 | 0.008 ** | 0.195 | 0.547 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Lei, Q.; Jiang, H.; Liu, J.; Yu, X.; Guo, X.; Tong, J. Genetic Diversity Among Wild and Cultured Bighead Carp (Hypophthalmichthys nobilis) in the Middle Yangtze River by Microsatellite Markers. Genes 2025, 16, 586. https://doi.org/10.3390/genes16050586
Wang J, Lei Q, Jiang H, Liu J, Yu X, Guo X, Tong J. Genetic Diversity Among Wild and Cultured Bighead Carp (Hypophthalmichthys nobilis) in the Middle Yangtze River by Microsatellite Markers. Genes. 2025; 16(5):586. https://doi.org/10.3390/genes16050586
Chicago/Turabian StyleWang, Junru, Qi Lei, Hanjun Jiang, Jun Liu, Xiaomu Yu, Xusheng Guo, and Jingou Tong. 2025. "Genetic Diversity Among Wild and Cultured Bighead Carp (Hypophthalmichthys nobilis) in the Middle Yangtze River by Microsatellite Markers" Genes 16, no. 5: 586. https://doi.org/10.3390/genes16050586
APA StyleWang, J., Lei, Q., Jiang, H., Liu, J., Yu, X., Guo, X., & Tong, J. (2025). Genetic Diversity Among Wild and Cultured Bighead Carp (Hypophthalmichthys nobilis) in the Middle Yangtze River by Microsatellite Markers. Genes, 16(5), 586. https://doi.org/10.3390/genes16050586

