Utilizing Target Sequences with Multiple Flanking Protospacer Adjacent Motif (PAM) Sites Reduces Off-Target Effects of the Cas9 Enzyme in Pineapple
Abstract
1. Introduction
2. Results
2.1. Off-Target Rates in Transformed Pineapples Were Higher with gRNA Vectors Targeting Sequences with One PAM Site Compared to Those with Two or More PAM Sites
2.2. Off-Target Rates in Transformed Pineapples with gRNA Vectors Using Target Sequences with Both 3′ End Flanking PAM Site and Core PAM Site Were Lower than Those with Only a Core PAM Site
2.3. Off-Target Rates in Transformed Pineapples with gRNA Vectors Using Target Sequences Having NAG Site in the Vicinal Region of the Core PAM Was Less than Those with Only a Core PAM Site
2.4. Relationship of Mutant Type and Quantity of PAM Sites
3. Discussion
4. Conclusions
5. Methods
5.1. Vector Construction
5.2. Callus Induction
5.3. Pineapple Transformation and Target-Sequence Identification
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Elbashir, S.M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.; Tuschl, T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 2001, 411, 494–498. [Google Scholar] [CrossRef] [Scilit]
- Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [Scilit]
- McManus, M.T.; Sharp, P.A. Gene silencing in mammals by small interfering RNAs. Nat. Rev. Genet. 2002, 3, 737–747. [Google Scholar] [CrossRef] [Scilit]
- Alonso, J.M.; Stepanova, A.N.; Leisse, T.J.; Kim, C.J.; Chen, H.; Shinn, P.; Stevenson, D.K.; Zimmerman, J.; Barajas, P.; Cheuk, R.; et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 2003, 301, 653–657. [Google Scholar] [CrossRef] [Scilit]
- Greene, E.A.; Codomo, C.A.; Taylor, N.E.; Henikoff, J.G.; Till, B.J.; Reynolds, S.H.; Enns, L.C.; Burtner, C.; Johnson, J.E.; Odden, A.R.; et al. A flexible SNP-based multiplexed method for high-throughput functional genomics. Nat. Methods 2003, 2, 33–39. [Google Scholar] [CrossRef] [Scilit]
- Lowder, L.G.; Zhang, D.; Baltes, N.J.; Paul, J.W., 3rd; Tang, X.; Zheng, X.; Voytas, D.F.; Hsieh, T.F.; Zhang, Y. A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol. 2015, 169, 971–985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, Y.; Foden, J.A.; Khayter, C.; Maeder, M.L.; Reyon, D.; Joung, J.K.; Sander, J.D. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 2014, 32, 279–284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hillary, V.E.; Ceasar, S.A. A Review on the Mechanism and Applications of CRISPR/Cas9/Cas12/ Cas13/Cas14 Proteins Utilized for Genome Engineering. Mol. Biotechnol. 2023, 65, 311–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lawrenson, T.; Shorinola, O.; Stacey, N.; Li, C.; Østergaard, L.; Patron, N.; Uauy, C.; Harwood, W. Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015, 16, 258. [Google Scholar] [CrossRef] [Scilit]
- Kang, B.; Yun, J.; Kim, S.; Shin, Y.; Ryu, J.; Choi, M.; Woo, J.W.; Kim, J. Precision genome engineering through adenine base editing in plants. Nat. Plants 2018, 4, 427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Xing, H.; Dong, L.; Zhang, H.; Han, C.; Wang, X.; Chen, Q. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015, 16, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, Z.; Chen, K.; Li, T.; Zhang, Y.; Wang, Y.; Zhao, Q.; Liu, J.; Zhang, H.; Liu, C.; Ran, Y. Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat. Commun. 2017, 8, 14261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haeussler, M.; Schonig, K.; Eckert, H.; Eschstruth, A.; Mianne, J.; Renaud, J.B.; Schneider-Maunoury, S.; Shkumatava, A.; Teboul, L.; Kent, J.; et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 2016, 17, 148. [Google Scholar] [CrossRef] [Scilit]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Xing, H.; Wang, Z.; Zhang, H.; Yang, F.; Wang, X.; Chen, Q. Potential high-frequency off-target mutagenesis induced by CRISPR/Cas9 in Arabidopsis and its prevention. Plant Mol. Biol. 2018, 96, 445–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peterson, B.A.; Haak, D.C.; Nishimura, M.T.; Teixeira, P.J.; James, S.R.; Dangl, J.L.; Nimchuk, Z.L. Genome-wide assessment of efficiency and specificity in CRISPR/Cas9 mediated multiple site targeting in Arabidopsis. PLoS ONE 2016, 11, e0162169. [Google Scholar] [CrossRef] [Scilit]
- Kleinstiver, B.P.; Pattanayak, V.; Prew, M.S.; Tsai, S.Q.; Nguyen, N.T.; Zheng, Z.; Joung, J.K. High-fidelity CRISPR-Cas9 nucleases with no detectable off-target effects. Nature 2016, 529, 490–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koblan, L.W.; Doman, J.L.; Wilson, C.; Garcia, S.P.; Holmes, B.; Lin, Z.; Schaefer, K.A.; Schier, A.F.; Liu, D.R. Improving cytosine base editor efficiency and specificity through protein engineering. Nat. Biotechnol. 2018, 36, 1073–1079. [Google Scholar] [CrossRef] [Scilit]
- Gaudelli, N.M.; Komor, A.C.; Rees, H.A.; Packer, M.S.; Badran, A.H.; Bryson, D.I.; Liu, D.R. Programmable base editing of AT to GC in genomic DNA without DNA cleavage. Nature 2017, 551, 464–471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wolt, J.D.; Wang, K.; Sashital, D.; Lawrence-Dill, C.J. Achieving plant CRISPR targeting that limits off-target effects. Plant Genome 2016, 9, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Shiga, T.; Suzuki, N. Amphipathic alpha-helix mediates the heterodimerization of soluble guanylyl cyclase. Zool. Sci. 2005, 22, 735–742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Globyte, V.; Lee, S.H.; Bae, T.; Kim, J.S.; Joo, C. CRISPR/Cas9 searches for a protospacer adjacent motif by lateral diffusion. EMBO J. 2019, 38, e99466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molla, K.A.; Yang, Y. CRISPR/Cas-mediated base editing: Technical considerations and practical applications. Trends Biotechnol. 2019, 37, 1121–1142. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Ge, X.; Yang, F.; Zhang, L.; Zheng, J.; Tan, X.; Jin, Z.; Qu, J.; Gu, F. Comparison of non-canonical PAMs for CRISPR/Cas9-mediated DNA cleavage in human cells. Sci. Rep. 2014, 4, 5405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Teng, Y.; Gong, X.; Zhang, J.; Wu, Y.; Lou, L.; Li, M.; Xie, Z.R.; Yan, Y. Exploring and engineering PAM-diverse Streptococci Cas9 for PAM-directed bifunctional and titratable gene control in bacteria. Metab. Eng. 2023, 75, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Goldberg, G.W.; Spencer, J.M.; Giganti, D.O.; Camellato, B.R.; Agmon, N.; Ichikawa, D.M.; Boeke, J.D.; Noyes, M.B. Engineered dual selection for directed evolution of SpCas9 PAM specificity. Nat. Commun. 2021, 12, 349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, G.; Zhou, Z.; Liang, L.; Song, Z.; Hu, Y.; Cui, J.; Chen, W.; Hu, K.; Cheng, J. Genome-wide identification and analysis of highly specific CRISPR/Cas9 editing sites in pepper (Capsicum annuum L.). PLoS ONE 2020, 15, e0244515. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.; Mao, Y.; Xu, N.; Zhang, B.; Wei, P.; Yang, D.L.; Wang, Z.; Zhang, Z.; Zheng, R.; Yang, L.; et al. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci. USA 2014, 111, 4632–4637. [Google Scholar] [CrossRef] [Scilit]
- Shu, H.; Zhan, R.; Eissa, M.A.; Vafadar, F.; Ding, Z.; Wang, Y.; He, J.; Wei, Q.; Luan, A.; Chang, S. Propagation of pineapple (Ananas comosus L.) embryogenic cell suspension is regulated by LEAFY COTYLEDON1 gene AcoLEC1–1. Sci. Hortic. 2024, 332, 113173. [Google Scholar] [CrossRef] [Scilit]
- Acharya, S.; Ansari, A.H.; Kumar Das, P.; Hirano, S.; Aich, M.; Rauthan, R.; Mahato, S.; Maddileti, S.; Sarkar, S.; Kumar, M.; et al. PAM-flexible Engineered FnCas9 variants for robust and ultra-precise genome editing and diagnostics. Nat. Commun. 2024, 15, 5471. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.Z.; Zaidi, S.S.E.A.; Amin, I.; Mansoor, S. A CRISPR way for fast-forward crop domestication. Trends Plant Sci. 2019, 24, 293–296. [Google Scholar] [CrossRef] [Scilit]
- Han, H.A.; Pang, J.K.S.; Soh, B.S. Mitigating off-target effects in CRISPR/Cas9-mediated in vivo gene editing. J. Mol. Med. 2020, 98, 615–632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charlier, J.; Nadon, R.; Makarenkov, V. Accurate deep learning off-target prediction with novel sgRNA-DNA sequence encoding in CRISPR-Cas9 gene editing. Bioinformatics 2021, 37, 2299–2307. [Google Scholar] [CrossRef] [Scilit]
- Sojka, J.; Šamajová, O.; Šamaj, J. Gene-edited protein kinases and phosphatases in molecular plant breeding. Trends Plant Sci. 2024, 29, 694–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cancellieri, S.; Zeng, J.; Lin, L.Y.; Tognon, M.; Nguyen, M.A.; Lin, J.; Bombieri, N.; Maitland, S.A.; Ciuculescu, M.F.; Katta, V.; et al. Human genetic diversity alters off-target outcomes of therapeutic gene editing. Nat. Genet. 2023, 55, 34–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [Scilit]
- Gasiunas, G.; Barrangou, R.; Horvath, P.; Siksnys, V. Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc. Natl. Acad. Sci. USA 2012, 109, E2579–E2586. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Foden, J.A.; Khayter, C.; Maeder, M.L.; Reyon, D.; Joung, J.K.; Sander, J.D. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 2013, 31, 822–826. [Google Scholar] [CrossRef] [Scilit]
- Sternberg, S.H.; Redding, S.; Jinek, M.; Greene, E.C.; Doudna, J.A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Biophys. J. 2014, 106, 695a. [Google Scholar] [CrossRef] [Scilit]
- Xue, C.; Greene, E.C. DNA repair pathway choices in CRISPR-Cas9-mediated genome editing. Trends Genet. 2021, 37, 639–656. [Google Scholar] [CrossRef] [Scilit]
- Pattanayak, V.; Lin, S.; Guilinger, J.P.; Ma, E.; Doudna, J.A.; Liu, D.R. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat. Biotechnol. 2013, 31, 839–843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef] [Scilit]
- Kleinstiver, B.P.; Prew, M.S.; Tsai, S.Q.; Topkar, V.V.; Nguyen, N.T.; Zheng, Z.; Gonzales, A.P.; Li, Z.; Peterson, R.T.; Yeh, J.R.; et al. Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 2015, 523, 481–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leenary, R.T.; Maksimchuk, K.R.; Slotkowski, R.A.; Agrawal, R.N.; Gomaa, A.A.; Briner, A.E.; Barrangou, R.; Beisel, C.L. Identifying and visualizing functional PAM diversity across CRISPR-Cas systems. Mol. Cell 2016, 62, 137–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szczelkun, M.D.; Tikhomirova, M.S.; Sinkunas, T.; Gasiunas, G.; Karvelis, T.; Pschera, P.; Siksnys, V.; Seidel, R. Direct observation of R-loop formation by single RNA-guided Cas9 and Cascade effector complexes. Proc. Natl. Acad. Sci. USA 2014, 111, 9798–9803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sternberg, S.H.; LaFrance, B.; Kaplan, M.; Doudna, J.A. Conformational control of DNA target cleavage by CRISPR–Cas9. Nature 2015, 527, 110–113. [Google Scholar] [CrossRef] [Scilit]
- Jiang, F.; Doudna, J.A. CRISPR–Cas9 structures and mechanisms. Annu. Rev. Biophys. 2017, 46, 505–529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishimasu, H.; Ran, F.A.; Hsu, P.D.; Konermann, S.; Shehata, S.I.; Dohmae, N.; Nureki, O. Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 2014, 156, 935–949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shou, J.; Li, J.; Liu, Y.; Wu, Q. Precise and Predictable CRISPR Chromosomal Rearrangements RevealPrinciples of Cas9-Mediated Nucleotide Insertion. Mol. Cell 2018, 71, 498–509.e4. [Google Scholar] [CrossRef] [Scilit]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Horsch, R.B.; Fry, J.E.; Hoffmann, N.L.; Eichholtz, D.; Rogers, S.G.; Fraley, R.T. A simple and general method for transferring genes into plants. Science 1985, 227, 1229–1231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, H.; Song, C.Q.; Suresh, S.; Kwan, S.Y.; Wu, Q.; Walsh, S.; Ding, J.; Bogorad, R.L.; Zhu, L.J.; Wolfe, S.A.; et al. Partial DNA-guided Cas9 enables genome editing with reduced off-target activity. Nat. Chem. Biol. 2018, 14, 311–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gamborg, O.L.; Miller, R.A.; Ojima, K. Nutrient requirements of suspension cultures of soybean root cells. Exp. Cell Res. 1968, 50, 151–158. [Google Scholar] [CrossRef] [Scilit]



| Target Seq. | Forward Primers (5′ to 3′) | Reverse Primers (5′ to 3′) |
|---|---|---|
| TS1 | GGCAgcgttttgtctcgctgaccc | AAACgggtcagcgagacaaaacgc |
| TS2 | GGCAtcgtgaaattcgtaaacgaa | AAACttcgtttacgaatttcacga |
| TS3 | GGCAgaacatcattaccatcgtaa | AAACttacgatggtaatgatgttc |
| TS4 | GGCAgcaatttgtaacgtgatggt | AAACaccatcacgttacaaattgc |
| TS5 | GGCAgatcgattattgcgctgtgg | AAACccacagcgcaataatcgatc |
| TS6 | GGCAgttattgacggttaatgtgc | AAACgcacattaaccgtcaataac |
| TS7 | GGCAgtggatcaagaatcacccgg | AAACccgggtgattcttgatccac |
| TS8 | GGCAtcaaaggacttcggcctccc | AAACgggaggccgaagtcctttga |
| TS9 | GGCAagaggctgtcggagaggcac | AAACgtgcctctccgacagcctct |
| TS10 | GGCAatcgccaccaacggccgcca | AAACtggcggccgttggtggcgat |
| TS11 | GGCAgcgcgaagaggctgtcggag | AAACctccgacagcctcttcgcgc |
| TS12 | GGCAattataggttacttgtaccc | AAACgggtacaagtaacctataat |
| TS13 | GGCAgtcaagctcaatgtgtcccc | AAACggggacacattgagcttgac |
| TS14 | GGCAcaccgacgacccgaagcaac | AAACgttgcttcgggtcgtcggtg |
| TS15 | GGCAtccacgtgccgttcacgagc | AAACgctcgtgaacggcacgtgga |
| TS16 | GGCAtcctgacccctattgtttac | AAACgtaaacaataggggtcagga |
| TS17 | GGCAatcttctttgctttctctta | AAACtaagagaaagcaaagaagat |
| TS18 | GGCAcgatccgaattcgccgaaag | AAACctttcggcgaattcggatcg |
| Target Seq. | Forward Primers (5′ to 3′) | Reverse Primers (5′ to 3′) |
|---|---|---|
| TS1 | tattttaatggacatgtcgcattcg | gaaccttttgatatcccagatgcct |
| TS2 | acagatttaatcgcgatctccggtg | gcgcaactaaccaccgtgtcgttgt |
| TS3 | atttcgatatctcccgtgtgtgctc | tgcatctgtttctcttctttcaatt |
| TS4 | ttcatgacggtcttcgtgacgagct | tactgagatttatcttactataatc |
| TS5 | tcttctttgctttctcttatggcct | gattccccaccagggaagctgcagc |
| TS6 | gtgaagctgtaaatatagaacttaa | actagactgtaaatgtgcctagcca |
| TS7 | cgtaatccaaatgggactctccgag | tttaattcaagttaagagtaaagta |
| TS8 | taaaaggagtactgataaccaaccc | gagaagatcctgtgcctctccgaca |
| TS9 | tccacattgcgtacagtctctcaaa | gcgatgcagaccctgaaccaacctg |
| TS10 | tattcatacgcatttcaacgtccag | tagtcttatatatacacaagaatga |
| TS11 | tccacattgcgtacagtctctcaaa | gcgatgcagaccctgaaccaacctg |
| TS12 | ccttcatattcacgctgccgatcgc | ccgtcgtcagcagccaccacgccgt |
| TS13 | acctactgggcgccatgctatccga | aaatctattctcaagaccgaattat |
| TS14 | catgtattgtgatccatatacagca | acggcacgtggatgggtgcggtcgg |
| TS15 | gagcaagtccggctcacggtcccga | agaacatagatcatttatatacctg |
| TS16 | tcccttcaataaccgcgctatcttt | gaaagagtagccgtgagagtcgcga |
| TS17 | tgatggtaggctttgctctcattgt | acggtcgttttccgccacagcgcaa |
| TS18 | gacgtgcgatcttctggcggttcga | agccgagcttctttagcagcctgaa |
| Target Seq. | Gene Name | Sequence | Definition | GenBank Accession |
|---|---|---|---|---|
| TS1 | AcACS1 | gcgttttgtctcgctgacccTGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS2 | AcACS1 | tcgtgaaattcgtaaacgaaAGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS3 | AcOT5 | gaacatcattaccatcgtaaAGG | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS4 | AcOT5 | gcaatttgtaacgtgatggtAGG | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS5 | AcOT5 | gatcgattattgcgctgtggCGG | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS6 | AcCSPE6 | gttattgacggttaatgtgcTGG | Cellulose synthase-like protein E6 | LSRQ01000073.1 |
| TS7 | AcACS1 | gtggatcaagaatcacccggAGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS8 | AcACS1 | tcaaaggacttcggcctcccCGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS9 | AcACS1 | agagcctgtcggagaggcacAGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS10 | AcACS1 | atcgccaccaacggccgccaCGGcgagg | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS11 | AcACS1 | gcgcgaagaggctgtcggagAGGcacagg | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS12 | AcOT5 | attataggttacttgtacccTGGtagg | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS13 | AcACS1 | gtcaagctcaatgtgtccccCGG | 1-aminocyclopropane-1-carboxylate synthase-like | NC_033623.1 |
| TS14 | AcOT5 | caccgacgacccgaagcaacCGG | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS15 | AcOT5 | tccacgtgccgttcacgagcTGG | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS16 | AcOT5 | tcctgacccctattgtttacTGGaag | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS17 | AcOT5 | atcttctttgctttctcttaTGGcctgag | Oligopeptide transporter 5 | LSRQ01000073.1 |
| TS18 | AcPKG11A | cgatccgaattcgccgaaagCGGaaag | Protein kinase G11A | LSRQ01000073.1 |
| Target Seq. | Off-Target Rate (%) | On-Target Rate (%) | Deletions | Insertions |
|---|---|---|---|---|
| TS1 | 72 | 28 | 87 | 45 |
| TS2 | 70 | 30 | 93 | 61 |
| TS3 | 72 | 28 | 93 | 71 |
| TS4 | 48 | 52 | 115 | 66 |
| TS5 | 48 | 52 | 95 | 55 |
| TS6 | 46 | 54 | 103 | 60 |
| TS7 | 32 | 68 | 107 | 65 |
| TS8 | 28 | 72 | 108 | 79 |
| TS9 | 34 | 66 | 86 | 56 |
| TS10 | 48 | 52 | 79 | 63 |
| TS11 | 50 | 50 | 86 | 62 |
| TS12 | 48 | 52 | 94 | 60 |
| TS13 | 56 | 44 | 83 | 55 |
| TS14 | 58 | 42 | 86 | 57 |
| TS15 | 56 | 44 | 92 | 54 |
| TS16 | 58 | 42 | 82 | 55 |
| TS17 | 58 | 42 | 93 | 59 |
| TS18 | 56 | 44 | 92 | 54 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shu, H.; Luan, A.; Ullah, H.; He, J.; Wang, Y.; Chen, C.; Wei, Q.; Zhan, R.; Chang, S. Utilizing Target Sequences with Multiple Flanking Protospacer Adjacent Motif (PAM) Sites Reduces Off-Target Effects of the Cas9 Enzyme in Pineapple. Genes 2025, 16, 217. https://doi.org/10.3390/genes16020217
Shu H, Luan A, Ullah H, He J, Wang Y, Chen C, Wei Q, Zhan R, Chang S. Utilizing Target Sequences with Multiple Flanking Protospacer Adjacent Motif (PAM) Sites Reduces Off-Target Effects of the Cas9 Enzyme in Pineapple. Genes. 2025; 16(2):217. https://doi.org/10.3390/genes16020217
Chicago/Turabian StyleShu, Haiyan, Aiping Luan, Hidayat Ullah, Junhu He, You Wang, Chengjie Chen, Qing Wei, Rulin Zhan, and Shenghe Chang. 2025. "Utilizing Target Sequences with Multiple Flanking Protospacer Adjacent Motif (PAM) Sites Reduces Off-Target Effects of the Cas9 Enzyme in Pineapple" Genes 16, no. 2: 217. https://doi.org/10.3390/genes16020217
APA StyleShu, H., Luan, A., Ullah, H., He, J., Wang, Y., Chen, C., Wei, Q., Zhan, R., & Chang, S. (2025). Utilizing Target Sequences with Multiple Flanking Protospacer Adjacent Motif (PAM) Sites Reduces Off-Target Effects of the Cas9 Enzyme in Pineapple. Genes, 16(2), 217. https://doi.org/10.3390/genes16020217

