miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF
Abstract
1. Background
2. Materials and Methods
2.1. Animal and RNA Extraction
2.2. Target Prediction and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Analysis
2.3. Design and Synthesis of Quantitative Primers
2.4. PCR Amplification of Pre-miR-423-5p, Product Recovery, and Simple Connection of pMD-19T
2.5. Plasmid Extraction, Double Digestion, and Purification
2.6. Cell Culture and Transfection
2.7. Plasmid Extraction Was Identified
2.8. Construction of Luciferase Reporter Plasmid
2.9. Dual Luciferase Reporter Assay
2.10. Real-Time PCR
2.11. Enzyme-Linked Immunosorbent Assay (ELISA)
2.12. Statistical Analysis
3. Results
3.1. Spatiotemporal Expression and Correlation Analysis of miR-423-5p and SRF
3.2. Target Prediction of miR-423-5p and KEGG Pathway Analysis
3.3. Construction and Identification of the miR-423-5p Lentivirus Expression Vector
3.4. Identification of the Target Relationship between miR-423-5p and the SRF Gene
3.5. Functional Validation of miR-423-5p in C2C12 Cells
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Li, R.; Li, B.; Jiang, A.; Cao, Y.; Hou, L.; Zhang, Z.; Zhang, X.; Liu, H.; Kim, K.H.; Wu, W. Exploring the lncRNAs Related to Skeletal Muscle Fiber Types and Meat Quality Traits in Pigs. Genes 2020, 11, 883. [Google Scholar] [CrossRef]
- Rykova, E.; Ershov, N.; Damarov, I.; Merkulova, T. SNPs in 3′ UTR miRNA Target Sequences Associated with Individual Drug Susceptibility. Int. J. Mol. Sci. 2022, 23, 13725. [Google Scholar] [CrossRef] [PubMed]
- Los, B.; Borges, J.B.; Oliveira, V.F.; Freitas, R.C.; Dagli-Hernandez, C.; Bortolin, R.H.; Gonçalves, R.M.; Faludi, A.A.; Rodrigues, A.C.; Bastos, G.M.; et al. Functional analysis of PCSK9 3’UTR variants and mRNA-miRNA interactions in patients with familial hypercholesterolemia. Epigenomics 2021, 13, 779–791. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.; Lee, R.C.; Ambros, V. Structure and function analysis of LIN-14, a temporal regulator of postembryonic developmental events in Caenorhabditis elegans. Mol. Cell. Biol. 2000, 20, 2285–2295. [Google Scholar] [CrossRef]
- Ambros, V. MicroRNA pathways in flies and worms: Growth, death, fat, stress, and timing. Cell 2003, 113, 673–676. [Google Scholar] [CrossRef] [PubMed]
- Igoucheva, O.; Alexeev, V. MicroRNA-dependent regulation of cKit in cutaneous melanoma. Biochem. Biophys. Res. Commun. 2009, 379, 790–794. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Chen, J.X.; Fu, X.P.; Yang, S.; Zhang, Z.; Chen, K.H.; Li, Y. microRNA expression profiling of nasopharyngeal carcinoma. Oncol. Rep. 2011, 25, 1353–1363. [Google Scholar] [PubMed]
- Annese, T.; Tamma, R.; De Giorgis, M.; Ribatti, D. microRNAs Biogenesis, Functions and Role in Tumor Angiogenesis. Front. Oncol. 2020, 10, 581007. [Google Scholar] [CrossRef]
- Nam, J.W.; Rissland, O.S.; Koppstein, D.; Abreu-Goodger, C.; Jan, C.H.; Agarwal, V.; Yildirim, M.A.; Rodriguez, A.; Bartel, D.P. Global analyses of the effect of different cellular contexts on microRNA targeting. Mol. Cell 2014, 53, 1031–1043. [Google Scholar] [CrossRef]
- Chen, J.F.; Mandel, E.M.; Thomson, J.M.; Wu, Q.; Callis, T.E.; Hammond, S.M.; Conlon, F.L.; Wang, D.Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 2006, 38, 228–233. [Google Scholar] [CrossRef]
- Li, T.; Wan, Y.; Su, Z.; Li, J.; Han, M.; Zhou, C. SRF Potentiates Colon Cancer Metastasis and Progression in a microRNA-214/PTK6-Dependent Manner. Cancer Manag. Res. 2020, 12, 6477–6491. [Google Scholar] [CrossRef] [PubMed]
- Hirai, H.; Verma, M.; Watanabe, S.; Tastad, C.; Asakura, Y.; Asakura, A. MyoD regulates apoptosis of myoblasts through microRNA-mediated down-regulation of Pax3. J. Cell Biol. 2010, 191, 347–365. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Chen, X.; Huang, Z.; Chen, D.; Yu, B.; He, J.; Zheng, P.; Yu, J.; Luo, J.; Luo, Y.; et al. Effects of MicroRNA-27a on Myogenin Expression and Akt/FoxO1 Signal Pathway during Porcine Myoblast Differentiation. Anim. Biotechnol. 2018, 29, 183–189. [Google Scholar] [CrossRef]
- Liu, N.; Williams, A.H.; Kim, Y.; McAnally, J.; Bezprozvannaya, S.; Sutherland, L.B.; Richardson, J.A.; Bassel-Duby, R.; Olson, E.N. An intragenic MEF2-dependent enhancer directs muscle-specific expression of microRNAs 1 and 133. Proc. Natl. Acad. Sci. USA 2007, 104, 20844–20849. [Google Scholar] [CrossRef] [PubMed]
- Li, S.Z.; Zhang, Z.Y.; Chen, J.; Dong, M.Y.; Du, X.H.; Gao, J.; Shu, Q.P.; Li, C.; Liang, X.Y.; Ding, Z.H.; et al. NLK is required for Ras/ERK/SRF/ELK signaling to tune skeletal muscle development by phosphorylating SRF and antagonizing the SRF/MKL pathway. Cell Death Discov. 2022, 8, 4. [Google Scholar] [CrossRef] [PubMed]
- Deshpande, A.; Shetty, P.M.V.; Frey, N.; Rangrez, A.Y. SRF: A seriously responsible factor in cardiac development and disease. J. Biomed. Sci. 2022, 29, 38. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Zhang, H.; Pober, J.S.; Min, W.; Zhou, J.H. SRF SUMOylation modulates smooth muscle phenotypic switch and vascular remodeling. Res. Sq. 2023. [Google Scholar] [CrossRef] [PubMed]
- Croissant, J.D.; Kim, J.H.; Eichele, G.; Goering, L.; Lough, J.; Prywes, R.; Schwartz, R.J. Avian serum response factor expression restricted primarily to muscle cell lineages is required for alpha-actin gene transcription. Dev. Biol. 1996, 177, 250–264. [Google Scholar] [CrossRef] [PubMed]
- Holstein, I.; Singh, A.K.; Pohl, F.; Misiak, D.; Braun, J.; Leitner, L.; Hüttelmaier, S.; Posern, G. Post-transcriptional regulation of MRTF-A by miRNAs during myogenic differentiation of myoblasts. Nucleic Acids Res. 2020, 48, 8927–8942. [Google Scholar] [CrossRef]
- Ross, J.A.; Barrett, B.; Bensimon, V.; Shukla, G.; Weyman, C.M. Basal Signalling through Death Receptor 5 and Caspase 3 Activates p38 Kinase to Regulate Serum Response Factor (SRF)-Mediated MyoD Transcription. J. Mol. Signal. 2020, 14, 1. [Google Scholar] [CrossRef]
- Lin, X.; Yang, X.; Li, Q.; Ma, Y.; Cui, S.; He, D.; Lin, X.; Schwartz, R.J.; Chang, J. Protein tyrosine phosphatase-like A regulates myoblast proliferation and differentiation through MyoG and the cell cycling signaling pathway. Mol Cell Biol. 2012, 32, 297–308. [Google Scholar] [CrossRef]
- Xue, S.T.; Zheng, B.; Cao, S.Q.; Ding, J.C.; Hu, G.S.; Liu, W.; Chen, C. Long non-coding RNA LINC00680 functions as a ceRNA to promote esophageal squamous cell carcinoma progression through the miR-423-5p/PAK6 axis. Mol. Cancer 2022, 21, 69. [Google Scholar] [CrossRef]
- McDaneld, T.G.; Smith, T.P.; Doumit, M.E.; Miles, J.R.; Coutinho, L.L.; Sonstegard, T.S.; Matukumalli, L.K.; Nonneman, D.J.; Wiedmann, R.T. MicroRNA transcriptome profiles during swine skeletal muscle development. BMC Genom. 2009, 10, 77. [Google Scholar] [CrossRef]
- Zhang, J.; Liu, Y.L. MicroRNA in Skeletal Muscle: Its Crucial Roles in Signal Proteins, Mus cle Fiber Type, and Muscle Protein Synthesis. Curr. Protein Pept Sci. 2017, 18, 579–588. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, J.; Hu, H.; Wang, H.; Wang, C.; Lin, H.; Zhao, X. Dynamic transcriptome profiles of postnatal porcine skeletal muscle growth and development. BMC Genom. Data 2021, 22, 32. [Google Scholar] [CrossRef]
- Mucha, O.; Podkalicka, P.; Żukowska, M.; Pośpiech, E.; Dulak, J.; Łoboda, A. miR-378 influences muscle satellite cells and enhances adipogenic potential of fibro-adipogenic progenitors but does not affect muscle regeneration in the glycerol-induced injury model. Sci. Rep. 2023, 13, 13434. [Google Scholar] [CrossRef] [PubMed]
- Ge, J.; Zhu, J.; Xia, B.; Cao, H.; Peng, Y.; Li, X.; Yu, T.; Chu, G.; Yang, G.; Shi, X. miR-423-5p inhibits myoblast proliferation and differentiation by targeting Sufu. J. Cell. Biochem. 2018, 119, 7610–7620. [Google Scholar] [CrossRef] [PubMed]
- Cheng, X.; Li, L.; Shi, G.; Chen, L.; Fang, C.; Li, M.; Li, C. MEG3 Promotes Differentiation of Porcine Satellite Cells by Sponging miR-423-5p to Relieve Inhibiting Effect on SRF. Cells 2020, 9, 449. [Google Scholar] [CrossRef]
- Zhang, Y.; Yao, Y.; Wang, Z.; Lu, D.; Zhang, Y.; Adetula, A.A.; Liu, S.; Zhu, M.; Yang, Y.; Fan, X.; et al. MiR-743a-5p regulates differentiation of myoblast by targeting Mob1b in skeletal muscle development and regeneration. Genes Dis. 2020, 9, 1038–1048. [Google Scholar] [CrossRef]
- Fu, L.; Wang, H.; Liao, Y.; Zhou, P.; Xu, Y.; Zhao, Y.; Xie, S.; Zhao, S.; Li, X. miR-208b modulating skeletal muscle development and energy homoeostasis through targeting distinct targets. RNA Biol. 2020, 17, 743–754. [Google Scholar] [CrossRef]
- Xu, S.; Chang, Y.; Wu, G.; Zhang, W.; Man, C. Potential role of miR-155-5p in fat deposition and skeletal muscle development of chicken. Biosci Rep. 2020, 40, BSR20193796. [Google Scholar] [CrossRef] [PubMed]
- Dey, B.K.; Gagan, J.; Yan, Z.; Dutta, A. miR-26a is required for skeletal muscle differentiation and regeneration in mice. Genes Dev. 2012, 26, 2180–2191. [Google Scholar] [CrossRef] [PubMed]
- Randrianarison-Huetz, V.; Papaefthymiou, A.; Herledan, G.; Noviello, C.; Faradova, U.; Collard, L.; Pincini, A.; Schol, E.; Decaux, J.F.; Maire, P.; et al. Srf controls satellite cell fusion through the maintenance of actin architecture. J. Cell. Biol. 2018, 217, 685–700. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Gu, T.; Lu, L.; Cao, Z.; Song, Q.; Wang, Z.; Zhang, Y.; Chang, G.; Xu, Q.; Chen, G. Roles of miRNA-1 and miRNA-133 in the proliferation and differentiation of myoblasts in duck skeletal muscle. J. Cell. Physiol. 2019, 234, 3490–3499. [Google Scholar] [CrossRef] [PubMed]
- Horak, M.; Novak, J.; Bienertova-Vasku, J. Muscle-specific microRNAs in skeletal muscle development. Dev Biol. 2016, 410, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yang, L.Z.; Zhang, J.S.; Gong, J.X.; Wang, Y.H.; Zhang, C.L.; Chen, H.; Fang, X.T. Effects of microRNAs on skeletal muscle development. Gene 2018, 668, 107–113. [Google Scholar] [CrossRef] [PubMed]
- Vicente-García, C.; Hernández-Camacho, J.D.; Carvajal, J.J. Regulation of myogenic gene expression. Exp. Cell Res. 2022, 419, 113299. [Google Scholar] [CrossRef] [PubMed]
- Bentzinger, C.F.; Wang, Y.X.; Rudnicki, M.A. Building muscle: Molecular regulation of myogenesis. Cold Spring Harb. Perspect. Biol. 2012, 4, a008342. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Zhan, S.; Wang, Y.; Wang, L.; Zhong, T.; Li, L.; Fan, J.; Xiong, C.; Wang, Y.; Zhang, H. Role of microRNA-101a in the regulation of goat skeletal muscle satellite cell proliferation and differentiation. Gene 2015, 572, 198–204. [Google Scholar] [CrossRef]
- Wei, D.; Zhang, J.; Raza, S.H.A.; Song, Y.; Jiang, C.; Song, X.; Wu, H.; Alotaibi, M.A.; Albiheyri, R.; Al-Zahrani, M.; et al. Interaction of MyoD and MyoG with Myoz2 gene in bovine myoblast differentiation. Res. Vet. Sci. 2022, 152, 569–578. [Google Scholar] [CrossRef]






| Primers | Primer Sequences (5′→3′) | Application |
|---|---|---|
| 3′-SRF-F | CTCGAGCTCCGTGTTTGCCATGAGTA | 3′ UTR amplification |
| 3′-SRF-R | GCGGCCGCTTCCCTCCAACCCAGCAG | 3′ UTR amplification |
| 3′-SRF-DF | GGCAAAAGAGCCCGACCCCTGGGAGCCAGTTGGGGAAATG | 3′ UTR amplification |
| 3′-SRF-UR | CATTTCCCCAACTGGCTCCCAGGGGTCGGGCTCTTTTGCC | 3′ UTR amplification |
| Q-miR-423-5p-F | AGGGGCAGAGAGCGAGACTTT | RT-qPCR |
| MyoG-F | ACTCCCTTACGTCCATCGTG | |
| MyoG-R | CCAGGGTCTTCTTCATCCGTTC | |
| MyoD-F | GCCTTCTACGCACCTGGAC | |
| MyoD-R | ACTCTTCCCTGGCCTGGACT | |
| SnU6-F | CGCTTCGGCAGCACATATAC | |
| SnU6-R | TTCACGAATTTGCGTGTCAT | |
| Q-SRF-F | CAAGATGGAGTTCATCGACAACAAG | |
| Q-SRF-R | CAGTTTGCGGGTGGCAAAG | |
| β-actin-F | TCCCTGGAGAAGAGCTACGAG | |
| β-actin-R | GCCGTGATCTCCTTCTGCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pang, Y.; Liang, J.; Huang, J.; Lan, G.; Chen, F.; Ji, H.; Zhao, Y. miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF. Genes 2024, 15, 606. https://doi.org/10.3390/genes15050606
Pang Y, Liang J, Huang J, Lan G, Chen F, Ji H, Zhao Y. miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF. Genes. 2024; 15(5):606. https://doi.org/10.3390/genes15050606
Chicago/Turabian StylePang, Yanqin, Jing Liang, Jianfang Huang, Ganqiu Lan, Fumei Chen, Hui Ji, and Yunxiang Zhao. 2024. "miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF" Genes 15, no. 5: 606. https://doi.org/10.3390/genes15050606
APA StylePang, Y., Liang, J., Huang, J., Lan, G., Chen, F., Ji, H., & Zhao, Y. (2024). miR-423-5p Regulates Skeletal Muscle Growth and Development by Negatively Inhibiting Target Gene SRF. Genes, 15(5), 606. https://doi.org/10.3390/genes15050606

