New Insights into the Mechanism by Which the Pituitary Gland Copes with Hypoxia Stress Based on a Transcriptomic Analysis of Megalobrama amblycephala
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals and Feeding
2.3. Hypoxia Challenge and Sample Preparation
2.4. RNA Extraction, Library Construction, and Sequencing
2.5. Differentially Expressed Genes (DEGs)
2.6. GO and KEGG Enrichment Analyses
2.7. Real-Time PCR
3. Results
3.1. Phenotype Analysis of M. amblycephala during the Hypoxia Challenge
3.2. Acquisition of Differentially Expressed Genes in the Pituitary in Response to Hypoxia
3.3. GO Functional Classification of Differentially Expressed Genes
3.4. Differentially Expressed Genes Related to Hypoxia Stress Obtained from KEGG Analysis
3.5. Validation of the RNA-seq Data for Differentially Expressed Genes Associated with Hypoxia Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bickler, P.; Buck, L. Hypoxia Tolerance in Reptiles, Amphibians, and Fishes: Life with Variable Oxygen Availability. Annu. Rev. Physiol. 2007, 69, 145–170. [Google Scholar] [CrossRef] [PubMed]
 - Wu, R.; Zhou, B.; Randall, D.; Woo, N.; Lam, P. Aquatic hypoxia is an disrupter and impairs fish reproduction. Environ. Sci. Technol. 2003, 37, 1137–1141. [Google Scholar] [CrossRef] [PubMed]
 - Shang, E.; Wu, R. Aquatic Hypoxia Is a Teratogen and Affects Fish Embryonic Development. Environ. Sci. Technol. 2004, 38, 4763–4767. [Google Scholar] [CrossRef] [PubMed]
 - Xu, X.C.; Zhang, J.H.; Bao, J.L. Review and Outlook on the Development of Megalobrama amblyocephala Industry in China. Fish. Wealth Guide 2011, 15, 12–14. [Google Scholar]
 - Wang, W.M. The current situation of the breeding industry of Megalobrama amblyocephala. Sci. Fish Farming 2009, 4, 44–45. [Google Scholar]
 - Yang, X.L.; Qu, C.Y.; Zhang, Q.; Feng, J.X.; Jiang, C.; Xie, G.Q.; He, H.Z.; Liu, C.B.; Zhao, S.R. Analysis of Meat Content and Muscle Nutrient Composition of Megalobrama amblyocephala in Yi River. Henan Fish. 2015, 5, 18–21. [Google Scholar]
 - Ge, X.P.; Liu, B.; Miu, L.H.; Zhao, Y.F. Research progress and prospects of healthy breeding technology for the entire industry chain of Megalobrama amblyocephala. J. Fish. 2023, 47, 70–83. [Google Scholar]
 - Law, S.; Wu, R.; Ng, P.K.S.; Yu, R.; Kong, R. Cloning and expression analysis of two distinct HIF-alpha isoforms-gcHIF-1alpha and gcHIF-4alpha—From the hypoxia-tolerant grass carp, Ctenopharyngodon idellus. BMC Mol. Biol. 2006, 7, 15. [Google Scholar] [CrossRef]
 - Yibin, C.; Chen, X.-Q.; Wang, S.; Wang, Y.; Du, J.-Z. Evolution and Regulation of the Downstream Gene of Hypoxia-Inducible Factor-1α in Naked Carp (Gymnocypris przewalskii) from Lake Qinghai, China. J. Mol. Evol. 2008, 67, 570–580. [Google Scholar]
 - Liao, X.; Cheng, L.; Xu, P.; Lu, G.; Wachholtz, M.; Sun, X.; Chen, S. Transcriptome Analysis of Crucian Carp (Carassius auratus), an Important Aquaculture and Hypoxia-Tolerant Species. PLoS ONE 2013, 8, e62308. [Google Scholar] [CrossRef]
 - Shen, R.; Jiang, X.-Y.; Pu, J.-W.; Zou, S.-M. HIF-1α and -2α genes in a hypoxia-sensitive teleost species Megalobrama amblycephala: cDNA cloning, expression and different responses to hypoxia. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2010, 157, 273–280. [Google Scholar] [CrossRef] [PubMed]
 - Sun, B.-Z.; Huang, H.; Cao, W.-X.; Wang, J.-W.; Tan, D.-Q. Studies on the Oxygen Consumption Rate and Asphyxiant Point of Megalobrama pellegrini and Coreius guichcnoti. Acta Hydrobiol. Sin. 2010, 34, 88–93. [Google Scholar] [CrossRef]
 - Semenza, G.; Semenza, G.L. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu. Rev. Cell Dev. Biol. 1999, 15, 551–578. [Google Scholar] [CrossRef] [PubMed]
 - Semenza, G. HIF-1 and mechanism of hypoxia sensing. Curr. Opin. Cell Biol. 2001, 13, 167–171. [Google Scholar] [CrossRef] [PubMed]
 - Manolescu, B.; Oprea, E.; Busu, C.; Cercasov, C. Natural compounds and the hypoxia-inducible factor (HIF) signalling pathway. Biochimie 2009, 91, 1347–1358. [Google Scholar] [CrossRef] [PubMed]
 - Lundby, C.; Calbet, J.; Robach, P. The response of skeletal muscle tissue to hypoxia. Cell. Mol. Life Sci. CMLS 2009, 66, 3615–3623. [Google Scholar] [CrossRef] [PubMed]
 - Fang, S.G.; Liu, D.Q.; Li, Z.; Zou, G.W. The expression regulation mechanism of genes related to animal resistance to hypoxia stress. Chin. J. Biotechnol. 2010, 30, 79–85. [Google Scholar]
 - Zhang, Z.W. Cloning and Expression Analysis of Genes Related to Hypoxia Stress in Silver Carp. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2011. [Google Scholar]
 - Zhai, W.Y. Cloning and Functional Study of IGFBP-1 and HIF-1 α Genes in Japanese Flounder. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2012. [Google Scholar]
 - Shen, R.J. Study on the Structure and Function of Hypoxic Inducing Factors in Megalobrama amblyocephala. Doctoral Dissertation, Shanghai Ocean University, Shanghai, China, 2011. [Google Scholar]
 - Chen, R.L. The current situation and development trend of the breeding industry of Megalobrama amblyocephala. Sci. Fish Farming 2015, 2, 4–5. [Google Scholar]
 - Wang, H.; Huang, C.; Chen, N.; Zhu, K.; Chen, B.; Wang, W.; Wang, H. Molecular characterization and mRNA expression of HIF-prolyl hydroxylase-2 (phd2) in hypoxia-sensing pathways from Megalobrama amblycephala. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2015, 186, 28–35. [Google Scholar] [CrossRef]
 - Zhang, B.; Chen, N.; Huang, C.; Huang, C.; Chen, B.; Liu, H.; Wang, W.; Gul, Y.; Wang, H. Molecular response and association analysis of Megalobrama amblycephala fih-1 with hypoxia. Mol. Genet. Genom. 2016, 291, 1615–1624. [Google Scholar] [CrossRef]
 - Love, M.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-Seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
 - Robinson, M.; McCarthy, D.; Smyth, G. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
 - Consortium, T. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar]
 - Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 1999, 27, 29–34. [Google Scholar] [CrossRef] [PubMed]
 - Xie, L.; Sun, Y.; Tong, Y.; Liu, Y.; Deng, Y. Association of endothelial lipase gene-384A/C with coronary artery disease in Han Chinese people. BMJ Open 2015, 5, e007621. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Chen, B.-X.; Yi, S.; Wang, W.; He, Y.; Huang, Y.; Gao, Z.; Liu, H.; Wang, W.-M.; Wang, H.-L. Transcriptome comparison reveals insights into muscle response to hypoxia in blunt snout bream (Megalobrama amblycephala). Gene 2017, 624, 6–13. [Google Scholar] [CrossRef] [PubMed]
 - Ultsch, G.; Boschung, H.; Ross, M. Metabolism, Critical Oxygen Tension, and Habitat Selection in Darters (Etheostoma). Ecology 1978, 59, 99–107. [Google Scholar] [CrossRef]
 - Shingles, A.; McKenzie, D.; Claireaux, G.; Domenici, P. Reflex Cardioventilatory Responses to Hypoxia in the Flathead Gray Mullet (Mugil cephalus) and Their Behavioral Modulation by Perceived Threat of Predation and Water Turbidity. Physiol. Biochem. Zool. PBZ 2005, 78, 744–755. [Google Scholar] [CrossRef]
 - Sloman, K.; Wood, C.; Scott, G.; Wood, S.; Kajimura, M.; Johannsson, O.; Almeida-Val, V.; Val, A. Tribute to R. G. Boutilier: The effect of size on the physiological and behavioural responses of Oscar, Astronotus ocellatus, to hypoxia. J. Exp. Biol. 2006, 209, 1197–1205. [Google Scholar] [CrossRef]
 - Takasusuki, J.; Fernandes, M.; Severi, W. The occurrence of aerial respiration in Rhinelepis strigosa during progressive hypoxia. J. Fish Biol. 2005, 52, 369–379. [Google Scholar] [CrossRef]
 - Katersky Barnes, R.; King, H.; Carter, C. Hypoxia tolerance and oxygen regulation in Atlantic salmon, Salmo salar from a Tasmanian population. Aquaculture 2011, 318, 397–401. [Google Scholar] [CrossRef]
 - Mandic, M.; Todgham, A.; Richards, J. Mechanisms and evolution of hypoxia tolerance in fish. Proc. Biol. Sci. R. Soc. 2008, 276, 735–744. [Google Scholar] [CrossRef] [PubMed]
 - Fu, S.-J.; Yan, G.; Cao, Z.-D.; Fu, C.; Zhang, A.-J.; Pang, X. Interspecies variation in hypoxia tolerance, swimming performance and plasticity in cyprinids that prefer different habitats. J. Exp. Biol. 2013, 217, 590–597. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, K.; Ruan, Z.; Li, J.; Bian, C.; You, X.; Coon, S.; Shi, Q. A Comparative Genomic and Transcriptomic Survey Provides Novel Insights into N-Acetylserotonin Methyltransferase (ASMT) in Fish. Molecules 2017, 22, 1653. [Google Scholar] [CrossRef] [PubMed]
 - Wang, T.; Jiang, D.-N.; Shi, H.; Mustapha, U.; Deng, S.; Liu, Z.; Li, W.; Chen, H.; Zhu, C.; Li, G. Liver Transcriptomic Analysis of the Effects of Dietary Fish Oil Revealed a Regulated Expression Pattern of Genes in Adult Female Spotted Scat (Scatophagus argus). Front. Mar. Sci. 2021, 8, 784845. [Google Scholar] [CrossRef]
 - Jia, R.; Hou, Y.; Feng, W.; Li, B.; Zhu, J. Alterations at biochemical, proteomic and transcriptomic levels in liver of tilapia (Oreochromis niloticus) under chronic exposure to environmentally relevant level of glyphosate. Chemosphere 2022, 294, 133818. [Google Scholar] [CrossRef] [PubMed]
 - Chen, R.-Y.; Hieu, B.; Audira, G.; Lou, B.; Lin, M.-D.; Hsiao, C.-D. Meta-Transcriptomic Analysis of RNAseq Data Reveals Pacu and Loach Fish with Unusually High Levels of Myoglobin Expression in Skeletal Muscles. Animals 2020, 10, 1130. [Google Scholar] [CrossRef] [PubMed]
 - Tse, W.K.F.; Sun, J.; Zhang, H.; Lai, K.P.; Jie, G.; Law, A.; Yeung, B.; Chow, S.; Qiu, J.-W.; Wong, C. Data for transcriptomic and iTRAQ proteomic analysis of Anguilla japonica gills in response to osmotic stress. Data Brief 2015, 3, 120–125. [Google Scholar] [CrossRef] [PubMed]
 - Gracey, A.; Lee, T.-H.; Higashi, R.; Fan, T. Hypoxia-induced mobilization of stored triglycerides in the euryoxic goby Gillichthys mirabilis. J. Exp. Biol. 2011, 214, 3005–3012. [Google Scholar] [CrossRef]
 - Wulff, T.; Jokumsen, A.; Højrup, P.; Jessen, F. Time-dependent changes in protein expression in rainbow trout muscle following hypoxia. J. Proteom. 2012, 75, 2342–2351. [Google Scholar] [CrossRef]
 - Lassmann, H. Demyelination and Neurodegeneration in Multiple Sclerosis: The Role of Hypoxia. Ann. Neurol. 2016, 79, 520–521. [Google Scholar] [CrossRef]
 - Pugh, C.; Gleadle, J.; Maxwell, P. Hypoxia and oxidative stress in breast cancer. Hypoxia signalling pathways. Breast Cancer Res. BCR 2001, 3, 313–317. [Google Scholar] [CrossRef] [PubMed]
 - Rothwell, N.; Stock, M. Effects of Cold and Hypoxia on Diet-Induced Thermogenesis. In Contributions to Thermal Physiology; Pergamon: Oxford, UK, 1981; pp. 511–513. [Google Scholar]
 - Beaudry, J.; McClelland, G. Thermogenesis in CD-1 mice after combined chronic hypoxia and cold acclimation. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2010, 157, 301–309. [Google Scholar] [CrossRef] [PubMed]
 - Feng, W.; Xue, W.; Zhao, J. Hypoxia-inducible factor 1α is critically involved in metallothionein protection against diabetic cardiomyopathy. FASEB J. 2010, 24, 572.2. [Google Scholar] [CrossRef]
 - Ritthaler, T.; Schricker, K.; Kees, F.; Krämer, B.; Kurtz, A. Acute hypoxia stimulates renin secretion and renin gene expression in vivo but not in vitro. Am. J. Physiol. 1997, 272, 1105–1111. [Google Scholar] [CrossRef]
 - Schweda, F.; Blumberg, F.; Schweda, A.; Kammerl, M.; Holmer, S.R.; Riegger, G.; Pfeifer, M.; Krämer, B. Effects of chronic hypoxia on renal renin gene expression in rats. Nephrol. Dial. Transplant. Off. Publ. Eur. Dial. Transpl. Assoc.-Eur. Ren. Assoc. 2000, 15, 11–15. [Google Scholar] [CrossRef] [PubMed]
 - Krämer, B.; Ritthaler, T.; Schweda, F.; Kees, F.; Schricker, K.; Holmer, S.R.; Kurtz, A. Effects of hypoxia on renin secretion and renal renin gene expression. Kidney Int. 1998, 54, S155–S158. [Google Scholar] [CrossRef]
 - Cheng, J.; Zou, Q.; Xue, Y. Nerol protects against hypoxia/reoxygenation-induced apoptotic injury by activating PI3K/AKT signaling in cardiomyocytes. STEMedicine 2021, 2, e87. [Google Scholar] [CrossRef]
 - Zhang, Z.; Qin, X.; Wang, Z.; Li, Y.; Chen, F.; Chen, R.; Li, C.; Zhang, W.; Zhang, M. Oxymatrine pretreatment protects H9c2 cardiomyocytes from hypoxia/reoxygenation injury by modulating the PI3K/Akt pathway. Exp. Ther. Med. 2021, 21, 1–12. [Google Scholar] [CrossRef]
 - Luo, S.-Y.; Wang, J.-Q.; Liu, C.; Gao, X.-M.; Zhang, Y.-B.; Ding, J.; Hou, C.; Zhu, J.-Q.; Lou, B.; Shen, W.-L.; et al. Hif-1α/Hsf1/Hsp70 signaling pathway regulates redox homeostasis and apoptosis in large yellow croaker (Larimichthys crocea) under environmental hypoxia. Zool. Res. 2021, 42, 746–760. [Google Scholar] [CrossRef]
 - Zhang, L.; Cao, Y.; Guo, X.; Wang, X.; Han, X.; Kanwore, K.; Hong, X.; Zhou, H.; Gao, D. Hypoxia-induced ROS aggravate tumor progression through HIF-1α-SERPINE1 signaling in glioblastoma. J. Zhejiang Univ. Sci. B 2023, 24, 32–49. [Google Scholar] [CrossRef] [PubMed]
 - Bigham, A. Genetics of human origin and evolution: High-altitude adaptations. Curr. Opin. Genet. Dev. 2016, 41, 8–13. [Google Scholar] [CrossRef] [PubMed]
 - Ai, H.; Yang, B.; Li, J.; Xie, X.; Chen, H.; Ren, J. Population history and genomic signatures for high-altitude adaptation in Tibetan pigs. BMC Genom. 2014, 15, 834. [Google Scholar] [CrossRef] [PubMed]
 - Pu, J.; Huang, Y.; Fang, Q.; Wang, J.; Li, W.; Xu, Z.; Wu, X.; Lu, Y.; Wei, H. Hypoxia-induced Fascin-1 upregulation is regulated by Akt/Rac1 axis and enhances malignant properties of liver cancer cells via mediating actin cytoskeleton rearrangement and Hippo/YAP activation. Cell Death Discov. 2021, 7, 385. [Google Scholar] [CrossRef] [PubMed]
 - Lin, Q.; Weis, S.; Yang, G.; Weng, Y.-H.; Helston, R.; Rish, K.; Smith, A.; Bordner, J.; Polte, T.; Gaunitz, F.; et al. Heme Oxygenase-1 Protein Localizes to the Nucleus and Activates Transcription Factors Important in Oxidative Stress. J. Biol. Chem. 2007, 282, 20621–20633. [Google Scholar] [CrossRef] [PubMed]
 - Hristov, K.; Bekyarova, G.; Tzaneva, M. Heme Oxygenase-1 Expression in Brain and Lungs in Hypobaric Hypoxia Exposed Rabbits. Trakia J. Sci. 2015, 13, 45–48. [Google Scholar] [CrossRef]
 - Lee, P.; Jiang, B.-H.; Chin, B.Y.; Iyer, N.; Alam, J.; Semenza, G.; Choi, A. Hypoxia-inducible Factor-1 Mediates Transcriptional Activation of the Heme Oxygenase-1 Gene in Response to Hypoxia. J. Biol. Chem. 1997, 272, 5375–5381. [Google Scholar] [CrossRef]
 - Sedoris, K.; Thomas, S.; Miller, D. Hypoxia induces differential translation of enolase/MBP-1. BMC Cancer 2010, 10, 157. [Google Scholar] [CrossRef]
 - Aaronson, R.; Graven, K.; Tucci, M.; McDonald, R.; Farber, H. Non-neuronal Enolase Is an Endothelial Hypoxic Stress Protein. J. Biol. Chem. 1995, 270, 27752–27757. [Google Scholar] [CrossRef]
 








| Temperature (°C) | DO (mg/L) | pH | Ammonia Nitrogen (mg/L) | Nitrite (mg/L) | |
|---|---|---|---|---|---|
| First Week | 24.2 ± 0.4 | 7.38 | 9.0 | 0.2 | 0.005 | 
| Second Week | 23.3 ± 0.2 | 8.15 | 9.2 | 0.2 | 0.005 | 
| Third Week | 23.2 ± 0.4 | 8.61 | 8.5 | 0.2 | 0.010 | 
| Fourth Week | 22.4 ± 0.1 | 6.89 | 8.6 | 0.2 | 0.010 | 
| Gene Name | Primer Name | Sequence | 
|---|---|---|
| capn1 | capn1-F | CTTTGTTCCCAGCCAGTAGT | 
| capn1-R | GCAGGAGGTTATCGTTTAGAG | |
| hmox | hmox-F | ATCCACGAAAAGCAAACAA | 
| hmox-R | AAGTAGACGGGCTGAACG | |
| hif1an | hif1an-F | TTGTGGTGGATTTCCTTGG | 
| hif1an-R | GCTGGTGTTACATTGCCTTC | |
| Irs2 | Irs2-F | ATGAGAATGGCGAGTCCG | 
| Irs2-R | AGGCACGAGTCCAAATGTA | |
| fscn1 | fscn1-F | AAGAGCCATCTGGGGAGG | 
| fscn1-R | CTGGGCGAAGCAGGTAAT | |
| igf1 | igf1-F | TTTGCGGTACTTTGCTTGC | 
| igf1-R | CATTTGTCATTCCGTTTCTATC | |
| β-actin | β-actin-F | CAGCAGATGTGGATTAGCAA | 
| β-actin-R | CAGTTTGAGTCGGCGTGA | 
| Sample | Average Body Length (cm) | Average Body Weight (g) | |
|---|---|---|---|
| Hypoxia-sensitive group (HS) | HS1 | 10.1 ± 0.1 | 20.5 ± 0.6 | 
| HS2 | 9.5 ± 0.6 | 17.6 ± 0.8 | |
| HS3 | 10.7 ± 0.6 | 21.3 ± 0.5 | |
| Hypoxia-tolerant group (HT) | HT1 | 10.3 ± 0.4 | 20.8 ± 0.4 | 
| HT2 | 9.6 ± 0.5 | 18.9 ± 0.2 | |
| HT3 | 9.8 ± 0.2 | 21.3 ± 0.8 | |
| Normal oxygen control group (C0) | C1 | 9.2 ± 0.4 | 18.4 ± 0.8 | 
| C2 | 9.3 ± 0.7 | 19.2 ± 0.2 | |
| C3 | 9.5 ± 0.4 | 18.9 ± 0.5 | |
| Sample | Total Raw Reads | Total Clean Reads | Q20 Ratio after Filtration (%) | GC Ratio (%) | |
|---|---|---|---|---|---|
| Hypoxia-sensitive group (HS) | HS1-ct | 41.60 | 41.44 | 98.81 | 45.76 | 
| HS2-ct | 42.70 | 42.58 | 98.89 | 47.06 | |
| HS3-ct | 46.57 | 46.37 | 98.49 | 47.20 | |
| Average | 43.62 | 43.46 | |||
| Hypoxia-tolerant group (HT) | HT1-ct | 46.50 | 46.35 | 98.85 | 46.40 | 
| HT2-ct | 41.00 | 40.87 | 98.83 | 46.34 | |
| HT3-ct | 40.76 | 40.62 | 98.50 | 47.17 | |
| Average | 42.75 | 42.61 | |||
| Normal oxygen control group (C0) | C1-ct | 48.48 | 48.33 | 98.80 | 44.39 | 
| C2-ct | 43.09 | 42.94 | 98.43 | 44.66 | |
| C3-ct | 37.05 | 36.93 | 98.41 | 43.82 | |
| Average | 42.88 | 42.73 | |||
| Total | 129.25 | 128.8 | |||
| Ko ID | KEGG Pathway | Gene Number | q-Value | 
|---|---|---|---|
| (a) | |||
| ko05022 | Pathways of neurodegeneration—multiple diseases | 50 | 0.002621 | 
| ko05200 | Pathways in cancer | 55 | 0.005909 | 
| ko05010 | Alzheimer disease | 40 | 0.008931 | 
| ko01521 | EGFR tyrosine kinase inhibitor resistance | 14 | 0.010725 | 
| ko04151 | PI3K-Akt signaling pathway | 38 | 0.010725 | 
| ko05410 | Hypertrophic cardiomyopathy | 16 | 0.010725 | 
| ko04910 | Insulin signaling pathway | 18 | 0.018797 | 
| ko04971 | Gastric acid secretion | 13 | 0.023564 | 
| ko04925 | Aldosterone synthesis and secretion | 16 | 0.027028 | 
| ko00561 | Glycerolipid metabolism | 9 | 0.045174 | 
| ko04714 | Thermogenesis | 22 | 0.045174 | 
| (b) | |||
| ko05022 | Pathways of neurodegeneration—multiple diseases | 69 | 0.000473 | 
| ko05010 | Alzheimer disease | 58 | 0.000473 | 
| ko05206 | MicroRNAs in cancer | 29 | 0.006187 | 
| ko04714 | Thermogenesis | 32 | 0.008774 | 
| ko05415 | Diabetic cardiomyopathy | 30 | 0.008774 | 
| ko04925 | Aldosterone synthesis and secretion | 22 | 0.008774 | 
| ko04920 | Adipocytokine signaling pathway | 16 | 0.009259 | 
| ko00190 | Oxidative phosphorylation | 19 | 0.010375 | 
| ko04722 | Neurotrophin signaling pathway | 21 | 0.018898 | 
| ko04924 | Renin secretion | 16 | 0.028885 | 
| ko05208 | Chemical carcinogenesis—reactive oxygen species | 29 | 0.035122 | 
| ko04961 | Endocrine and other factor-regulated calcium reabsorption | 12 | 0.035802 | 
| ko04932 | Non-alcoholic fatty liver disease | 25 | 0.039190 | 
| ko04152 | AMPK signaling pathway | 20 | 0.041482 | 
| ko05214 | Glioma | 14 | 0.042298 | 
| ko05014 | Amyotrophic lateral sclerosis | 42 | 0.044880 | 
| (c) | |||
| ko05410 | Hypertrophic cardiomyopathy | 11 | 0.000909 | 
| ko00030 | Pentose phosphate pathway | 5 | 0.004514 | 
| ko04066 | HIF-1 signaling pathway | 8 | 0.034028 | 
| (a) | |||
| Ko ID | Gene Abbreviation | Gene | Log2 Fold Change | 
| K01367 | CAPN1 | Calpain-1 | −2.8205 | 
| K02183 | CALM1 | Calmodulin | −2.0736 | 
| K04961 | RYR1 | Ryanodine receptor 1 | −2.8205 | 
| K05199 | GRIA3 | Glutamate receptor 3 | −2.0555 | 
| K13241 | NOS2 | Nitric oxide synthase, inducible | −2.0357 | 
| K05448 | VEGFA | Vascular endothelial growth factor A | −1.1658 | 
| K05459 | IGF1 | Insulin-like growth factor 1 | −2.1498 | 
| K08765 | CPT1A | Carnitine O-palmitoyltransferase 1, liver isoform | −1.9533 | 
| K04356 | NTF3 | Neurotrophin 3 | 1.9761 | 
| (b) | |||
| Ko ID | Gene Abbreviation | Gene | Log2 Fold Change | 
| K23551 | FSCN1 | Fascin 1 | −3.8669 | 
| K05852 | PLN | Phospholamban | −4.6055 | 
| K05262 | ADCYAP | Pituitary adenylate cyclase-activating polypeptide | −4.8438 | 
| K00510 | hmox1 | Heme oxygenase 1 | 3.9614 | 
| K04361 | EGFR | Epidermal growth factor receptor | 1.1630 | 
| K07187 | IRS2 | Insulin receptor substrate 2 | 1.4813 | 
| (c) | |||
| Ko ID | Gene Abbreviation | Gene | Up/Down | 
| K01689 | ENO3 | Enolase | 2.2894 | 
| - | hif1an | HIF-1 alpha subunit inhibitor | 1.3558 | 
| K00134 | GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | 3.0927 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, R.; Guo, H.; Luo, Y.; Huang, W.; Ruan, Z.; Liu, W. New Insights into the Mechanism by Which the Pituitary Gland Copes with Hypoxia Stress Based on a Transcriptomic Analysis of Megalobrama amblycephala. Genes 2024, 15, 987. https://doi.org/10.3390/genes15080987
Xie R, Guo H, Luo Y, Huang W, Ruan Z, Liu W. New Insights into the Mechanism by Which the Pituitary Gland Copes with Hypoxia Stress Based on a Transcriptomic Analysis of Megalobrama amblycephala. Genes. 2024; 15(8):987. https://doi.org/10.3390/genes15080987
Chicago/Turabian StyleXie, Ruilin, Huandi Guo, Yuanyuan Luo, Wen Huang, Zhuohao Ruan, and Wensheng Liu. 2024. "New Insights into the Mechanism by Which the Pituitary Gland Copes with Hypoxia Stress Based on a Transcriptomic Analysis of Megalobrama amblycephala" Genes 15, no. 8: 987. https://doi.org/10.3390/genes15080987
APA StyleXie, R., Guo, H., Luo, Y., Huang, W., Ruan, Z., & Liu, W. (2024). New Insights into the Mechanism by Which the Pituitary Gland Copes with Hypoxia Stress Based on a Transcriptomic Analysis of Megalobrama amblycephala. Genes, 15(8), 987. https://doi.org/10.3390/genes15080987
        
