Novel Cases of Non-Syndromic Hearing Impairment Caused by Pathogenic Variants in Genes Encoding Mitochondrial Aminoacyl-tRNA Synthetases
Abstract
1. Introduction
2. Materials and Methods
2.1. Human Subjects
2.2. DNA Purification and Sequencing
2.3. Assessment of Pathogenicity of DNA Variants
3. Results
3.1. KARS1
3.2. HARS2
3.3. LARS2
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rubio Gomez, M.A.; Ibba, M. Aminoacyl-tRNA synthetases. RNA 2020, 26, 910–936. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.; Jani, J.; Vijayasurya; Mochi, J.; Tabasum, S.; Sabarwal, A.; Pappachan, A. Aminoacyl-tRNA synthetase—A molecular multitasker. FASEB J. 2023, 37, e23219. [Google Scholar] [CrossRef]
- Turvey, A.K.; Horvath, G.A.; Cavalcanti, A.R.O. Aminoacyl-tRNA synthetases in human health and disease. Front. Physiol. 2022, 13, 1029218. [Google Scholar] [CrossRef] [PubMed]
- Santos-Cortez, R.L.P.; Lee, K.; Azeem, Z.; Antonellis, P.J.; Pollock, L.M.; Khan, S.; Irfanullah; Andrade-Elizondo, P.B.; Chiu, I.; Adams, M.D.; et al. Mutations in KARS, encoding lysyl-tRNA synthetase, cause autosomal-recessive nonsyndromic hearing impairment DFNB89. Am. J. Hum. Genet. 2013, 93, 132–140. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.L.; He, L.X.; Yu, L.J.; Wang, Y.; Wang, X.J.; Wang, E.D.; Yang, T. Mutations in KARS cause early-onset hearing loss and leukoencephalopathy: Potential pathogenic mechanism. Hum. Mutat. 2017, 38, 1740–1750. [Google Scholar] [CrossRef] [PubMed]
- Simon, M.; Richard, E.M.; Wang, X.; Shahzad, M.; Huang, V.H.; Qaiser, T.A.; Potluri, P.; Mahl, S.E.; Davila, A.; Nazli, S.; et al. Mutations of human NARS2, encoding the mitochondrial asparaginyl-tRNA synthetase, cause nonsyndromic deafness and Leigh syndrome. PLoS Genet. 2015, 11, e1005097. [Google Scholar] [CrossRef] [PubMed]
- Vanlander, A.V.; Menten, B.; Smet, J.; De Meirleir, L.; Sante, T.; De Paepe, B.; Seneca, S.; Pearce, S.F.; Powell, C.A.; Vergult, S.; et al. Two siblings with homozygous pathogenic splice-site variant in mitochondrial asparaginyl-tRNA synthetase (NARS2). Hum. Mutat. 2015, 36, 222–231. [Google Scholar] [CrossRef] [PubMed]
- Pierce, S.B.; Chisholm, K.M.; Lynch, E.D.; Lee, M.K.; Walsh, T.; Opitz, J.M.; Li, W.; Klevit, R.E.; King, M.C. Mutations in mitochondrial histidyl tRNA synthetase HARS2 cause ovarian dysgenesis and sensorineural hearing loss of Perrault syndrome. Proc. Natl. Acad. Sci. USA 2011, 108, 6543–6548. [Google Scholar] [CrossRef]
- Pierce, S.B.; Gersak, K.; Michaelson-Cohen, R.; Walsh, T.; Lee, M.K.; Malach, D.; Klevit, R.E.; King, M.C.; Levy-Lahad, E. Mutations in LARS2, encoding mitochondrial leucyl-tRNA synthetase, lead to premature ovarian failure and hearing loss in Perrault syndrome. Am. J. Hum. Genet. 2013, 92, 614–620. [Google Scholar] [CrossRef]
- Morín, M.; Borreguero, L.; Booth, K.T.; Lachgar, M.; Huygen, P.; Villamar, M.; Mayo, F.; Barrio, L.C.; Santos Serrão de Castro, L.; Morales, C.; et al. Insights into the pathophysiology of DFNA10 hearing loss associated with novel EYA4 variants. Sci. Rep. 2020, 10, 6213. [Google Scholar] [CrossRef]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. ACMG Laboratory Quality Assurance Committee. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [PubMed]
- VarSome: The Human Genomic Variant Search Engine. Available online: https://varsome.com/ (accessed on 31 May 2024).
- Oza, A.M.; DiStefano, M.T.; Hemphill, S.E.; Cushman, B.J.; Grant, A.R.; Siegert, R.K.; Shen, J.; Chapin, A.; Boczek, N.J.; Schimmenti, L.A.; et al. ClinGen Hearing Loss Clinical Domain Working Group. Expert specification of the ACMG/AMP variant interpretation guidelines for genetic hearing loss. Hum. Mutat. 2018, 39, 1593–1613. [Google Scholar] [CrossRef] [PubMed]
- Lin, S.J.; Vona, B.; Barbalho, P.G.; Kaiyrzhanov, R.; Maroofian, R.; Petree, C.; Severino, M.; Stanley, V.; Varshney, P.; Bahena, P.; et al. Biallelic variants in KARS1 are associated with neurodevelopmental disorders and hearing loss recapitulated by the knockout zebrafish. Genet. Med. 2021, 23, 1933–1943. [Google Scholar] [CrossRef] [PubMed]
- Moulinier, L.; Ripp, R.; Castillo, G.; Poch, O.; Sissler, M. MiSynPat: An integrated knowledge base linking clinical, genetic, and structural data for disease-causing mutations in human mitochondrial aminoacyl-tRNA synthetases. Hum. Mutat. 2017, 38, 1316–1324. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.; Song, J.; Jiang, Y.; Zhao, C.; Lu, J.; Li, Y.; Wang, Y.; Gao, M.; Xi, J.; Luo, S.; et al. Loss-of-function mutations in Lysyl-tRNA synthetase cause various leukoencephalopathy phenotypes. Neurol. Genet. 2019, 5, e565. [Google Scholar] [CrossRef] [PubMed]
- Demain, L.A.M.; Gerkes, E.H.; Smith, R.J.H.; Molina-Ramirez, L.P.; O’Keefe, R.T.; Newman, W.G. A recurrent missense variant in HARS2 results in variable sensorineural hearing loss in three unrelated families. J. Hum. Genet. 2020, 65, 305–311. [Google Scholar] [CrossRef] [PubMed]
- Riley, L.G.; Rudinger-Thirion, J.; Frugier, M.; Wilson, M.; Luig, M.; Alahakoon, T.I.; Nixon, C.Y.; Kirk, E.P.; Roscioli, T.; Lunke, S.; et al. The expanding LARS2 phenotypic spectrum: HLASA, Perrault syndrome with leukodystrophy, and mitochondrial myopathy. Hum. Mutat. 2020, 41, 1425–1434. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Ignatov, M.; Musier-Forsyth, K.; Schimmel, P.; Yang, X.L. Crystal structure of tetrameric form of human lysyl-tRNA synthetase: Implications for multisynthetase complex formation. Proc. Natl. Acad. Sci. USA 2008, 105, 2331–2336. [Google Scholar] [CrossRef] [PubMed]
- McLaughlin, H.M.; Sakaguchi, R.; Liu, C.; Igarashi, T.; Pehlivan, D.; Chu, K.; Iyer, R.; Cruz, P.; Cherukuri, P.F.; Hansen, N.F.; et al. Compound Heterozygosity for Loss-of-Function Lysyl-tRNA Synthetase Mutations in a Patient with Peripheral Neuropathy. Am. J. Hum. Genet. 2010, 87, 560–566. [Google Scholar] [CrossRef]
- Scheidecker, S.; Bär, S.; Stoetzel, C.; Geoffroy, V.; Lannes, B.; Rinaldi, B.; Fischer, F.; Becker, H.D.; Pelletier, V.; Pagan, C.; et al. Mutations in KARS cause a severe neurological and neurosensory disease with optic neuropathy. Hum. Mutat. 2019, 40, 1826–1840. [Google Scholar] [CrossRef]
- Verrigni, D.; Diodato, D.; Di Nottia, M.; Torraco, A.; Bellacchio, E.; Rizza, T.; Tozzi, G.; Verardo, M.; Piemonte, F.; Tasca, G.; et al. Novel mutations in KARS cause hypertrophic cardiomyopathy and combined mitochondrial respiratory chain defect. Clin. Genet. 2017, 91, 918–923. [Google Scholar] [CrossRef] [PubMed]
- Ardissone, A.; Tonduti, D.; Legati, A.; Lamantea, E.; Barone, R.; Dorboz, I.; Boespflug-Tanguy, O.; Nebbia, G.; Maggioni, M.; Garavaglia, B.; et al. KARS-related diseases: Progressive leukoencephalopathy with brainstem and spinal cord calcifications as new phenotype and a review of literature. Orphanet J. Rare Dis. 2018, 13, 45. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Hei, Z.; Zheng, L.; Zhou, J.; Liu, Z.; Wang, J.; Fang, P. Structural analyses of a human lysyl-tRNA synthetase mutant associated with autosomal recessive nonsyndromic hearing impairment. Biochem. Biophys. Res. Commun. 2021, 554, 83–88. [Google Scholar] [CrossRef] [PubMed]
- Kuo, M.E.; Antonellis, A. Ubiquitously Expressed Proteins and Restricted Phenotypes: Exploring Cell-Specific Sensitivities to Impaired tRNA Charging. Trends Genet. 2020, 36, 105–117. [Google Scholar] [CrossRef] [PubMed]
- Faridi, R.; Rea, A.; Fenollar-Ferrer, C.; O’Keefe, R.T.; Gu, S.; Munir, Z.; Khan, A.A.; Riazuddin, S.; Hoa, M.; Naz, S.; et al. New insights into Perrault syndrome, a clinically and genetically heterogeneous disorder. Hum. Genet. 2022, 141, 805–819. [Google Scholar] [CrossRef] [PubMed]
- Kalotay, E.; Klugmann, M.; Housley, G.D.; Fröhlich, D. Recessive aminoacyl-tRNA synthetase disorders: Lessons learned from in vivo disease models. Front. Neurosci. 2023, 17, 1182874. [Google Scholar] [CrossRef] [PubMed]
- Souissi, A.; Ben Said, M.; Frikha, F.; Elloumi, I.; Masmoudi, S.; Megarbane, A. Expanding the Clinical and Molecular Spectrum of HARS2-Perrault Syndrome: Identification of a Novel Homozygous Missense Variant in the HARS2 gene. Genet. Test. Mol. Biomark. 2021, 25, 528–539. [Google Scholar] [CrossRef] [PubMed]
- Karstensen, H.G.; Rendtorff, N.D.; Hindbæk, L.S.; Colombo, R.; Stein, A.; Birkebæk, N.H.; Hartmann-Petersen, R.; Lindorff-Larsen, K.; Højland, A.T.; Petersen, M.B.; et al. Novel HARS2 missense variants identified in individuals with sensorineural hearing impairment and Perrault syndrome. Eur. J. Med. Genet. 2020, 63, 103733. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Jiang, W.; Cao, L.; Na, X.; Yang, J. Two novel likely pathogenic variants of HARS2 identified in a Chinese family with sensorineural hearing loss. Hereditas 2020, 157, 47. [Google Scholar] [CrossRef]
- Xu, P.; Wang, L.; Peng, H.; Liu, H.; Liu, H.; Yuan, Q.; Lin, Y.; Xu, J.; Pang, X.; Wu, H.; et al. Disruption of Hars2 in Cochlear Hair Cells Causes Progressive Mitochondrial Dysfunction and Hearing Loss in Mice. Front. Cell. Neurosci. 2021, 15, 804345. [Google Scholar] [CrossRef]
- Zerkaoui, M.; Demain, L.A.M.; Cherkaoui Jaouad, I.; Ratbi, I.; Amjoud, K.; Urquhart, J.E.; O’Sullivan, J.; Newman, W.G.; Sefiani, A. Marfanoid habitus is a nonspecific feature of Perrault syndrome. Clin. Dysmorphol. 2017, 26, 200–204. [Google Scholar] [CrossRef] [PubMed]
- Demain, L.A.M.; Urquhart, J.E.; O’Sullivan, J.; Williams, S.G.; Bhaskar, S.S.; Jenkinson, E.M.; Lourenco, C.M.; Heiberg, A.; Pearce, S.H.; Shalev, S.A.; et al. Expanding the genotypic spectrum of Perrault syndrome. Clin. Genet. 2017, 91, 302–312. [Google Scholar] [CrossRef] [PubMed]
- Carminho-Rodrigues, M.T.; Klee, P.; Laurent, S.; Guipponi, M.; Abramowicz, M.; Cao-van, H.; Guinand, N.; Paoloni-Giacobino, A. LARS2-Perrault syndrome: A new case report and literature review. BMC Med. Genet. 2020, 21, 109. [Google Scholar] [CrossRef] [PubMed]
- Pan, Z.; Xu, H.; Tian, Y.; Liu, D.; Liu, H.; Li, R.; Dou, Q.; Zuo, B.; Zhai, R.; Tang, W.; et al. Perrault syndrome: Clinical report and retrospective analysis. Mol. Genet. Genom. Med. 2020, 8, e1445. [Google Scholar] [CrossRef] [PubMed]
- Kosaki, R.; Horikawa, R.; Fujii, E.; Kosaki, K. Biallelic mutations in LARS2 can cause Perrault syndrome type 2 with neurologic symptoms. Am. J. Med. Genet. A 2018, 176, 404–408. [Google Scholar] [CrossRef]
- Van der Knaap, M.S.; Bugiani, M.; Mendes, M.I.; Riley, L.G.; Smith, D.E.C.; Rudinger-Thirion, J.; Frugier, M.; Breur, M.; Crawford, J.; Van Gaalen, J.; et al. Biallelic variants in LARS2 and KARS cause deafness and (ovario)leukodystrophy. Neurology 2019, 92, e1225–e1237. [Google Scholar] [CrossRef]
Gene | Exon(s) | Primer Sequences (5′-3′) | Annealing T (°C) |
---|---|---|---|
KARS1 | 6–7 | Upper: TCCTTCTTGGGCTCACATTAAC Lower: TGACACAGGATACGCTTTGG | 60 |
8 | Upper: TCATAGTGTCCTTTTTTGTC Lower: TCTCTCTGTTCCTCTTATTTC | 60 | |
9 | Upper: CAAGAGCAAAACTCCATCTCA Lower: CTGCCTGTAATATGCTTCACC | 60 | |
HARS2 | 5–6 | Upper: CCAGTCCTCCCTAATGTC Lower: AACAATGGCAGTACCTACTTT | 55 |
7 | Upper: GTCAGGAAAGTAGGTACTGCC Lower: AAATAGCCCACTTCCAGC | 55 | |
9–10 | Upper: CTAGAGCACATTAGGGATAA Lower: CAATTCCAAAAATCAAGA | 55 | |
11–12 | Upper: GTTTCTGGAGGTGTAGTTGGA Lower: ACAGGCAGCAATGGTCAT | 55 | |
LARS2 | 4 | Upper: TTGAATTTTGCTTTTTGACATT Lower: CAGCACAACACCCAACTC | 55 |
9 | Upper: TGGATCTTCTTTAGTGTCCC Lower: CCCAAGTTGCTGGTTTAC | 55 |
Gene 1 | Variant | SIFT Score | Polyphen-2 Score | CADD Score | REVEL Score | Minor Allele Frequency (MAF) | ACMG Criteria | Classification | |
---|---|---|---|---|---|---|---|---|---|
DNA | Protein | ||||||||
KARS1 | c.766C>T | p.Arg256Cys | 0 | 1.000 | 35 | 0.744 | 4 × 10−6 (global) 6 × 10−6 (European non-Finnish) | PM2 (moderate), PM3 (strong), PP1 (moderate) PP3 (supporting) | Likely pathogenic |
HARS2 | c.728A>C | p.Asp243Ala | 0.001 | 0.885 | 23.8 | 0.317 | 8 × 10−6 (global) 7 × 10−5 (Admixed American) | PM2 (moderate), PM3 (strong), PP1 (moderate) | Likely pathogenic |
HARS2 | c.1012G>A | p.Glu338Lys | 0.001 | 0.999 | 32 | 0.871 | 6 × 10−5 (global) 0 (Admixed American) | PM2 (moderate), PM3 (strong), PP1 (moderate) PP3 (moderate) | Pathogenic |
LARS2 | c.795A>G | p.Ile265Met | 0.001 | 0.987 | 20.4 | 0.556 | 8 × 10−6 (global) 3 × 10−6 (European non-Finnish) | PM2 (moderate), PM3 (strong), PP1 (moderate) | Likely pathogenic |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Domínguez-Ruiz, M.; Olarte, M.; Onecha, E.; García-Vaquero, I.; Gelvez, N.; López, G.; Villamar, M.; Morín, M.; Moreno-Pelayo, M.A.; Morales-Angulo, C.; et al. Novel Cases of Non-Syndromic Hearing Impairment Caused by Pathogenic Variants in Genes Encoding Mitochondrial Aminoacyl-tRNA Synthetases. Genes 2024, 15, 951. https://doi.org/10.3390/genes15070951
Domínguez-Ruiz M, Olarte M, Onecha E, García-Vaquero I, Gelvez N, López G, Villamar M, Morín M, Moreno-Pelayo MA, Morales-Angulo C, et al. Novel Cases of Non-Syndromic Hearing Impairment Caused by Pathogenic Variants in Genes Encoding Mitochondrial Aminoacyl-tRNA Synthetases. Genes. 2024; 15(7):951. https://doi.org/10.3390/genes15070951
Chicago/Turabian StyleDomínguez-Ruiz, María, Margarita Olarte, Esther Onecha, Irene García-Vaquero, Nancy Gelvez, Greizy López, Manuela Villamar, Matías Morín, Miguel A. Moreno-Pelayo, Carmelo Morales-Angulo, and et al. 2024. "Novel Cases of Non-Syndromic Hearing Impairment Caused by Pathogenic Variants in Genes Encoding Mitochondrial Aminoacyl-tRNA Synthetases" Genes 15, no. 7: 951. https://doi.org/10.3390/genes15070951
APA StyleDomínguez-Ruiz, M., Olarte, M., Onecha, E., García-Vaquero, I., Gelvez, N., López, G., Villamar, M., Morín, M., Moreno-Pelayo, M. A., Morales-Angulo, C., Polo, R., Tamayo, M. L., & del Castillo, I. (2024). Novel Cases of Non-Syndromic Hearing Impairment Caused by Pathogenic Variants in Genes Encoding Mitochondrial Aminoacyl-tRNA Synthetases. Genes, 15(7), 951. https://doi.org/10.3390/genes15070951