Next Article in Journal
Current and Emerging Protein Biomarkers for the Diagnosis and Prognosis of Head and Neck Cancer
Previous Article in Journal
Transcriptomic and Metabolomic Insights into the Hepatic Response to Dietary Carvacrol in Pengze Crucian Carp (Carassius auratus var. Pengze)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 12
10.3390/genes16121492
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Duplication, Divergence and Cardiac Expression of Tropoelastin in Jawed Fishes, Including Tetraploid Rainbow Trout (Oncorhynchus mykiss)

by
Øivind Andersen
1,2,* and
Tone-Kari Knutsdatter Østbye
1
1
Norwegian Institute of Food, Fisheries and Aquaculture Research (Nofima), 1433 Ås, Norway
2
Department of Animal and Aquacultural Sciences, Norwegian University of Life Sciences (NMBU), 1433 Ås, Norway
*
Author to whom correspondence should be addressed.
Genes 2025, 16(12), 1492; https://doi.org/10.3390/genes16121492
Submission received: 11 November 2025 / Revised: 9 December 2025 / Accepted: 10 December 2025 / Published: 13 December 2025
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

Background/objectives: Tropoelastin is a highly hydrophobic extracellular matrix protein responsible for the extensibility and elastic recoil of various organs. The Windkessel effect in blood vessels dampens pressure variations during the cardiac cycle to provide continuous perfusion of tissues, such as the fragile gill capillaries in fish. The teleost-specific whole-genome duplication was followed by structural and functional divergence of the duplicated tropoelastins, of which ElnB confers the uniquely low stiffness of the bulbus arteriosus. Methods: We have examined the diversity of tropoelastins in all major fish clades by searching for tropoelastin (eln) genes in the sequenced genomes. Duplication of eln genes in tetraploid salmonids and cyprinids was examined by maximum likelihood phylogenetic analysis, and cardiac eln expression in rainbow trout was quantified by qPCR. Results: The tetraploid salmonid genomes harbor two elna genes but a single elnb, except for the tandem duplicated elnb genes in sockeye salmon and lake whitefish, while the tetraploid common carp possesses four elna and elnb genes on separate chromosomes. Rainbow trout showed strong elastin staining in the larval bulbus and ventral aorta, and the bulbar expression of elnb was 15 times higher than the ventricular levels in juvenile fish. The expression of elna1 and elna2 was also significantly higher in the bulbus, and together their transcript levels were almost similar as the elnb levels. The overall hydrophobicity of the fish tropoelastins differed considerably among the species ranging from 28.6% in Emerald rockcod ElnB to 56.3% in lesser devil ray Eln, but showed no significant difference with the tetrapods examined, except for the lower hydrophobicity of teleost ElnB. Conclusions: The inclusion of tetrapods in the analysis revealed a positive relationship between ventral aortic blood pressure and tropoelastin hydrophobicity.

1. Introduction

Elastin is an essential extracellular matrix protein in all jawed vertebrates by providing extensibility and elastic recoil in various organs like blood vessels, skin, lungs and ligaments. The elastin fibers consist of a microfibrillar mantle surrounding the insoluble elastin core, which is formed by self-assembly of the soluble tropoelastin monomers followed by covalent crosslinking of the elastin aggregates [1,2]. The extreme hydrophobicity, together with the multiple crosslinks, is pivotal for the insolubility, proteolytic resistance and exceptional stability and longevity of elastin with a half-time of about 70 years in man [2,3]. The tropoelastin protein consists of alternating hydrophobic and hydrophilic domains, which usually correspond to the individual exons in the genetic sequence [4]. The hydrophobic domains interact in the self-assembly, or coacervation, process and are particularly rich in non-polar amino acids typically occurring in repeated motifs [5,6,7,8]. The hydrophilic crosslinking domains are subdivided into KA and KP types, which consist of alanine and proline residues, respectively, between pairs of lysine and form highly stable crosslinks by the action of lysyl oxidases [4,9,10]. The KA and KP types can be covalently crosslinked with each other, and substitution of KP for KA crosslinks had little effect on the tensile mechanical properties of elastin-like proteins [10,11]. The conserved C-terminal end of tropoelastin contains a tetrabasic motif and a cysteine pair of importance for the interactions with other matrix components [12,13,14].
The elasticity of blood vessels is crucial for smoothing the pulsatile blood flow generated by the heart to provide continuous perfusion of peripheral tissues [15]. The large amounts of elastin fibers in the aortic wall create the arterial elasticity below and at physiological pressure, while the collagen fibers provide arterial stiffness to withstand the force of high blood flow [16]. The expanding energy from the blood pressure is temporarily stored in the elastic arteries when the walls are stretched during the systolic phase and is returned to the blood flow when the elastin recoils during diastole [17]. This “Windkessel” effect also occurs in the elastic bulbus arteriosus of the teleost heart, acting as a damping chamber to provide a more even flow through the gill lamellae for efficient gas exchange and for protecting the delicate gill capillaries [18,19,20,21,22]. The teleost-specific whole-genome duplication (WGD) event about 300 million years ago generated the duplicated elna and elnb genes, which exhibit divergent expression patterns and functions in zebrafish [23,24]. The ElnB paralog plays a key role in the development of the bulbus by promoting the differentiation of cardiac precursor cells into smooth muscle [23,24]. Zebrafish ElnB was recently suggested to confer the considerably lower stiffness of the bulbus than the ventricle, in contrast to the high stiffness in both the muscular conus arteriosus and ventricle in the non-teleost ray-finned gray bichir (Polypterus senegalus) [25]. Consistently, the extended hydrophobic domains in zebrafish ElnB were predicted to have implications for the decreased elastic modulus, assuming a rubber model for the elasticity of elastin [4,23]. The divergence and subfunctionalization of the duplicated tropoelastins should be further examined in non-model fish species, including tetraploid salmonids and cyprinids. Multiple gene paralogs retained from the salmonid WGD were identified in the sequenced genomes from various subfamilies [26]. The few molecular studies of salmonid tropoelastin include the extraction of a single eln mRNA from the bulbus in coho salmon (Oncorhynchus kisutch), while the immunoreactive protein of 43 kD was considerably smaller than the 70 kD tropoelastin in mammals [27].
The mechanism underlying the reversible elasticity of elastin has been controversial for decades and was recently concluded to be primarily driven by the hydrophobic effect that was suggested to account for elastin’s low stiffness and high resilience [28]. An evolutionary trend towards increased overall hydrophobicity in vertebrate tropoelastin was proposed to be an adaptive advantage in homeothermic vertebrates related to the higher blood pressure in the more advanced circulatory systems [29,30,31], or by lowering the coacervation temperature to facilitate elastin formation in mammals, birds and alligators [32]. The structural and functional properties of elastin should be investigated in a broad range of fish species to better understand the evolution of this unique protein and the relationship with different physiological adaptations and functional requirements among species. Many fish species live in extreme environments, such as Antarctic icefish permanently inhabit ice-cold water and are apparently lacking bulbar elastin [21]. Deep-sea snailfish (Pseudoliparis swirei) has developed unique adaptations to withstand the extreme hydrostatic pressure at depths below 8000 m in the Mariana trench [33,34]. The Greenland shark (Somniosus microcephalus) has the longest lifespan in any known vertebrate, of several hundred years, which may be reflected in elastin stability and longevity. Here, we examine the diversity of fish elastin in a variety of species spanning about 450 million years of evolution. Elastin gene duplications of the paralogs were investigated in tetraploid cyprinids and salmonids, including rainbow trout (Oncorhynchus mykiss) possessing three eln genes, which were differentially expressed in bulbus and ventricle.

2. Materials and Methods

2.1. Identification and Characterization of Fish Elastins

To examine the diversity of elastin in jawed fish, we selected 51 species differing in living habitat, swimming activity and cardio-vascular morphology. We searched for eln genes in the sequenced fish genomes available at NCBI’s Genome Resources (https://www.ncbi.nlm.nih.gov/home/genomes (accessed on 1 November 2025)) by comparing nucleotide (BLASTN) and protein sequences (BLASTP) (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 1 November 2025)). Uncharacterized or misannotated or uncharacterized eln genes were identified by searching for the syntenic genes limk1 and septin4/5 [35], which were conserved in all species examined, except for the missing elnb in the tarpon genome (Table S1). All tropoelastins were examined for full-length size by inspecting the N-terminal signal peptide (https://services.healthtech.dtu.dk/services/SignalP-6.0/ (accessed on 1 November 2025)) and the basic Cys-containing C-terminus. Partial or missing eln genes were verified by screening the genome using TBLASTN at NCBI, while short eln-like sequences identified in the incomplete cyprinid genomes were excluded. The teleost ElnA and ElnB paralogs were distinguished by the extended exons and lower hydrophobicity of ElnB than ElnA. In species where only a single paralog was identified, the identity was verified by blasting the protein sequence against the ElnA and ElnB paralogs from related species.
A phylogenetic tree of the tropoelastins in tetraploid salmonid and cyprinid species was made by alignment of the amino acid sequence data using the ClustalW algorithm implemented in the software package MEGA (version 12) [33]. MEGA was also used to perform a maximum likelihood phylogenetic analysis with a Jones–Taylor–Thornton (JTT) substitution model and uniform rates among sites. Heuristic tree searching was performed using the Nearest-Neighbor-Interchange (NNI) method, and bootstrapping with 100 pseudoreplicates was used to assess tree robustness.
The overall hydrophobicity of full-length tropoelastin proteins was calculated using the Kyte-Doolittle hydrophobicity scale [36] (https://www.peptide2.com/N_peptide_hydrophobicity_hydrophilicity.php (accessed on 1 November 2025)). The Kyte–Doolittle hydropathy analysis of rainbow trout ElnB was performed by ProtScale (https://web.expasy.org/protscale/ (accessed on 1 November 2025)) with a sliding window size of 9 amino acids. Repeated hydrophobic motives and crosslinks were identified by the ScanProsite tool (https://prosite.expasy.org/scanprosite/ (accessed on 1 November 2025)). Graphpad Prism 10.4.1 was used to visualize the overall hydrophobicity (%) of the tropoelastins and to compare tropoelastin hydrophobicity and mean ventral aortic blood pressure. Due to the small sample size, the hydrophobicity data did not meet the assumption for normality using the D’Agostino and Pearson test, and one-way ANOVA followed by Kruskal–Wallis test was therefore applied.

2.2. Fish Hold and Heart Sampling

Rainbow trout eggs were fertilized with milt of sex-reversed females supplied by AquaGen breeding company and incubated at 10 °C at the Aquaculture Research Station at Sunndalsøra, Norway, from 22 March 2023. The hatched larvae were transported before starting to feed to Svanøy Havbruk farming rainbow trout at Svanøy island on the west coast of Norway. The all-female fish were raised at 10 °C under 24 h light cycle that was changed to 12 h:12 h light-dark cycle at 100 g to adapt the fish to natural photoperiod before seawater transfer. The fish were kept in fiberglass tanks from 16 to 280 m3 at densities varying with the fish size and were supplied with water from the local lake, Sagevatn, at water flow and stock densities varying with fish age. The oxygen levels were monitored continuously, and the fish were fed daily with commercial pellets adjusted to the appetite using automated feeders. Pit-tagged fish were transferred to seawater on 15 December 2023 and were kept in net pens until slaughtering at body weight of about 3500 g on 12 December 2024.
Twenty fish were sampled for qPCR analysis of the cardiac expression of the three eln genes during the freshwater phase at body weight of about 1 g (22 May 2023), 10 g (18 August 2023), and 100 g (1 December 2023), and finally at about 700 g in seawater (13 May 2024). The four time points for tissue sampling throughout one year were chosen for proper removal of the heart from 1 g fry and for dissection of the bulbus and ventricle from 10 g juveniles and later from 100 and 700 g fish before and after seawater transfer. The fish were anesthetized with MS-222 (tricaine methanesulfonate, 150 mg·L−1) and killed with a blow to the head at Svanøy Havbruk. The heart was removed and was stored in RNA-later at −80 °C for four months until extraction of RNA from bulbus and ventricle dissected under microscope. Ten fry of 1 g were fixed in 10% PFA and kept at room temperature before histology and staining.
The study was conducted in accordance with the European Union Directive 2010/63/EU and the National Guidelines for Animal Care and Welfare established by the Norwegian Ministry of Education and Research. The Norwegian Food Safety Authority approved the experiment (FOTS ID 29083). Key personnel involved in the fish trial held FELASA C certification.

2.3. Histology

Formalin-fixed fry (n = 10) were processed overnight in Tissue Processor (Logos EVO, Milestone, Italy). Paraffin-embedded whole fry were sectioned (2 μm) in sagittal plan using a rotary microtome (Leica RM2255, Biosystems, Muttenz, Switzerland) and stained with Elastin Van Gieson (EVG) staining kit (Atom Scientific Ltd., Hyde, UK) according to manufacturer’s instructions. The slides were then analyzed using light microscopy and the QuPath0.3.2, (Quantitative Pathology & Bioimage Analysis) software. Images were scanned with Leica AperioCS2 slide scanner (Leica Biosystems, Deer Park, IL, USA) at 40× magnification.

2.4. Gene Expression Analysis

Total RNA was extracted from heart tissue using Proteinase K digestion followed by Agencourt RNAadvanced Tissue Kit® (Beckman Coulter Inc., Brea, CA, USA) using the Biomek 4000® robotic workstation according to the manufacturer’s protocol. RNA concentration and purity were assessed using a Nanodrop 8000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized from mRNA using the Qiagen QuantiTect Reverse Transcription Kit® that includes genomic DNA removal (Qiagen, Valencia, CA, USA) and then diluted 1:10 for qPCR analysis. No enzyme control and no template control were included as negative controls. The PCR mix consisted of 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 5 μL PowerUp SYBR green (Thermo Fisher Scientific, USA) and 4 μL diluted cDNA. The qPCR conditions were: 50 °C/2 min, 95 °C/20 s; 40 cycles of 95 °C/1 s, 60 °C/20 s. Duplicate technical replicates were included in the qPCR analysis. Biological replicates consisted of 8 samples for bulbus at 10 g, 9 samples for ventricle at 100 g, 10 samples for ventricle at 10 g and 700 g, and 10 samples for bulbus at 100 g and 700 g. The melting curve conditions were 95 °C/1 s, 60 °C/20 s, 95 °C/1 s. Specificity of all primers (Thermo Fisher Scientific, MA, USA) was confirmed by Sanger Sequencing (Eurofins Genomics; Ebersberg, Germany) of amplicons (Table 1). ef1a and b-act were evaluated as reference genes using RefFinder [37], and the relative gene expression level was calculated according to the ΔΔCt method [38] using ef1a as reference gene. Normality was assessed using the Shapiro–Wilk test, which indicated that the data for elna2 and elnb were normally distributed (p > 0.05), but not the data for elna1. Examination of the homoscedasticity plot showed that elna1 and elna2 gene expression data met the assumption of homoscedasticity, whereas elnb did not. Since both normality of the data and homogeneity of the variance were satisfied for elna2, statistical significance was assessed by using one-way ANOVA followed by Tukey’s post hoc test (p < 0.05). For elnb and elna1 gene expression, one-way ANOVA with Kruskal–Wallis test was applied.

3. Results

We identified up to four different eln genes in the sequenced genomes from 51 jawed fish species, including cartilaginous fishes, basal ray-finned fishes, teleost fishes, and lobe-finned fish (Table S1). All genomes examined were shown to contain a syntenic block comprising eln, septin4/septin5 and limk1, except for the missing tarpon (Megalops cyprinoides) elnb linked to septin5 and limk1 on chromosome 3. Examination of the jawless fish genomes revealed no eln-like gene close to the hagfish septin5 (LOC137430108), lamprey septin4 (LOC116957768) and lamprey limk1 (LOC116958416).
All non-teleost genomes contain a single eln gene, whereas duplicated elna and elnb genes were found in teleosts, including Northern pike (Esox lupius) and grass carp (Ctenopharyngodon idella), which are diploid relatives to tetraploid salmonids and cyprinids, respectively. The salmonids examined have duplicated elna1 and elna2 paralogs, but only a single elnb gene, except for the tandem duplicated elnb1 and elnb2 genes in sockeye salmon (Oncorhynchus nerka) and lake whitefish (Coregonus clupeaformis) (Figure 1). Common carp has four eln genes named elna1, elna2, elnb1 and elnb2 located on separate chromosomes, while only elna1, elna2 and elnb were identified in goldfish (Carassius auratus).
All fish eln genes were found to contain multiple hydrophilic and hydrophobic exons, but the exon length varies considerably among the species and between the paralogs. Probably the most remarkable genetic structure is found in the lesser devil ray (Mobula hypostoma) eln gene, which consists of 70 exons containing multiple copies of 36-nt and 48-nt long exons coding for alternating hydrophilic and hydrophobic domains, respectively (Figure 2 and Figure S1). The lesser devil ray tropoelastin has 24 KAAK crosslinks, and the KA type also dominated in teleost ElnA, including rainbow trout ElnA1 and ElnA2 (Figure 3A,B). Most ElnB paralogs contained both KA and KP types, such as rainbow trout ElnB (Figure 3C), while the ray-finned species spotted gar, bowfin and gray bichir exhibited mainly KP domains (Figure S2). Similarly to the single eln gene in non-teleost fish, the teleost elna gene comprises multiple short exons, whereas the elnb paralog consists of considerably larger hydrophobic and hydrophilic exons. For example, yellowfin tuna (Thunnus albacares) ElnA of 1096 aa has 52 short exons, except for the 180-nt long exon 20, while the partial ElnB of 1433 aa is coded by 31 extended exons, such as 441-nt long exon 28. The genetic structure also differs between the elna and elnb genes in the tetraploid salmonids and cyprinids. The three rainbow trout eln genes have about the same number of exons, but the 2441-aalong ElnB consists of much longer hydrophobic and hydrophilic domains compared to ElnA1 and ElnA2 of 1357 and 1403 aa, respectively (Figure 3). KA and KP crosslinks are found in both short and long domains of ElnB, making the distinction between hydrophobic and crosslinking regions less clear. The hydrophobicity plot of rainbow trout ElnB shows that the extended domains comprise both hydrophobic and hydrophilic sequences, consistent with the low overall hydrophobicity of ElnB (Figure S2).
Histochemical analysis of 2-month-old rainbow trout fry revealed strong elastin staining in the bulbus and ventral aorta (Figure 4). Elastin was weakly stained in the bulboventricular valve and pericardium, but not in the ventricle. qPCR quantification of the three eln gene expression levels showed that elnb dominated in the fry heart, and the elnb expression was 15 times higher in the bulbus than in the ventricle of the juvenile fish (Figure 5). The bulbar expression of elna1 and elna2 genes was significantly lower than elnb, but the total amounts of elna1 and elna2 transcripts were almost similar to the elnb transcripts in the bulbus.
The overall hydrophobicity of fish tropoelastin varies largely among species, ranging from 28.6% in Emerald rockcod ElnB to 56.3% in the lesser devil ray Eln. The hydrophobicity of the teleost ElnB paralogs (33.4 ± 3.6%) was significantly lower than the levels in cartilaginous fish (48.7 ± 3.8%) and teleost ElnA (42.2 ± 3.9%), which were not significantly different from the hydrophobicity of the reptiles, birds and mammals examined (Figure 6).
A relation between the mean ventral aortic blood pressure and the overall tropoelastin hydrophobicity was examined in various fish species. No correlation was found between the blood pressure levels and the hydrophobicity levels of non-teleost Eln and teleost ElnA (Figure 7). Moreover, the overall hydrophobicity of the teleost ElnB paralog showed no relationship with the blood pressure in the bulbus, where pressure levels were derived from the strong correlation between bulbar plateau pressure and ventral aortic pressure [39]. By broadening the analysis to include tetrapods, we identified a positive relationship between ventral aortic pressure and tropoelastin hydrophobicity (Figure 7).

4. Discussion

The systematic survey of eln genes in the sequenced genomes from diverse fish species identified up to four different tropoelastins in jawed species sharing the characteristic properties of multiple alternating hydrophobic and hydrophilic domains with KA and KP crosslinks ending with a Cys pair in the negatively charged C-terminal end. Whereas the linear sequence of the single tropoelastin in sharks and rays seems to be well conserved, teleost ElnA and ElnB have diverged considerably in accordance with the subfunctionalization of the paralogs in zebrafish [23,24,25]. Consistent with the differential expression of elna and elnb in the developing zebrafish heart, the expression of rainbow trout elnb dominated in the fry heart and in the bulbus at later stages. The spatial and temporal expression of elnb should be further compared with elna1 and elna2 in the developing heart during embryogenesis using in situ hybridization and specific antibodies.
The low stiffness imparted by zebrafish ElnB for proper bulbus cell fate and function was predicted to be the result of the long hydrophobic domains in ElnB [4,23,25]. The high distensibility and resilience of the bulbus have consistently been reported in tuna fish, carp and rainbow trout [4,23,25] and were calculated to account for 25% of the blood flow in rainbow trout at rest [40]. Thermal remodeling of the rainbow trout heart during cold acclimation resulted in decreased elastin-to-collagen ratio and increased stiffness in the bulbus [41]. Intriguingly, the elnb gene is apparently missing in the genome of the tarpon, which branched off very early in teleost evolution. This athletic air-breathing fish has a unique heart with a prominent bulbus arteriosus in addition to a distinct, vestigial conus arteriosus [42,43]. The highly hydrophobic tarpon ElnA consists of only short hydrophobic and hydrophilic domains and probably does not function like an ElnB paralog in this species.
The Antarctic icefish ElnB paralog has very low overall hydrophobicity, such as the red-blooded Emerald rockcod (Trematomus bernacchii), which, together with the white-blooded crocodile icefish (Chionodraco hamatus), lacks elastin in the bulbus [44,45]. The low hydrophobicity and few crosslinks may explain the possible inability of the bulbar elastin in Antarctic icefish to aggregate into larger units at freezing temperatures [44]. In human elastin, disruptions of the hydrophobic domains were shown to be detrimental to the self-assembly process, and mutated human elastin required much higher temperatures than the normal physiological temperature to achieve full coacervation [46]. On the other hand, the absence of elastin fibers in Antarctic fish could be simply the result of extreme morpho-functional adaptation to constant sub-zero temperatures [46]. The Antarctic icefishes have very large hearts, high blood volumes and low blood pressure, and smooth muscle cells may contribute to the elastic properties of the bulbus, maintaining constant aortic flow in the large branchial vessels [45,47,48,49].
Except for Antarctic icefishes, the various fish species examined revealed no relationship between tropoelastin hydrophobicity and blood pressure in ventral aorta. Cartilaginous fish exhibit highly hydrophobic tropoelastin, but slow-mowing sharks have low blood pressure below 4 kPa, while blood pressure around 7 kPa has been recorded in fast-mowing sharks, which is probably similar in rays [50,51,52,53]. In comparison, lobe-finned fish exhibited relative high tropoelastin hydrophobicity, while low blood pressure of 3.1 kPa was measured in West-African lungfish (P. annectens) [54]. Similarly, the sterlet sturgeon (Acipenser ruthenus) showed the highest hydrophobicity of 44.8% among non-teleostean ray-finned fish, but blood pressure less than 3 kPa was reported in white sturgeon [55]. Except for tarpon and baby whalefish (Brienomyrus brachyistius), all teleost tropoelastins examined have hydrophobicity below 50%, but show large differences in ventral aortic blood pressure varying from 0.3 to 13 kPa in zebrafish and tuna fish, respectively [56,57]. While the overall hydrophobicity of ElnA is higher than ElnB in the two species, the importance of the long hydrophobic domains for the elasticity in zebrafish ElnB [4,23] should be further investigated in other teleost species. On the other hand, the fast-swimming tuna fish has thick aortic elastin lamella and bulbar elastin fibers, in contrast to the thinner, less developed elastin fibers in zebrafish [22,23,57]. Consistently, the higher elastin content in some species than in others probably gives higher tissue compliance and elasticity [19,21,40,58,59].

5. Conclusions

The single tropoelastin in non-teleosts has been well conserved during 450 million years of evolution, but structural differences among species may be related to dissimilar adaptations and functional requirements. The structural and functional divergence of the duplicated ElnA and ElnB seems to be similar in zebrafish and tetraploid rainbow trout, but the cardiac expression of the three eln genes in rainbow trout should be further examined during embryogenesis. The crucial role played by ElnB in the development of bulbus seems to be absent in Antarctic icefish, lacking bulbar elastin, and in the early teleostean tarpon, apparently missing the elnb gene. This study showed no evolutionary tendency towards increased hydrophobicity of vertebrate tropoelastins. When tetrapods were incorporated into the analysis, a positive association emerged between ventral aortic pressure and tropoelastin hydrophobicity.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes16121492/s1, Figure S1: Nucleotide sequence alignment (Kalign) of the protein coding exon in the lesser devil ray eln gene (LOC134336752). The multiple copies of a 36-nt exon and a 48-nt exon code for alternating hydrophilic crosslinks and hydrophobic domains, respectively; Figure S2: Amino acid sequences of the tropoelastin in ray-finned fishes spotted gar (A), bowfin (B), gray bichir (C) and sterlet sturgeon (C), and the lobe-finned fishes West-African lungfish (D) and African coelacanth (E). Putative crosslinks are underlined. NCBI accession numbers are given in Table S1. Figure S3: Kyte–Doolittle hydropathy plot of rainbow trout ElnB visualizing the hydrophobic and hydrophilic domains; Table S1: Overview of the fish and tetrapod tropoelastins examined in this study, including NCBI ID, amino acid numbers and overall hydrophobicity levels. Mean ventral aortic blood pressure levels recorded in various fish species and references are given at right. Refs. [60,61,62,63,64,65,66,67,68,69,70] are cited in Supplementary Materials.

Author Contributions

Conceptualization and methodology, Ø.A. and T.-K.K.Ø.; molecular analysis, T.-K.K.Ø.; writing manuscript, Ø.A.; review and editing, Ø.A. and T.-K.K.Ø. All authors have read and agreed to the published version of the manuscript.

Funding

Svanøy Havbruk received funding from the Norwegian Research Council managing “Skattefunn” (Tax Deduction for Research and Development Projects).

Institutional Review Board Statement

The study was conducted in accordance with the European Union Directive 2010/63/EU and the National Guidelines for Animal Care and Welfare established by the Norwegian Ministry of Education and Research. The Norwegian Food Safety Authority approved the experiment (FOTS ID 29083, approval date 17 January 2022). Key personnel involved in the fish trial held FELASA C certification.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and in Supplementary Materials. Further inquiries can be directed to the corresponding author. Table S1 gives the accession numbers of the fish elastin examined. Figure S1 gives the alignment of the multiple copies encoding alternating hydrophilic and hydrophobic domains in the lesser devil ray elastin. Figure S2 shows ray-finned and lobe-finned tropoelastin protein with crosslinks. Figure S3 gives the Kyte-Doolittle hydropathy plot of rainbow trout ElnB.

Acknowledgments

The authors wish to thank Miroslava Hansen for the excellent histochemical work and Torstein Tengs for performing the phylogenetic analysis. Marianne H. S. Hansen and Mari A. Braaten are greatly acknowledged for the qPCR analyses. We thank Svanøy Havbruk for supplying the fish and Monica Kaldberg for sampling the tissues.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Sato, F.; Wachi, H.; Ishida, M.; Nonaka, R.; Onoue, S.; Urban, Z.; Starcher, B.C.; Seyama, Y. Distinct steps of cross-linking, self-association, and maturation of tropoelastin are necessary for elastic fiber formation. J. Mol. Biol. 2007, 369, 841–851. [Google Scholar] [CrossRef]
  2. Schmelzer, C.E.; Hedtke, T.; Heinz, A. Unique molecular networks: Formation and role of elastin cross-links. IUBMB Life 2020, 72, 842–854. [Google Scholar] [PubMed]
  3. Shapiro, S.; Endicott, S.; Province, M.; Pierce, J.; Campbell, E. Marked longevity of human lung parenchymal elastic fibers deduced from prevalence of D-aspartate and nuclear weapons-related radiocarbon. J. Clin. Investig. 1991, 87, 1828–1834. [Google Scholar]
  4. Chung, M.I.; Miao, M.; Stahl, R.J.; Chan, E.; Parkinson, J.; Keeley, F.W. Sequences and domain structures of mammalian, avian, amphibian and teleost tropoelastins: Clues to the evolutionary history of elastins. Matrix Biol. 2006, 25, 492–504. [Google Scholar] [CrossRef] [PubMed]
  5. Urry, D.W.; Starcher, B.; Partridge, S. Coacervation of solubilized elastin effects a notable conformational change. Nature 1969, 222, 795–796. [Google Scholar] [CrossRef]
  6. Cox, B.A.; Starcher, B.C.; Urry, D.W. Coacervation of tropoelastin results in fiber formation. J. Biol. Chem. 1974, 249, 997–998. [Google Scholar] [CrossRef]
  7. Rauscher, S.; Baud, S.; Miao, M.; Keeley, F.W.; Pomes, R. Proline and glycine control protein self-organization into elastomeric or amyloid fibrils. Structure 2006, 14, 1667–1676. [Google Scholar] [CrossRef]
  8. Kozel, B.A.; Mecham, R.P. Elastic fiber ultrastructure and assembly. Matrix Biol. 2019, 84, 31–40. [Google Scholar] [CrossRef]
  9. Bedell-Hogan, D.; Trackman, P.; Abrams, W.; Rosenbloom, J.; Kagan, H. Oxidation, cross-linking, and insolubilization of recombinant tropoelastin by purified lysyl oxidase. J. Biol. Chem. 1993, 268, 10345–10350. [Google Scholar] [CrossRef]
  10. Schräder, C.U.; Heinz, A.; Majovsky, P.; Mayack, B.K.; Brinckmann, J.; Sippl, W.; Schmelzer, C.E. Elastin is heterogeneously cross-linked. J. Biol. Chem. 2018, 293, 15107–15119. [Google Scholar] [CrossRef] [PubMed]
  11. Miao, M.; Sitarz, E.; Bellingham, C.M.; Won, E.; Muiznieks, L.D.; Keeley, F.W. Sequence and domain arrangements influence mechanical properties of elastin-like polymeric elastomers. Biopolym. Orig. Res. Biomol. 2013, 99, 392–407. [Google Scholar] [CrossRef] [PubMed]
  12. Nonaka, R.; Sato, F.; Wachi, H. Domain 36 of tropoelastin in elastic fiber formation. Biol. Pharm. Bull. 2014, 37, 698–702. [Google Scholar] [CrossRef] [PubMed]
  13. Bax, D.V.; Rodgers, U.R.; Bilek, M.M.; Weiss, A.S. Cell adhesion to tropoelastin is mediated via the C-terminal GRKRK motif and integrin αVβ3. J. Biol. Chem. 2009, 284, 28616–28623. [Google Scholar] [CrossRef] [PubMed]
  14. Kozel, B.A.; Wachi, H.; Davis, E.C.; Mecham, R.P. Domains in tropoelastin that mediate elastin depositionin vitro and in vivo. J. Biol. Chem. 2003, 278, 18491–18498. [Google Scholar] [CrossRef] [PubMed]
  15. Elliott, W.; Guo, D.; Veldtman, G.; Tan, W. Effect of viscoelasticity on arterial-like pulsatile flow dynamics and energy. J. Biomech. Eng. 2020, 142, 041001. [Google Scholar] [CrossRef]
  16. Faury, G. Function–structure relationship of elastic arteries in evolution: From microfibrils to elastin and elastic fibres. Pathol. Biol. 2001, 49, 310–325. [Google Scholar] [CrossRef]
  17. Belz, G.G. Elastic properties and Windkessel function of the human aorta. Cardiovasc. Drugs Ther. 1995, 9, 73–83. [Google Scholar] [CrossRef]
  18. Randall, D. Functional morphology of the heart in fishes. Am. Zool. 1968, 8, 179–189. [Google Scholar] [CrossRef]
  19. Licht, J.H.; Harris, W.S. The structure, composition and elastic properties of the teleost bulbus arteriosus in the carp, Cyprinus carpio. Comp. Biochem. Physiol. Part A Physiol. 1973, 46, 699–708. [Google Scholar] [CrossRef]
  20. Farrell, A. The Wind-Kessel effect of the bulbus arteriosus in trout. J. Exp. Zool. 1979, 209, 169–173. [Google Scholar] [CrossRef]
  21. Icardo, J.; Colvee, E.; Cerra, M.C.; Tota, B. The bulbus arteriosus of stenothermal and temperate teleosts: A morphological approach. J. Fish Biol. 2000, 57, 121–135. [Google Scholar] [CrossRef]
  22. Braun, M.H.; Brill, R.W.; Gosline, J.M.; Jones, D.R. Form and function of the bulbus arteriosus in yellowfin tuna (Thunnus albacares): Dynamic properties. J. Exp. Biol. 2003, 206, 3327–3335. [Google Scholar] [CrossRef] [PubMed]
  23. Miao, M.; Bruce, A.; Bhanji, T.; Davis, E.; Keeley, F. Differential expression of two tropoelastin genes in zebrafish. Matrix Biol. 2007, 26, 115–124. [Google Scholar] [CrossRef] [PubMed]
  24. Moriyama, Y.; Ito, F.; Takeda, H.; Yano, T.; Okabe, M.; Kuraku, S.; Keeley, F.W.; Koshiba-Takeuchi, K. Evolution of the fish heart by sub/neofunctionalization of an elastin gene. Nat. Commun. 2016, 7, 10397. [Google Scholar] [CrossRef]
  25. Matsuki, S.; Inoue, Y.; Watanabe, R.; Mitsui, T.; Moriyama, Y. Extracellular stiffness regulates cell fate determination and drives the emergence of evolutionary novelty in teleost heart. bioRxiv 2025. [Google Scholar] [CrossRef]
  26. Macqueen, D.J.; Johnston, I.A. A well-constrained estimate for the timing of the salmonid whole genome duplication reveals major decoupling from species diversification. Proc. R. Soc. B Biol. Sci. 2014, 281, 20132881. [Google Scholar] [CrossRef]
  27. Chow, M.; Boyd, C.D.; Iruela-Arispe, M.-L.; Wrenn, D.S.; Mecham, R.; Sage, E.H. Characterization of elastin protein and mRNA from salmonid fish (Oncorhynchus kisutch). Comp. Biochem. Physiol. Part B Comp. Biochem. 1989, 93, 835–845. [Google Scholar] [CrossRef]
  28. Jamhawi, N.M.; Koder, R.L.; Wittebort, R.J. Elastin recoil is driven by the hydrophobic effect. Proc. Natl. Acad. Sci. USA 2024, 121, e2304009121. [Google Scholar] [CrossRef] [PubMed]
  29. Sage, H. Structure-function relationships in the evolution of elastin. J. Investig. Dermatol. 1982, 79, 146–153. [Google Scholar] [CrossRef]
  30. Sage, H.; Gray, W. Studies on the evolution of elastin—III. The ancestral protein. Comp. Biochem. Physiol. Part B Comp. Biochem. 1981, 68, 473–480. [Google Scholar] [CrossRef]
  31. Sage, H.; Gray, W. Studies on the evolution of elastin—I. Phylogenetic distribution. Comp. Biochem. Physiol. B Comp. Biochem. 1979, 64, 313–327. [Google Scholar]
  32. Chalmers, G.; Gosline, J.; Lillie, M. The hydrophobicity of vertebrate elastins. J. Exp. Biol. 1999, 202, 301–314. [Google Scholar] [CrossRef]
  33. Wang, K.; Shen, Y.; Yang, Y.; Gan, X.; Liu, G.; Hu, K.; Li, Y.; Gao, Z.; Zhu, L.; Yan, G. Morphology and genome of a snailfish from the Mariana Trench provide insights into deep-sea adaptation. Nat. Ecol. Evol. 2019, 3, 823–833. [Google Scholar] [CrossRef]
  34. Xu, W.; Zhu, C.; Gao, X.; Wu, B.; Xu, H.; Hu, M.; Zeng, H.; Gan, X.; Feng, C.; Zheng, J. Chromosome-level genome assembly of hadal snailfish reveals mechanisms of deep-sea adaptation in vertebrates. eLife 2023, 12, RP87198. [Google Scholar] [CrossRef] [PubMed]
  35. Kumar, S.; Stecher, G.; Suleski, M.; Sanderford, M.; Sharma, S.; Tamura, K. MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Mol. Biol. Evol. 2024, 41, msae263. [Google Scholar] [CrossRef] [PubMed]
  36. Kyte, J.; Doolittle, R.F. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 1982, 157, 105–132. [Google Scholar] [CrossRef] [PubMed]
  37. Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
  38. Pfaffl, M.W. Quantification strategies in real-time PCR. In A–Z of Quantitative PCR; Bustin, S.A., Ed.; International University Line: La Jolla, CA, USA, 2004; pp. 87–120. [Google Scholar]
  39. Jones, D.R.; Perbhoo, K.; Braun, M.H. Necrophysiological determination of blood pressure in fishes. Naturwissenschaften 2005, 92, 582–585. [Google Scholar] [CrossRef]
  40. Priede, I.G. Functional morphology of the bulbus arteriosus of rainbow trout (Salmo gairdneri Richardson). J. Fish Biol. 1976, 9, 209–216. [Google Scholar] [CrossRef]
  41. Keen, A.N.; Mackrill, J.J.; Gardner, P.; Shiels, H.A. Compliance of the fish outflow tract is altered by thermal acclimation through connective tissue remodelling. J. R. Soc. Interface 2021, 18, 20210492. [Google Scholar] [CrossRef]
  42. Parsons, C. The conus arteriosus in fishes. J. Cell Sci. 1929, 2, 145–176. [Google Scholar] [CrossRef]
  43. Farrell, A.; Simonot, D.; Seymour, R.; Clark, T. A novel technique for estimating the compact myocardium in fishes reveals surprising results for an athletic air-breathing fish, the Pacific tarpon. J. Fish Biol. 2007, 71, 389–398. [Google Scholar] [CrossRef]
  44. Icardo, J.M.; Colvee, E.; Cerra, M.C.; Tota, B. Bulbus arteriosus of the Antarctic teleosts. I. The white-blooded Chionodraco hamatus. Anat. Rec. Off. Publ. Am. Assoc. Anat. 1999, 254, 396–407. [Google Scholar] [CrossRef]
  45. Icardo, J.M.; Colvee, E.; Cerra, M.C.; Tota, B. Bulbus arteriosus of the Antarctic teleosts. II. The red-blooded Trematomus bernacchii. Anat. Rec. 1999, 256, 116–126. [Google Scholar] [CrossRef]
  46. Toonkool, P.; Jensen, S.A.; Maxwell, A.L.; Weiss, A.S. Hydrophobic domains of human tropoelastin interact in a context-dependent manner. J. Biol. Chem. 2001, 276, 44575–44580. [Google Scholar] [CrossRef]
  47. Sloop, G. The cardiovascular system of Antarctic Icefish appears to have been designed to utilize hemoglobinless blood. BIO-Complexity 2022, 2022, 1–12. [Google Scholar] [CrossRef]
  48. Sidell, B.D.; O’Brien, K.M. When bad things happen to good fish: The loss of hemoglobin and myoglobin expression in Antarctic icefishes. J. Exp. Biol. 2006, 209, 1791–1802. [Google Scholar] [CrossRef] [PubMed]
  49. Zummo, G.; Acierno, R.; Agnisola, C.; Tota, B. The heart of the icefish: Bioconstruction and adaptation. Braz. J. Med. Biol. Res. 1995, 28, 1265–1276. [Google Scholar]
  50. Taylor, E.; Short, S.T.; Butler, P. The role of the cardiac vagus in the response of the dogfish Scyliorhinus canicula to hypoxia. J. Exp. Biol. 1977, 70, 57–75. [Google Scholar] [CrossRef]
  51. Lai, N.C.; Korsmeyer, K.E.; Katz, S.; Holts, D.B.; Laughlin, L.M.; Graham, J.B. Hemodynamics and blood properties of the shortfin mako shark (Isurus oxyrinchus). Copeia 1997, 1997, 424–428. [Google Scholar] [CrossRef]
  52. Speers-Roesch, B.; Brauner, C.J.; Farrell, A.P.; Hickey, A.J.; Renshaw, G.M.; Wang, Y.S.; Richards, J.G. Hypoxia tolerance in elasmobranchs. II. Cardiovascular function and tissue metabolic responses during progressive and relative hypoxia exposures. J. Exp. Biol. 2012, 215, 103–114. [Google Scholar] [CrossRef]
  53. Shadwick, R.E.; Bernal, D.; Bushnell, P.G.; Steffensen, J.F. Blood pressure in the Greenland shark as estimated from ventral aortic elasticity. J. Exp. Biol. 2018, 221, jeb186957. [Google Scholar] [CrossRef] [PubMed]
  54. Szidon, J.P.; Lahiri, S.; Lev, M.; Fishman, A.P. Heart and circulation of the African lungfish. Circul. Res. 1969, 25, 23–38. [Google Scholar] [CrossRef] [PubMed]
  55. da Silva Braga, V.H.; Armelin, V.A.; Noll, I.G.; Florindo, L.H.; Milsom, W.K. Cardiorespiratory reflexes in white sturgeon (Acipenser transmontanus): Lack of cardiac baroreflex response to blood pressure manipulation? Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2024, 288, 111554. [Google Scholar] [CrossRef] [PubMed]
  56. Hu, N.; Yost, H.J.; Clark, E.B. Cardiac morphology and blood pressure in the adult zebrafish. Anat. Rec. Off. Publ. Am. Assoc. Anat. 2001, 264, 1–12. [Google Scholar] [CrossRef]
  57. Braun, M.H.; Brill, R.W.; Gosline, J.M.; Jones, D.R. Form and function of the bulbus arteriosus in yellowfin tuna (Thunnus albacares), bigeye tuna (Thunnus obesus) and blue marlin (Makaira nigricans): Static properties. J. Exp. Biol. 2003, 206, 3311–3326. [Google Scholar] [CrossRef]
  58. Watson, A.; Cobb, J. A comparative study on the innervation and the vascularization of the bulbus arteriosus in teleost fish. Cell Tissue Res. 1979, 196, 337–346. [Google Scholar] [CrossRef]
  59. Benjamin, M.; Norman, D.; Santer, R.; Scarborough, D. Histological, histochemical and ultrastructural studies on the bulbus arteriosus of the sticklebacks, Gasterosteus aculeatus and Pungitius pungitius (Pisces: Teleostei). J. Zool. 1983, 200, 325–346. [Google Scholar] [CrossRef]
  60. Butler, D.G.; Oudit, G.Y.; Cadinouche, M.Z. Angiotensin I-and II-and norepinephrine-mediated pressor responses in an ancient holostean fish, the bowfin (Amia calva). Gen. Comp. Endocrinol. 1995, 98, 289–302. [Google Scholar]
  61. Iversen, N.K.; Bayley, M.; Wang, T. Autonomic control of the heart in the Asian swamp eel (Monopterus albus). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2011, 158, 485–489. [Google Scholar] [CrossRef]
  62. Axelsson, M.; Farrell, A.P. Coronary blood flow in vivo in the coho salmon (Oncorhynchus kisutch). Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1993, 264, R963–R971. [Google Scholar] [CrossRef]
  63. Forster, M.; Davie, P.; Davison, W.; Satcheli, G.; Wells, R. Blood pressures and heart rates in swimming hagfish. Comp. Biochem. Physiol. Part A Physiol. 1988, 89, 247–250. [Google Scholar] [CrossRef]
  64. Clark, R.J.; Rodnick, K.J. Pressure and volume overloads are associated with ventricular hypertrophy in male rainbow trout. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 1999, 277, R938–R946. [Google Scholar] [CrossRef] [PubMed]
  65. Lillywhite, H.B.; Seymour, R.S. Regulation of arterial blood pressure in Australian tiger snakes. J. Exp. Biol. 1978, 75, 65–79. [Google Scholar] [CrossRef] [PubMed]
  66. Jensen, B.; Elfwing, M.; Elsey, R.M.; Wang, T.; Crossley, D.A., II. Coronary blood flow in the anesthetized American alligator (Alligator mississippiensis). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2016, 191, 44–52. [Google Scholar] [CrossRef] [PubMed]
  67. Jensen, B.; Nielsen, J.M.; Axelsson, M.; Pedersen, M.; Löfman, C.; Wang, T. How the python heart separates pulmonary and systemic blood pressures and blood flows. J. Exp. Biol. 2010, 213, 1611–1617. [Google Scholar] [CrossRef]
  68. Smith, F.M. Blood pressure regulation by aortic baroreceptors in birds. Physiol. Zool. 1994, 67, 1402–1425. [Google Scholar] [CrossRef]
  69. Seymour, R.S.; Blaylock, A.J. The principle of Laplace and scaling of ventricular wall stress and blood pressure in mammals and birds. Physiol. Biochem. Zool. 2000, 73, 389–405. [Google Scholar] [CrossRef]
  70. Paranjape, V.V.; Gatson, B.J.; Bailey, K.; Wellehan, J.F. Cuff size, cuff placement, blood pressure state, and monitoring technique can influence indirect arterial blood pressure monitoring in anesthetized bats (Pteropus vampyrus). Am. J. Vet. Res. 2023, 84. [Google Scholar] [CrossRef]
Genes 16 01492 g001
Figure 1. Maximum likelihood phylogenetic analysis of the tropoelastins in tetraploid salmonids and cyprinids based on amino acid sequences. The tandem duplicated ElnB2 in sockeye salmon and lake whitefish was excluded due to low sequence similarities. Northern pike and grass carp ElnA and ElnB were included for comparison, and spotted gar Eln was used as outgroup. Bootstrap values > 75% have been indicated. NCBI accession numbers are given in Table S1.
Figure 1. Maximum likelihood phylogenetic analysis of the tropoelastins in tetraploid salmonids and cyprinids based on amino acid sequences. The tandem duplicated ElnB2 in sockeye salmon and lake whitefish was excluded due to low sequence similarities. Northern pike and grass carp ElnA and ElnB were included for comparison, and spotted gar Eln was used as outgroup. Bootstrap values > 75% have been indicated. NCBI accession numbers are given in Table S1.
Genes 16 01492 g001
Genes 16 01492 g002
Figure 2. Elastin of the lesser devil ray with alternating hydrophilic and hydrophobic domains. Crosslinks and preceding Ala residues are in yellow color, and imperfect repeats of hydrophobic motives shown in bold. The multiple copies of the corresponding hydrophilic and hydrophobic exons are given in Figure S1.
Figure 2. Elastin of the lesser devil ray with alternating hydrophilic and hydrophobic domains. Crosslinks and preceding Ala residues are in yellow color, and imperfect repeats of hydrophobic motives shown in bold. The multiple copies of the corresponding hydrophilic and hydrophobic exons are given in Figure S1.
Genes 16 01492 g002
Genes 16 01492 g003
Figure 3. Amino acid (aa) sequences with exon borders (/) of rainbow trout ElnA1 (A), ElnA2 (B) and ElnB (C). Exons coding for more than 50 aa are shown in bold. The KA and KP types of crosslinks are underlined.
Figure 3. Amino acid (aa) sequences with exon borders (/) of rainbow trout ElnA1 (A), ElnA2 (B) and ElnB (C). Exons coding for more than 50 aa are shown in bold. The KA and KP types of crosslinks are underlined.
Genes 16 01492 g003
Genes 16 01492 g004
Figure 4. Histochemical EVG staining of elastin in the heart and ventral aorta of rainbow trout fry at two months. Cross-section of ventral aorta and enlarged image of bulboventricular valve are included. Arrowhead shows elastin in pericardium.
Figure 4. Histochemical EVG staining of elastin in the heart and ventral aorta of rainbow trout fry at two months. Cross-section of ventral aorta and enlarged image of bulboventricular valve are included. Arrowhead shows elastin in pericardium.
Genes 16 01492 g004
Genes 16 01492 g005
Figure 5. qPCR quantification of relative expression levels (mean ± SE) of rainbow trout elna1, elna2 and elnb in bulbus and ventricle at 1, 10, 100 and 700 g body weight (n = 8–10). The relative expression levels were normalized using ef1 as reference gene. Different letters indicate significant differences elna1 (uppercase letters), elna2 (lower case) and elnb (lower case and underlined).
Figure 5. qPCR quantification of relative expression levels (mean ± SE) of rainbow trout elna1, elna2 and elnb in bulbus and ventricle at 1, 10, 100 and 700 g body weight (n = 8–10). The relative expression levels were normalized using ef1 as reference gene. Different letters indicate significant differences elna1 (uppercase letters), elna2 (lower case) and elnb (lower case and underlined).
Genes 16 01492 g005
Genes 16 01492 g006
Figure 6. The overall hydrophobicity (Kyte–Doolittle) of full-length tropoelastins in the major fish clades and selected tetrapod species shown in different colors and with the median indicated. Different letters indicate significant differences.
Figure 6. The overall hydrophobicity (Kyte–Doolittle) of full-length tropoelastins in the major fish clades and selected tetrapod species shown in different colors and with the median indicated. Different letters indicate significant differences.
Genes 16 01492 g006
Genes 16 01492 g007
Figure 7. Tropoelastin hydrophobicity plotted against mean ventral aortic blood pressure in various fish and tetrapod species. Trend lines including equation and R2 are given for all species (black), for all fish species (blue), and for teleosts ElnB (brown). References to the blood pressure measurements are given in Table S1. The codes refer to the scientific names. He.oc: Epaulette shark (Hemiscyllium ocellatum), Ca.mi: Elephant shark (Callorhinchus milii), Sc.ca: Spotted catshark (Scyliorhinus canicula), Mo.hy: Lesser Devil ray (Mobula hypostoma), Pr.pe: Smalltooth sawfish (Pristis pectinata), Mo.al: Swamp eel (Monopterus albus), Da.re: Zebrafish (Danio rerio), Ch.ac: Blackfin icefish (Chaenocephalus aceratus), Th.al: Yellow-fin thuna (Thunnus albacares), Ga.mo: Atlantic cod (Gadus morhua), An.ro: American eel (Anguilla rostrata), On.my: Rainbow trout (Oncorhynchus mykiss), On.ki: Coho salmon (Oncorhynchus kisutch), Pr.an: West-African lungfish (Protopterus annectens), Ra.ca: American bullfrog (Rana catespiana), Ch.my: Green sea turtle (Chelonia mydas), No.sc: Tiger snake (Notechis scutatus), Al.si: Chinese alligator (Alligator sinensis), Py.bi: African python (Python bivittatus), Ga.ga: Chicken (Gallus gallus), Se.ca: Common canary (Serinus canaria), St.ca: South African ostrich (Struthio camelus), Ho.sa: Human (Homo sapiens), Mu.mu: Mouse (Mus musculus), Pt.va: Large flying fox (Pteropus vampyrus), Ca.ba: Bactrian camel (Camelus bactrianus).
Figure 7. Tropoelastin hydrophobicity plotted against mean ventral aortic blood pressure in various fish and tetrapod species. Trend lines including equation and R2 are given for all species (black), for all fish species (blue), and for teleosts ElnB (brown). References to the blood pressure measurements are given in Table S1. The codes refer to the scientific names. He.oc: Epaulette shark (Hemiscyllium ocellatum), Ca.mi: Elephant shark (Callorhinchus milii), Sc.ca: Spotted catshark (Scyliorhinus canicula), Mo.hy: Lesser Devil ray (Mobula hypostoma), Pr.pe: Smalltooth sawfish (Pristis pectinata), Mo.al: Swamp eel (Monopterus albus), Da.re: Zebrafish (Danio rerio), Ch.ac: Blackfin icefish (Chaenocephalus aceratus), Th.al: Yellow-fin thuna (Thunnus albacares), Ga.mo: Atlantic cod (Gadus morhua), An.ro: American eel (Anguilla rostrata), On.my: Rainbow trout (Oncorhynchus mykiss), On.ki: Coho salmon (Oncorhynchus kisutch), Pr.an: West-African lungfish (Protopterus annectens), Ra.ca: American bullfrog (Rana catespiana), Ch.my: Green sea turtle (Chelonia mydas), No.sc: Tiger snake (Notechis scutatus), Al.si: Chinese alligator (Alligator sinensis), Py.bi: African python (Python bivittatus), Ga.ga: Chicken (Gallus gallus), Se.ca: Common canary (Serinus canaria), St.ca: South African ostrich (Struthio camelus), Ho.sa: Human (Homo sapiens), Mu.mu: Mouse (Mus musculus), Pt.va: Large flying fox (Pteropus vampyrus), Ca.ba: Bactrian camel (Camelus bactrianus).
Genes 16 01492 g007
Table 1. Primers used in the qPCR analysis of rainbow trout eln and reference genes.
Table 1. Primers used in the qPCR analysis of rainbow trout eln and reference genes.
GeneGenbank IdPrimer Sequence (5′-3′)Efficiency
elna1XM_036965318.1F: ttcgatactgctctggcatgt1.96
R: tggcccctaatctagcacac
elna2XM_021582450.2F: tgtagcctactccgtgatggt1.99
R: cggtattgctgggcacaagt
elnbXM_036944404.1F: caaatcaggttatggctcctcct2.00
R: tgcatggctgtgtatttggct
ef1aAF498320.1F: attaacattgtggtcattggccatgtc2.03
R: atctcagctgcttccttctcgaactttt
b-actXM_036973727.1F: ggaggctccatcttggcttc2.00
R: gaagtggtagtcgggtgtgg
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Andersen, Ø.; Østbye, T.-K.K. Duplication, Divergence and Cardiac Expression of Tropoelastin in Jawed Fishes, Including Tetraploid Rainbow Trout (Oncorhynchus mykiss). Genes 2025, 16, 1492. https://doi.org/10.3390/genes16121492

AMA Style

Andersen Ø, Østbye T-KK. Duplication, Divergence and Cardiac Expression of Tropoelastin in Jawed Fishes, Including Tetraploid Rainbow Trout (Oncorhynchus mykiss). Genes. 2025; 16(12):1492. https://doi.org/10.3390/genes16121492

Chicago/Turabian Style

Andersen, Øivind, and Tone-Kari Knutsdatter Østbye. 2025. "Duplication, Divergence and Cardiac Expression of Tropoelastin in Jawed Fishes, Including Tetraploid Rainbow Trout (Oncorhynchus mykiss)" Genes 16, no. 12: 1492. https://doi.org/10.3390/genes16121492

APA Style

Andersen, Ø., & Østbye, T.-K. K. (2025). Duplication, Divergence and Cardiac Expression of Tropoelastin in Jawed Fishes, Including Tetraploid Rainbow Trout (Oncorhynchus mykiss). Genes, 16(12), 1492. https://doi.org/10.3390/genes16121492

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop