Next Article in Journal
Research Progress on Genomic Regions and Candidate Genes Related to Milk Composition Traits of Dairy Goats Based on Functional Genomics: A Narrative Review
Previous Article in Journal
Genetic Variation, Polyploidy, Hybridization Influencing the Aroma Profiles of Rosaceae Family
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea

1
Biotechnology and Nuclear Technology Research Institute, Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
2
Sichuan Academy of Agricultural Sciences, Chengdu 610066, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Genes 2024, 15(10), 1340; https://doi.org/10.3390/genes15101340
Submission received: 16 September 2024 / Revised: 12 October 2024 / Accepted: 18 October 2024 / Published: 19 October 2024
(This article belongs to the Special Issue Sweet Potato Genetics and Genomics: 2nd Edition)

Abstract

Background: Sweet potato (Ipomoea batatas (L.) Lam.), a key global root crop, faces challenges due to its narrow genetic background. This issue can be addressed by utilizing the diverse genetic resources of sweet potato’s wild relatives, which are invaluable for its genetic improvement. Methods: The morphological differences in leaves, stems, and roots among 13 Ipomoea species were observed and compared. Chromosome numbers were determined by examining metaphase cells from root tips. Fluorescence in situ hybridization (FISH) was used to identify the number of 5S and 18S rDNA sites in these species. PCR amplification was performed for both 5S and 18S rDNA, and phylogenetic relationships among the species were analyzed based on the sequences of 18S rDNA. Results: Three species were found to have enlarged roots among the 13 Ipomoea species. Chromosome analysis revealed that I. batatas had 90 chromosomes, Ipomoea pes-tigridis had 28 chromosomes, while the remaining species possessed 30 chromosomes. Detection of rDNA sites in the 13 species showed two distinct 5S rDNA site patterns and six 18S rDNA site patterns in the 12 diploid species. These rDNA sites occurred in pairs, except for the seven 18S rDNA sites observed in Ipomoea digitata. PCR amplification of 5S rDNA identified four distinct patterns, while 18S rDNA showed only a single pattern across the species. Phylogenetic analysis divided the 13 species into two primary clades, with the closest relationships found between I. batatas and Ipomoea trifida, as well as between Ipomoea platensis and I. digitata. Conclusions: These results enhance our understanding of the diversity among Ipomoea species and provide valuable insights for breeders using these species to generate improved varieties.

1. Introduction

Sweet potato (Ipomoea batatas (L.) Lam.), which is one of the most important root crops, is cultivated worldwide because of its high starch content and abundance of vitamins and other nutrients. It is grown as a source of food, feed, fuel, and starch [1]. Sweet potato varieties that are resistant to diseases and pests and have high yields and nutritional value are crucial for satisfying the growing demand for high-quality food and industrial raw materials [2]. However, the narrow genetic background of sweet potato results in low genetic diversity, thereby hindering varietal improvement [3]. Thus, wild relatives of sweet potato are important genetic resources for enhancing sweet potato cultivars [1]. Accordingly, clarifying the relationships between sweet potato and its wild relatives is important for optimizing the genetic improvement of sweet potato through breeding.
Ribosomal DNA (rDNA) is a highly conserved genomic segment in eukaryotes that is widely used for chromosomal localization and phylogenetic analyses. It consists of 45S and 5S rDNA, with 45S rDNA comprising repeating units of 18S, 5.8S, and 26S rDNA, as well as tandem arrays of transcribed and non-transcribed spacer regions [4]. The number and distribution of rDNA have been analyzed in many species [5]. In the genus Ipomoea, 5S and 18S rDNA have been used to provide evidence of the origin of sweet potato [6]. Additionally, 5S rDNA has been used to analyze the karyotypes of I. batatas and its wild relatives [7].
Over the past decade, oligonucleotide fluorescence in situ hybridization (oligo-FISH) has become an important technique for analyzing chromosomes [8]. In terms of its utility for cell biology and genetics research, oligo-FISH can accurately locate DNA sequences on chromosomes and chromatin [9], but it is also widely used to identify chromosomes [10] and analyze karyotypes [11] as well as phylogenetic relationships [12,13] among plants and microbes. Furthermore, using rDNA oligonucleotide probes to visualize rDNA chromosomal sites can clarify the variability in 5S and 18S rDNA.
Plastome sequences, ITS (internal transcribed spacer), and rDNA sequences have often been used as reliable molecular evidence of phylogenetic relationships. For example, Chen et al. elucidated the phylogenetic relationships of 40 species from the family Convolvulaceae using complete plastome sequences [14]. The analysis of ITS sequences in I. batatas and its wild relatives by Chen et al. and Xu et al. clarified the genetic relationships among these species [15,16]. 18S rDNA sequences and 5S rDNA molecular markers have commonly been employed in phylogenetic analyses [17]. However, there are relatively few reports describing phylogenetic relationships among Ipomoea species determined on the basis of 18S rDNA sequences and 5S rDNA molecular markers.
In this study, we examined 13 species from the genus Ipomoea in terms of their morphological characteristics, number and distribution of 18S and 5S rDNA sites, and polymorphisms among 18S rDNA sequences and 5S rDNA molecular markers. This study’s results will be useful for exploiting these species for the genetic improvement of sweet potato.

2. Materials and Methods

2.1. Plant Materials

The seeds of 12 Ipomoea species, including Ipomoea muelleri, Ipomoea murucoides, Ipomoea trifida, Ipomoea triloba, Ipomoea nil, Ipomoea setosa, Ipomoea platensis, Ipomoea quamoclit, Ipomoea obscura, Ipomoea pes-tigridis, Ipomoea pes-caprae, and Ipomoea digitata, and seedlings of I. batatas were used in this study. All germplasms were supplied by the Biotechnology and Nuclear Technology Research Institute of Sichuan Academy of Agricultural Sciences, China. The sweet potato cultivar Xushu 18 was bred by the Xuzhou Institute of Agricultural Sciences, China. All the seeds were placed in a moist box. After germination, three well-sprouted seeds from each species were selected and transferred into pots filled with soil. The pots were placed in a greenhouse in Chengdu, China. The greenhouse was maintained at 28 °C with 70% relative humidity. Plants were exposed to light from 8:00 a.m. to 10:00 p.m. The examination of phenotypic traits for all species was based on Descriptors for Sweet Potato [18].

2.2. Chromosome Preparation

Two months after planting, root tips were collected and treated using a published method [19]. Briefly, all root tips were exposed to nitrous oxide for 2 h to inhibit spindle formation, thereby allowing for the observation of more metaphase cells. Then, they were placed in 90% acetic acid for 10 min to fix the cells and stored in 70% ethanol solution. After being thoroughly washed using ddH2O, the root tips were placed in a solution comprising 1% pectinase and 2% cellulase (Yakult Pharmaceutical Industry Co., Ltd., Tokyo, Japan) and incubated in a 37 °C water bath for 1 h to digest the cell walls. Following this, the root tips were washed using 70% ethanol and squashed in acetic acid. Finally, 10 μL of the solution was dropped onto each slide and air-dried in a moist box for at least 5 min.

2.3. Fluorescence In Situ Hybridization

18S rDNA probe multiplexes were developed and 5S rDNA probes were synthesized as described by Yu et al. [20]. The sequences of the 18S rDNA probe multiplexes and 5S rDNA probes are listed in Table 1.
A droplet of a solution comprising both 18S and 5S rDNA probes was placed on individual slides, which were then covered for 1 h hybridization at 42 °C. After removing the cover glass using 2× SSC (saline–sodium citrate), the samples were air-dried and stained with 4′,6-diamidino-2-phenylindole. FISH images were captured using a Leica DM2500 microscope (Leica Microsystems, Wetzlar, Germany). The resulting photos were processed using Adobe Photoshop 2020 (Adobe Systems Software Ltd., Dublin, Ireland). At least 10 metaphase plates were examined for each species.

2.4. DNA Extraction and PCR Amplification of 5S and 18S rDNA

DNA was extracted according to the CTAB method [21]. The primers used for the PCR amplification of 18S rDNA were 18S-forward (5′-CAACCTGGTTGATCCTGCCAGT-3′) and 18S-reverse (5′-CTGATCCTTCTGCAGGTTCACCTAC-3′) [22], whereas 5S-forward (5′-GGATCCCATCAGAACTCC-3′) and 5S-reverse (5′-GGTGCTTTAGTGCTGGTAT-3′) were the primers used for the PCR amplification of 5S rDNA [23]. Both PCR amplifications were performed in 20 µL reaction mixtures containing 10 μL 2× Taq PCR Master Mix (Bio Basic Inc., New York, NY, USA), 2 µL DNA template, 0.2 μL forward and reverse primers (10 μM), and 7.6 μL ddH2O. The PCR cycling conditions were as follows: initial denaturation at 94 °C for 5 min; 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 58 °C for 30 s, and primer extension at 72 °C for 2 min and 20 s; and a final extension at 72 °C for 7 min. Amplified products were visualized via 1.5% (w/v) agarose gel electrophoresis.

2.5. 18S rDNA Sequence Analysis

Amplified fragments were purified from the agarose gel using Universal DNA Purification Kit (Tiangen, Beijing, China). Then, the purification products were sequenced using Sanger sequencing method by Tsingke Biotechnology Co., Ltd. (Beijing, China). DNA sequences were aligned using the MUSCLE algorithm, which was widely used in sequences analysis for its high accuracy and reliability. A phylogenetic tree was constructed according to the neighbor-joining method with 1000 bootstrap replicates using MEGA 11. tvBOT (https://www.chiplot.online/circleTree.html, accessed on 31 August 2023) [24], a tool to customize the layout and font style, was employed to visualize the phylogenetic tree. Genetic distances were calculated on the basis of the Kimura 2-parameter model.

3. Results

3.1. Phenotypic Analysis of 13 Ipomoea Species

The root, stem, and leaf phenotypes of 13 Ipomoea species were analyzed (Figure 1, Figures S1 and S2).
The leaves of all species varied in terms of shape, size, and color. Notably, leaves with downy hair were detected exclusively on I. nil and I. pes-tigridis plants. Pinnately lobed leaves were detected only on I. quamoclit plants. I. nil, I. pes-tigridis and I. setosa all had palmately lobed leaves. However, I. nil and I. setosa had moderate lobed leaves, while I. pes-tigridis had deep lobed leaves. Interestingly, I. platensis and I. digitata had both very deep lobed and very slight lobed leaves. Although all species had green leaves, they differed in leaf vein and petiole colors. Specifically, the leaf veins of I. trifida, I. setosa, I. pes-caprae, and I. batatas exhibited anthocyanin pigmentation. Additionally, the petioles of these four species, along with I. triloba, I. nil, and I. obscura, also showed anthocyanin pigmentation.
The stems differed in terms of shape and thickness. I. murucoides had erect stems, but all other species had twining stems. Furthermore, downy hair was detected on the stems of I. nil, I. setosa, and I. pes-tigridis. In addition to being the only species with an erect stem, I. murucoides also had the thickest stem (approximately 14 mm in diameter). I. muelleri and I. obscura had the thinnest stems (approximately 1 mm in diameter). For all other species, stem thickness ranged from 2.5 to 5 mm.
There were significant root morphological differences. The roots of three species clearly expanded, whereas the roots of the other ten species did not. Both I. platensis and I. digitata had only one long irregular storage root, while I. batatas produced multiple long elliptic storage roots. Moreover, the storage roots of I. platensis and I. digitata were both developed from the swelling of the primary root. In contrast, the storage roots of I. batatas were developed from multiple lateral roots. Among the examined species, only I. batatas had red skin on its storage roots.

3.2. Number and Length of Chromosomes

With the exception of I. batatas, which was revealed to be a hexaploid with 90 chromosomes, the remaining species were diploids with 30 chromosomes, except for I. pes-tigridis, which had 28 chromosomes (Table 2, Figure 2).
A comparison of chromosome lengths (Table 3) indicated I. batatas had the shortest chromosomes (average length of 0.52 μm; the longest chromosome was 2.795 times longer than the shortest chromosome). I. digitata had the longest chromosomes (average length of 1.07 μm). The smallest difference in chromosome length was detected in I. platensis (the longest chromosome was only 1.444 times longer than the shortest chromosome).

3.3. 5S rDNA FISH Signal Sites and Amplified Fragment Polymorphisms

In the metaphase chromosomes of the 13 Ipomoea species, 5S rDNA signals were detected in pairs (Figure 3).
There were six and four 5S rDNA signals in I. batatas and I. digitata, respectively, which was more than the two 5S rDNA signals in the other species. The different signal pairs in I. batatas and I. digitata differed in terms of intensity. One pair of signals in I. digitata was significantly weaker than the other signal pairs. In I. batatas, one pair of signals was obviously stronger than the other signal pairs. However, any two signals on homologous chromosomes had essentially the same intensity.
5S rDNA molecular markers were used to detect polymorphisms in 13 Ipomoea species (Figure 4).
There were four patterns of 5S rDNA amplification products. The first pattern, which included two major amplification products (detected as approximately 220 and 450 bp bands), was obtained for I. murucoides, I. nil, I. setosa, and I. obscura. The second pattern, which consisted of two major bands at approximately 270 and 520 bp, was detected for I. trifida, I. triloba, I. pes-caprae, and I. batatas. The third pattern, which was obtained for I. muelleri, I. platensis, and I. digitata, comprised two major bands (approximately 230 and 290 bp). The final amplification pattern consisted of only one major band (approximately 300 bp) and was detected for I. quamoclit and I. pes-tigridis.

3.4. 18S rDNA Sites and Sequence Polymorphisms

The number of 18S rDNA signals among the 13 selected species could be divided into seven patterns. All 18S rDNA signals were detected as pairs, except in I. digitata, which had seven 18S rDNA signals. The only hexaploid species (I. batatas) had 16 18S rDNA signals. In the diploid species, four signals were detected in I. murucoides, I. setosa, I. obscura, and I. pes-caprae; six signals were detected in I. muelleri, I. trifida, and I. pes-tigridis; and eight signals were detected in I. triloba and I. platensis. In I. digitata, I. quamoclit, and I. nil, 7, 12, and 14 18S rDNA signals were detected, respectively (Table 2, Figure 5).
All of the 18S rDNA FISH signals in I. setosa, I. triloba, and I. trifida had almost the same intensity, whereas there were obvious differences in the signal intensities in the other 10 species. In addition, the PCR amplification of 18S rDNA generated only one product (approximately 1700 bp) in all 13 species (Figure S3).

3.5. Polymorphisms in 18S rDNA Sequences

To further analyze 18S rDNA polymorphisms, we sequenced the amplification products for all 13 species. According to the results, the 18S rDNA sequence lengths for the 13 species ranged from 1682 bp (I. murucoides and I. pes-caprae) to 1722 bp (I. quamoclit). When all 18S rDNA sequences were included, the average length was 1688 bp. Further aligning and splicing of the 18S rDNA sequences (1908 bp) revealed 652 variable sites and 636 parsimony-informative sites, accounting for 34.2% and 33.3% of the sequences, respectively. There were also 16 singleton sites, accounting for 0.8% of the sequences. Moreover, there was relatively little difference in the GC content among species, with an average of 50.7%.
On the basis of the 18S rDNA sequences in the 13 species, a neighbor-joining phylogenetic tree was constructed (1000 bootstrap replicates) using MEGA 11. The 13 species were divided into two main clades (Figure 6).
Clade I consisted of I. trifida, I. batatas, I. platensis, I. digitata, I. setosa, I. obscura, and I. nil, among which I. trifida and I. batatas, as well as I. platensis and I. digitata, were clustered together. Clade II included I. muelleri, I. triloba, I. murucoides, I. quamoclit, I. pes-tigridis, and I. pes-caprae, of which I. pes-tigridis and I. pes-caprae were clustered together.
The 18S rDNA sequences and MEGA 11 were used to calculate genetic distances (Table 4).
The genetic distance between any two species in clade I ranged from 0.000 to 0.003. Notably, the genetic distance between I. batatas and I. trifida, as well as between I. platensis and I. digitata, was 0.000. A comparison of the 18S rDNA sequences in I. batatas and I. trifida detected only three differences. Additionally, the 18S rDNA sequences of I. platensis and I. digitata were identical. In clade II, the genetic distance between any two species ranged from 0.001 to 0.006. Moreover, the genetic distance between any two species from different main clades ranged from 0.657 to 0.663.

4. Discussion

To date, the limited genetic diversity of sweet potato has limited varietal improvement [1,3]. Hence, the introduction of more germplasm resources with substantial genetic diversity is essential for sweet potato breeding. In addition to being genetically diverse, the wild relatives of sweet potato possess desirable characteristics (e.g., disease resistance and high starch content) [25], making them potentially useful for broadening the genetic background of sweet potato [26]. However, there are few reports describing the utility of these wild relatives, except for I. trifida, for sweet potato breeding. In this study, we compared the phenotypes of 13 Ipomoea species, which revealed considerable differences in the leaves, stems, and roots. For example, I. murucoides had a thick and erect stem. Notably, besides sweet potato (I. batatas), I. platensis and I. digitata had expanded roots. These results are relevant to future studies and the application of these germplasm.
Root expansion, which is a key trait of sweet potato, is affected and regulated by many factors [27], including environmental conditions [28], endogenous hormones [29], transcription factors, and genes [30,31,32]. In particular, genes related to the synthesis and metabolism of hormones, lignin, and starch play an important role [33,34]. In recent years, the hypothesis that the formation of sweet potato storage roots may be triggered by Agrobacterium rhizogenes derived from species related to sweet potato via hybridization or infection has been proposed [35,36]. Because of the polyploidy and high heterozygosity of sweet potato, the key genes and molecular mechanisms regulating root expansion have not been fully characterized. The two diploid (2n = 30) Ipomoea species with expanded roots in this study may be useful materials for research on sweet potato root expansion.
Considering the basic chromosome number for the genus Ipomoea (n = 15), diploid species should contain 2n = 30 chromosomes. Earlier research indicated that I. trifida, I. triloba, I. setosa, I. nil, I. pes-caprae, and I. obscura have 30 chromosomes [6,37,38,39], which is consistent with our findings. Previous studies on I. pes-tigridis revealed the following number of chromosomes: 2n = 2x = 26, 2n = 2x = 30, and 2n = 4x = 60 [40,41,42]. However, the number of chromosomes reported by Sampathkumar et al. (2n = 2x = 28) was in accordance with our results [39]. Similar studies have also found chromosomal aneuploidy in many Ipomoea species [13,43,44]. A few studies suggest that chromosomal aneuploidy affects transcript dosage, ultimately leading to phenotypic variations [45]. The effects of the number of chromosomal mutations remain unknown. The variations in the number of I. pes-tigridis chromosomes will need to be investigated further.
rDNA, which is highly repetitive and conserved across various species, has been commonly used as a reliable and stable marker for cytological studies. Analyses of the number and distribution of rDNA sites using FISH probes can help elucidate chromosomal behavior. In the present study, we analyzed 18S/5S rDNA distribution patterns in 13 Ipomoea species and found that the number of 18S and 5S rDNA sites in I. trifida, I. nil, and I. setosa was consistent with the results of earlier studies [6,46].
Except for I. digitata, which had four 5S rDNA sites, all diploid species possessed two 5S rDNA sites, representing exactly one-third of the number of 5S rDNA sites found in hexaploid species. In contrast, there were seven patterns for the number of 18S rDNA signals. Eight and sixteen signals were detected for I. triloba and I. batatas, respectively. However, Srisuwan et al. reported that I. triloba has 6 18S rDNA sites, while sweet potato (I. batatas) from various regions differs regarding the number of 18S rDNA sites (e.g., 12, 16, and 18) [6]. The intraspecific variation in the number of 18S rDNA sites, which is common among plants [47,48,49,50], is related to unequal crossing over and transposition events, chromosomal structure fracture and rearrangement, and polyploidization-related process changes to varying degrees [13]. Interestingly, the number of 5S rDNA sites is relatively stable in I. batatas. In this study, as well as in some earlier studies [6,13,23], six 5S rDNA sites were detected, with a few exceptions. Moreover, seven 18S rDNA sites (i.e., not paired) were detected in I. digitata. The loss of rDNA sites has been reported for Citrullus species [51] and sweet potato [13]. This loss is caused by chromosomal deletion, duplication, and unequal exchange [52]. Furthermore, different signal sizes and intensities for 18S and 5S rDNA sites were observed in this study, which is consistent with the findings of other studies [53,54,55]. This diversity is mainly related to differences in the copy number among rDNA sites [13].
In eukaryotes, rDNA sequences are highly conserved. Many studies that amplified rDNA sequences revealed patterns that were similar to those in the current study, in which only one 18S rDNA sequence [22,56] and multiple 5S rDNA sequences [57,58,59] were amplified. These results confirmed that 18S rDNA is more conserved than 5S rDNA. 5S rDNA multigene family members consist of a highly conserved coding sequence (120 bp) and a variable non-transcribed spacer (NTS), forming hundreds to thousands of tandem repeats [60]. The different 5S rDNA amplification patterns are probably due to how freely NTS can mutate [61]. Using the same primers as us, Choi et al. amplified two 5S rDNA sequences in three different sweet potato cultivars (250 and 340 bp) [23].
The origin of sweet potato remains unclear [62], necessitating further research regarding the phylogenetic relationships among its wild relatives. Of the Ipomoea species we selected, I. batatas, I. trifida, and I. triloba had similar 5S rDNA amplification patterns. In addition, the genetic distance between I. trifida and I. batatas was 0.00 according to the 18S rDNA sequences, which was almost consistent with the findings of a previous related study that examined ITS sequences (0.01) [16]. However, I. triloba and I. batatas were clearly separated in the phylogenetic tree, with a genetic distance of 0.658. According to previous investigations, I. trifida [6,62,63] and I. triloba [16,64] are both the progenitors of cultivated sweet potato, but our results indicate that I. trifida is more likely to be the progenitor of cultivated sweet potato than I. triloba.
In our phylogenetic tree, species located on different main clades showed significant genetic distances. However, species within the same clade exhibit extremely close genetic distances. These results demonstrated that the phylogenetic tree construct by 18S rDNA could be used to effectively distinguish species within the Ipomoea genus based on sequences accumulated variations during evolution. Interestingly, the three species that produced enlarged roots were all on clade I, while only the species on clade II displayed the fourth amplification pattern of 5S rDNA. However, the number of 18S rDNA sites and the amplification pattern of 5S rDNA on the two main clades both have multiple patterns, indicating that the polymorphism of rDNA site number and amplification results should be related to genome complexity or polyploidy but not to the variation of the sequence itself. Moreover, I. platensis and I. digitata were closely related to sweet potato, sharing identical 18S rDNA sequences and similar morphological features (e.g., expanded roots). These characteristics further reflect the importance of these species for future theoretical research and genetic improvement of sweet potato.
Considering the size of the genus Ipomoea, our study involved relatively few species. Nevertheless, we detected significant variability in the morphology, number of chromosomes, location of 5S/18S rDNA sites, and 18S rDNA sequences among the selected species. These findings have deepened our understanding of the genus Ipomoea and serve as useful information for future investigations. To explore and exploit more wild relatives of sweet potato, additional research involving more species is needed.

5. Conclusions

In this study, we clarified the phenotypic diversity among thirteen Ipomoea species, with three species, including sweet potato, found to produce expanded roots. Except for sweet potato, which was a hexaploid, all other species were diploid. Furthermore, the number of 18S rDNA sites showed more polymorphisms than that of 5S rDNA. All sites were paired, except for the 18S rDNA sites in I. digitata. The amplification patterns of 5S rDNA were found to be more variable, while those of 18S rDNA were more conserved. Thirteen Ipomoea species were divided into two main clades based on the analysis of 18S rDNA sequences, and greater genetic distances were observed between the clades. Three species with enlarged roots were all on clade I, and the closest relationships were found between sweet potato and I. trifida. These results provide comprehensive information regarding the morphological, molecular, and cytological characteristics of 13 Ipomoea species. This information should provide breeders with helpful clues regarding how to optimize the use of these germplasms in breeding programs.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/genes15101340/s1, Figure S1: Comparison of stem morphology among 13 species of the genus Ipomoea. Figure S2: Comparison of leaf morphology among 13 species of the genus Ipomoea. Figure S3: Electrophoresis results of 18S rDNA amplification products in 13 species of the genus Ipomoea.

Author Contributions

Conceptualization, J.F.; Data curation, C.Z.; Formal analysis, T.L. and C.Z.; Investigation, J.W.; Methodology, T.L., Z.P. and F.Y. (Fan Yang); Software, T.L.; Validation, J.W. and F.Y. (Feiyang Yang); Writing—original draft, J.W., T.L. and F.Y. (Feiyang Yang); Writing—review and editing, H.Q., Z.P. and J.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Financial Self-directed Innovation Project of Sichuan Province (2022YXLW003, 2022ZZCX041); Strategic Scientist Studio of Sichuan Academy of Agricultural Sciences, the Accurate Identification Project of Crop Germplasm from Sichuan Provincial Finance Department, 1 + 3ZYGG001; the 1 + 9 open competition project of Sichuan Academy of Agricultural Sciences to select the best candidates (1 + 9KJGG001); and the Sichuan Science and Technology Program (2021YFY0027).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article and Supplementary Material, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Khoury, C.K.; Heider, B.; Castañeda-Álvarez, N.P.; Achicanoy, H.A.; Sosa, C.C.; Miller, R.E.; Scotland, R.W.; Wood, J.R.I.; Rossel, G.; Eserman, L.A.; et al. Distributions, ex situ conservation priorities, and genetic resource potential of crop wild relatives of sweetpotato [Ipomoea batatas (L.) Lam., I. series Batatas]. Front. Plant Sci. 2015, 6, 251. [Google Scholar] [CrossRef] [PubMed]
  2. Yan, M.X.; Nie, H.Z.; Wang, Y.Z.; Wang, X.Y.; Jarret, R.; Zhao, J.M.; Wang, H.X.; Yang, J. Exploring and exploiting genetics and genomics for sweetpotato improvement: Status and perspectives. Plant Commun. 2022, 3, 100332. [Google Scholar] [CrossRef]
  3. Liu, D.G.; Zhao, N.; Zhai, H.; Yu, X.X.; Jie, Q.; Wang, L.J.; He, S.Z.; Liu, Q.C. AFLP Fingerprinting and Genetic Diversity of Main Sweetpotato Varieties in China. J. Integr. Agric. 2012, 11, 1424–1433. [Google Scholar] [CrossRef]
  4. Heslop-Harrison, J.S. Comparative Genome Organization in Plants: From Sequence and Markers to Chromatin and Chromosomes. Plant Cell 2000, 12, 617–635. [Google Scholar] [CrossRef] [PubMed]
  5. Niu, K.; Chen, C.B.; Liu, H.J.; Gu, Y.; Wang, C.G.; Sun, D.L.; Song, W.Q. Localization of rDNA Sequences in a Variety of Vegetable & Fruit Plants on Chromosome. Acta Sci. Nat. Univ. Nankaiensis 2017, 50, 67–75. [Google Scholar]
  6. Srisuwan, S.; Sihachakr, D.; Siljak-Yakovlev, S. The origin and evolution of sweet potato (Ipomoea batatas Lam.) and its wild relatives through the cytogenetic approaches. Plant Sci. 2006, 171, 424–433. [Google Scholar] [CrossRef] [PubMed]
  7. An, T.T.; Tang, J.L.; Sun, J.Y.; Cao, Q.H.; Ma, D.F.; Li, Z.Y. rDNA-FISH Analysis and DAPI-kayotype of Ipomoea batatas cv. and Ipomoea hederacea Jacq. Acta Bot. Boreali-Occident. Sin. 2012, 32, 682–687. [Google Scholar]
  8. He, J.; Lin, S.S.; Yu, Z.Y.; Song, A.P.; Guan, Z.Y.; Fang, W.M.; Chen, S.M.; Zhang, F.; Jiang, J.F.; Chen, F.D.; et al. Identification of 5S and 45S rDNA sites in Chrysanthemum species by using oligonucleotide fluorescence in situ hybridization (Oligo-FISH). Mol. Biol. Rep. 2021, 48, 21–31. [Google Scholar] [CrossRef]
  9. Liu, Y.L.; Liu, L.J.; Peng, R.H. Development of FISH and Its Application in Plant Genome Research. Mol. Plant Breed. 2018, 16, 5696–5703. [Google Scholar]
  10. Wang, L.J.; Sheng, M.Y.; Ren, X.L. Chromosomal Localization of 5S and 18S rDNA in Eight Nicotiana Species and the Implications for Genome Evolution of Genus Nicotiana. Cytologia 2021, 86, 149–154. [Google Scholar] [CrossRef]
  11. Xin, H.Y.; Zhang, T.; Wu, Y.F.; Zhang, W.L.; Zhang, P.D.; Xi, M.L.; Jiang, J.M. An extraordinarily stable karyotype of the woody Populus species revealed by chromosome painting. Plant J. 2019, 101, 253–264. [Google Scholar] [CrossRef] [PubMed]
  12. Zhou, Y.P.; Wang, Z.X.; Du, Y.P.; Li, J.W.; He, H.B.; Jia, G.X. Fluorescence in situ hybridization of 35S rDNA sites and karyotype of wild Lilium (Liliaceae) species from China: Taxonomic and phylogenetic implications. Genet. Resour. Crop Evol. 2020, 67, 10011–11017. [Google Scholar] [CrossRef]
  13. Su, D.; Chen, L.; Sun, J.Y.; Zhang, L.Y.; Gao, R.F.; Li, Q.; Han, Y.H.; Li, Z.Y. Comparative Chromosomal Localization of 45S and 5S rDNA Sites in 76 Purple-Fleshed Sweet Potato Cultivars. Plants 2020, 9, 865–876. [Google Scholar] [CrossRef]
  14. Chen, L.Q.; Zhang, Z.R.; Yang, J.B.; Li, D.Z.; Yu, W.B. Plastid phylogenomic insights into the phylogeny of Convolvulaceae. Guihaia 2021, 42, 1740–1749. [Google Scholar]
  15. Liu, Z.; Zhang, H.Y. ITS Sequence Analysis of Convolvulaceae Plants. J. West China For. Sci. 2012, 41, 70–74. [Google Scholar]
  16. Yu, L.X.; Liu, M.Y.; Cao, Q.H.; Yu, Y.C.; Xie, Y.P.; Luo, Y.H.; Han, Y.H.; Li, Z.Y. Analysis of nrDNA ITS Sequences in Ipomoea batatas and its Relative Wild Species. Plant Sci. J. 2014, 32, 40–49. [Google Scholar]
  17. Chelomina, G.N.; Rozhkovan, K.V.; Voronova, A.N.; Burundukova, O.L.; Muzarok, T.I.; Zhuravlev, Y.N. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer). J. Ginseng Res. 2016, 40, 176–184. [Google Scholar] [CrossRef]
  18. Huamén, Z. Descriptors for Sweet Potato; International Board for Plant Genetic Resources: Rome, Italy, 1991. [Google Scholar]
  19. Zhang, J.; Jiang, Y.; Wang, Y.; Guo, Y.L.; Long, H.; Deng, G.B.; Chen, Q.; Xuan, P. Molecular markers and cytogenetics to characterize a wheat-Dasypyrum villosum 3V (3D) substitution line conferring resistance to stripe rust. PLoS ONE 2018, 13, e0202033. [Google Scholar] [CrossRef] [PubMed]
  20. Yu, Z.H.; Wang, H.J.; Xu, Y.F.; Li, Y.S.; Lang, T.; Yang, Z.J.; Li, G.R. Characterization of Chromosomal Rearrangement in New Wheat—Thinopyrum intermedium Addition Lines Carrying Thinopyrum—Specific Grain Hardness Genes. Agronomy 2019, 9, 18. [Google Scholar] [CrossRef]
  21. Zheng, L.Y.; Jia, D.H.; Fei, X.F.; Luo, X.; Yang, Z.R. An assessment of the genetic diversity within Ganoderma strains with AFLP and ITS PCR-RFLP. Microbiol. Res. 2009, 164, 312–321. [Google Scholar] [CrossRef]
  22. Jiang, F.Y.; Huang, H.; Yang, N.; Ma, J. Cloning and Sequence Analysis of 18s rRNA Genes of Several Large Green Algae in Hainan Province. Chin. J. Trop. Agric. 2017, 37, 49–54. [Google Scholar]
  23. Choi, E.Y.; Seo, J.H.; Seo, B.B. Sequence Polymorphism and Chromosomal Localization of 5S rDNA of Three Cultivated Varieties of Sweetpotato (Ipomoea batatas (L.) Lam.). Genes Genom. 2009, 31, 325–332. [Google Scholar] [CrossRef]
  24. Xie, J.M.; Chen, Y.R.; Cai, G.J.; Cai, R.L.; Hu, Z.; Wang, H. Tree Visualization by One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef] [PubMed]
  25. Acosta-Gallegos, J.A.; Kelly, J.D.; Gepts, P. Prebreeding in Common Bean and Use of Genetic Diversity from Wild Germplasm. Crop Science 2007, 47, S44–S59. [Google Scholar] [CrossRef]
  26. Feuillet, C.; Langridge, P.; Waugh, R. Cereal breeding takes a walk on the wild side. Trends Genet. 2008, 24, 24–32. [Google Scholar] [CrossRef]
  27. Song, W.H.; Hou, M.; Zhang, Y.G.; Li, Q. Research Advance on Mechanism of Expansion in Sweetpotato Storage Roots. Mol. Plant Breed. 2024, 22, 6796–6804. [Google Scholar]
  28. Wang, L.P.; Qin, K.J.; Zhao, L.C.; Yan, Z.G.; Huang, Z.Q.; Tu, D.P. Research progress of plant root expansion. Hubei Agric. Sci. 2020, 59, 5–9. [Google Scholar]
  29. Wang, Q.M.; Zhang, L.M.; Wang, Z.L. Formation and Thickening of Tuberous Roots in Relation to the Endogenous Hormone Concentrations in Sweetpotato. Sci. Agric. Sin. 2005, 38, 2414–2420. [Google Scholar]
  30. Tanaka, M.; Takahata, Y.; Nakatani, M. Analysis of genes developmentally regulated during storage root formation of sweet potato. J. Plant Physiol. 2005, 162, 91–102. [Google Scholar] [CrossRef]
  31. Tanaka, M.; Kato, N.; Nakayama, H.; Nakatani, M.; Takahata, Y. Expression of class I knotted1-like homeobox genes in the storage roots of sweetpotato (Ipomoea batatas). J. Plant Physiol. 2008, 165, 1726–1735. [Google Scholar] [CrossRef]
  32. Eserman, L.A.; Jarret, R.L.; Leebens-Mack, J.H. Parallel evolution of storage roots in morning glories (Convolvulaceae). BMC Plant Biol. 2018, 18, 95. [Google Scholar] [CrossRef] [PubMed]
  33. Ravi, V.; Chakrabarti, S.K.; Makeshkumar, T.; Saravanan, R. Molecular Regulation of Storage Root Formation and Development in Sweet Potato. Hortic. Rev. 2014, 42, 157–208. [Google Scholar]
  34. Wang, H.X.; Yang, J.; Zhang, M.; Fan, W.J.; Firon, N.; Pattanaik, S.; Yuan, L.; Zhang, P. Altered Phenylpropanoid Metabolism in the Maize Lc-Expressed Sweet Potato (Ipomoea batatas) Affects Storage Root Development. Sci. Rep. 2016, 6, 18645. [Google Scholar] [CrossRef] [PubMed]
  35. Zhang, W.; Zuo, Z.D.; Zhu, Y.X.; Feng, Y.X.; Wang, Y.; Zhao, H.Q.; Zhao, N.; Zhang, H.; He, S.Z.; Liu, Q.C.; et al. Fast track to obtain heritable transgenic sweet potato inspired by its evolutionary history as a naturally transgenic plant. Plant Biotechnol. J. 2023, 21, 671–673. [Google Scholar] [CrossRef]
  36. Kyndt, T.; Quispe, D.; Zhai, H.; Jarret, R.; Ghislain, M.; Liu, Q.H.; Gheysen, G.; Kreuze, J.F. The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc. Natl. Acad. Sci. USA 2015, 112, 5844–5849. [Google Scholar] [CrossRef]
  37. Hoshino, A.; Jayakumar, V.; Nitasaka, E.; Toyoda, A.; Noguchi, H.; Itoh, T.; Shin-I, T.; Minakuchi, Y.; Koda, Y.; Nagano, A.J.; et al. Genome sequence and analysis of the Japanese morning glory Ipomoea nil. Nat. Commun. 2016, 7, 13295. [Google Scholar] [CrossRef]
  38. Huo, K.S.; Zhao, D.L.; Chen, Y.L.; Zhou, Z.L.; Wang, Y.; Tang, J.; Zhu, G.P.; Cao, Q.H. Analysis of Genome Size and Characteristics of Salt-tolerant Plant Ipomoea pes-caprae (L.) R. Br. J. Plant Genet. Resour. 2019, 20, 728–735. [Google Scholar]
  39. Sampathkumar, R. Karyomorphological Studies in Some South Indian Convolvulaceae. Cytologia 1979, 44, 275–286. [Google Scholar] [CrossRef]
  40. Sampathkumar, R. On the chromosome numbers of some Convolvulaceae from South India. In Proceedings of the 55th Indian Science Congress, Calcutta, India, 3 January 1968; pp. 361–362. [Google Scholar]
  41. Bir, S.S.; Sidhu, M. Evolutionary status of weed flora of cultivated lands in Punjab, India. In Current Approaches in Cytogenetics; Sinha, R.R., Sinha, U., Eds.; Spectrum Publishing House: Delhi, India, 1983; pp. 135–144. [Google Scholar]
  42. Kaur, K.; Ramanpreet; Gupta, R.C.; Kumari, S. Cyto-Morphological Studies of Some Dicot Plants from Rajasthan (India). Cytologia 2015, 80, 353–362. [Google Scholar] [CrossRef][Green Version]
  43. Ibiapino, A.; García, M.A.; Amorim, B.; Baez, M.; Costea, M.; Stefanović, S.; Pedrosa-Harand, A. The Evolution of Cytogenetic Traits in Cuscuta (Convolvulaceae), the Genus with the Most Diverse Chromosomes in Angiosperms. Front. Plant Sci. 2022, 13, 842260. [Google Scholar] [CrossRef]
  44. Lekhak, M.M.; Patil, S.D.; Kattee, A.V.; Yadav, P.B.; Ghane, S.G.; Gavade, S.K.; Shimpale, V.B.; Yadav, S.R. Cytopalynological studies in some Convolvulaceae members from northern Western Ghats, India. Caryologia 2018, 71, 263–271. [Google Scholar] [CrossRef]
  45. Wu, S.; Lau, K.H.; Cao, Q.H.; Hamilton, J.P.; Sun, H.H.; Zhou, C.X.; Eserman, L.; Gemenet, D.C.; Olukolu, B.A.; Wang, H.Y.; et al. Genome sequences of two diploid wild relatives of cultivated sweetpotato reveal targets for genetic improvement. Nat. Commun. 2018, 9, 4580. [Google Scholar] [CrossRef] [PubMed]
  46. Chen, L.; Su, D.; Sun, J.Y.; Li, Z.Y.; Han, Y.H. Development of a set of chromosome-specific oligonucleotide markers and karyotype analysis in the Japanese morning glory Ipomoea nil. Sci. Hortic. 2020, 273, 109633. [Google Scholar] [CrossRef]
  47. Pedrosa-Harand, A.; de Almeida, C.C.S.; Mosiolek, M.; Blair, M.W.; Schweizer, D.; Guerra, M. Extensive ribosomal DNA amplification during Andean common bean (Phaseolus vulgaris L.) evolution. Theor. Appl. Genet. 2006, 112, 924–933. [Google Scholar] [CrossRef]
  48. Shishido, R.; Sano, Y.; Fukui, K. Ribosomal DNAs: An exception to the conservation of gene order in rice genomes. Mol. Gen. Genet. 2000, 263, 586–591. [Google Scholar] [CrossRef]
  49. Hayasaki, M.; Morikawa, T.; Leggett, J.M. Intraspecific variation of 18S-5.8S-26S rDNA sites vevealed by FISH and RFLP in wild oat, Avena agadiriana. Genes Genet. Syst. 2001, 76, 9–14. [Google Scholar] [CrossRef][Green Version]
  50. Raskina, O.; Belyayev, A.; Nevo, E. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations. Proc. Natl. Acad. Sci. USA 2004, 101, 14818–14823. [Google Scholar] [CrossRef] [PubMed]
  51. Li, K.P.; Wu, Y.X.; Zhao, H.; Wang, Y.; Lü, X.M.; Wang, J.M.; Xu, Y.; Li, Z.Y.; Han, Y.H. Cytogenetic relationships among Citrullus species in comparison with some genera of the tribe Benincaseae (Cucurbitaceae) as inferred from rDNA distribution patterns. BMC Evol. Biol. 2016, 16, 85–93. [Google Scholar] [CrossRef]
  52. Bass, H.W.; Marshall, W.F.; Sedat, J.W.; Agard, D.A.; Cande, W.Z. Telomeres Cluster De Novo before the Initiation of Synapsis: A Three-dimensional Spatial Analysis of Telomere Positions before and during Meiotic Prophase. J. Cell Biol. 1997, 137, 5–18. [Google Scholar] [CrossRef]
  53. Widarmi, W.D.; Kikuchi, S.; Sassa, H.; Koba, T. Physical localization of rDNAs and microsatellite sequences on the chromosomes of Lactuca saligna using fluorescence in situ hybridization. Chromosome Sci. 2020, 22, 13–18. [Google Scholar]
  54. Xie, J.H.; Zhao, Y.; Yu, L.Q.; Liu, R.J.; Dou, Q.W. Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes. PLoS ONE 2020, 15, e0227208. [Google Scholar] [CrossRef] [PubMed]
  55. Luo, X.M.; Liu, J.C. Fluorescence In Situ Hybridization (FISH) Analysis of the Locations of the Oligonucleotides 5S rDNA, (AGGGTTT)3, and (TTG)6 in Three Genera of Oleaceae and Their Phylogenetic Framework. Genes 2019, 10, 375–388. [Google Scholar] [CrossRef] [PubMed]
  56. Hu, J.; Xie, J.R.; Wang, S.M. Cloning and sequence analysis of 18s rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum. Pratacult. Sci. 2012, 29, 1369–1373. [Google Scholar]
  57. He, W.G.; Qin, Q.B.; Liu, S.J.; Li, T.L.; Wang, J.; Xiao, J.; Xie, L.H.; Zhang, C.; Liu, Y. Organization and Variation Analysis of 5S rDNA in Different Ploidy-level Hybrids of Red Crucian Carp × Topmouth Culter. PLoS ONE 2012, 7, e38976. [Google Scholar] [CrossRef]
  58. Pinhal, D.; Gadig, O.B.; Wasko, A.P.; Oliveira, C.; Ron, E.; Foresti, F.; Martins, C. Discrimination of Shark species by simple PCR of 5S rDNA repeats. Genet. Mol. Biol. 2008, 31, 361–365. [Google Scholar] [CrossRef][Green Version]
  59. Messias, L.H.V.; Ferreira, D.C.; Wasko, A.P.; Oliveira, C.; Foresti, F.; Martins, C. Brief report 5S rDNA organization in the fish Synbranchus marmoratus (Synbranchidae, Synbranchiformes). Hereditas 2003, 139, 228–231. [Google Scholar] [CrossRef][Green Version]
  60. Fujiwara, M.; Inafuku, J.; Takeda, A.; Watanabe, A.; Fujiwara, A.; Kohno, S.; Kubota, S. Molecular organization of 5S rDNA in bitterlings (Cyprinidae). Genetica 2008, 135, 355–365. [Google Scholar] [CrossRef]
  61. Campo, D.; Machado-Schiaffino, G.; Horreo, J.L.; Garcia-Vazquez, E. Molecular Organization and Evolution of 5S rDNA in the Genus Merluccius and Their Phylogenetic Implications. J. Mol. Evol. 2009, 68, 208–216. [Google Scholar] [CrossRef]
  62. Roullier, C.; Duputié, A.; Wennekes, P.; Benoit, L.; Bringas, V.M.F.; Rossel, G.; Tay, D.; McKey, D.; Lebot, V. Disentangling the origins of cultivated sweet potato (Ipomoea batatas (L.) Lam.). PLoS ONE 2017, 8, e62707. [Google Scholar]
  63. Muñoz-Rodríguez, P.; Carruthers, T.; Wood, J.R.I.; Williams, B.R.M.; Weitemier, K.; Kronmiller, B.; Ellis, D.; Anglin, N.L.; Longway, L.; Harris, S.A.; et al. Reconciling Conflicting Phylogenies in the Origin of Sweet Potato and Dispersal to Polynesia. Curr. Biol. 2018, 28, 1246–1256. [Google Scholar] [CrossRef]
  64. Austin, D.F. The Ipomoea batatas Complex-I. Taxonomy. Bull. Torrey Bot. Club 1978, 105, 114–129. [Google Scholar] [CrossRef]
Figure 1. Comparison of root morphology among 13 species of the genus Ipomoea. (a): Ipomoea triloba; (b): Ipomoea nil; (c): Ipomoea quamoclit; (d): Ipomoea platensis; (e): Ipomoea pes-tigridis; (f): Ipomoea pes-caprae; (g): Ipomoea trifida; (h): Ipomoea setosa; (i): Ipomoea obscura; (j): Ipomoea muelleri; (k): Ipomoea murucoides; (l): Ipomoea batatas; (m): Ipomoea digitata. Scale bars, 5 cm.
Figure 1. Comparison of root morphology among 13 species of the genus Ipomoea. (a): Ipomoea triloba; (b): Ipomoea nil; (c): Ipomoea quamoclit; (d): Ipomoea platensis; (e): Ipomoea pes-tigridis; (f): Ipomoea pes-caprae; (g): Ipomoea trifida; (h): Ipomoea setosa; (i): Ipomoea obscura; (j): Ipomoea muelleri; (k): Ipomoea murucoides; (l): Ipomoea batatas; (m): Ipomoea digitata. Scale bars, 5 cm.
Genes 15 01340 g001
Figure 2. Chromosomes and rDNA sites in 13 species of the genus Ipomoea. 5S rDNA is green, and 18S rDNA is red. (a): Ipomoea obscura; (b): Ipomoea quamoclit; (c): Ipomoea setosa; (d): Ipomoea trifida; (e): Ipomoea murucoides; (f): Ipomoea pes-caprae; (g): Ipomoea batatas; (h): Ipomoea pes-tigridis; (i): Ipomoea nil; (j): Ipomoea muelleri; (k): Ipomoea digitata; (l): Ipomoea platensis; (m): Ipomoea triloba. Scale bars, 10 μm.
Figure 2. Chromosomes and rDNA sites in 13 species of the genus Ipomoea. 5S rDNA is green, and 18S rDNA is red. (a): Ipomoea obscura; (b): Ipomoea quamoclit; (c): Ipomoea setosa; (d): Ipomoea trifida; (e): Ipomoea murucoides; (f): Ipomoea pes-caprae; (g): Ipomoea batatas; (h): Ipomoea pes-tigridis; (i): Ipomoea nil; (j): Ipomoea muelleri; (k): Ipomoea digitata; (l): Ipomoea platensis; (m): Ipomoea triloba. Scale bars, 10 μm.
Genes 15 01340 g002
Figure 3. 5S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa; (c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e1,e2): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l): Ipomoea quamoclit; (m1,m2,m3): Ipomoea batatas.
Figure 3. 5S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa; (c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e1,e2): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l): Ipomoea quamoclit; (m1,m2,m3): Ipomoea batatas.
Genes 15 01340 g003
Figure 4. Electrophoresis results of 5S rDNA amplification products in 13 species of the genus Ipomoea. 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6: Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11: Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas; M: Marker.
Figure 4. Electrophoresis results of 5S rDNA amplification products in 13 species of the genus Ipomoea. 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6: Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11: Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas; M: Marker.
Genes 15 01340 g004
Figure 5. 18S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa; (c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l1,l2): Ipomoea quamoclit; (m1,m2,m3): Ipomoea batatas.
Figure 5. 18S rDNA signals in 13 species of the genus Ipomoea. (a): Ipomoea obscura; (b): Ipomoea setosa; (c): Ipomoea murucoides; (d): Ipomoea pes-caprae; (e): Ipomoea digitata; (f): Ipomoea triloba; (g): Ipomoea platensis; (h): Ipomoea nil; (i): Ipomoea trifida; (j): Ipomoea pes-tigridis; (k): Ipomoea muelleri; (l1,l2): Ipomoea quamoclit; (m1,m2,m3): Ipomoea batatas.
Genes 15 01340 g005
Figure 6. Phylogenetic tree of 13 Ipomoea species based on 18S rDNA sequence. The bootstrap analysis was replicated 1000 times. The number shown in each branch indicates the bootstrap value percentage (%).
Figure 6. Phylogenetic tree of 13 Ipomoea species based on 18S rDNA sequence. The bootstrap analysis was replicated 1000 times. The number shown in each branch indicates the bootstrap value percentage (%).
Genes 15 01340 g006
Table 1. Sequences of 18S rDNA probe multiplexes and 5S rDNA probe used in this study.
Table 1. Sequences of 18S rDNA probe multiplexes and 5S rDNA probe used in this study.
ProbeSequenceLength (bp)
18S-1TTTGATGGTACCTACTACTCGGATAACCGTAGT33
18S-2GGTAGGATAGTGGCCTACCATGGTGGTGACGGGTG35
18S-3TCGAGTCTGGTAATTGGAATGAGTACAATCTAA33
18S-4AAAGCAAGCCTACGCTCTGTATACATTAGCATGG34
18S-5AGATACCGTCCTAGTCTCAACCATAAACGATGCC34
18S-6CTCAACACGGGGAAACTTACCAGGTCCAGACATAG35
18S-7GGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACG35
18S-8TTGTACACACCGCCCGTCGCTCCTACCGATTGAAT35
5STCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC41
Note: 18S rDNA probe multiplexes were composed of 18S-1 to 18S-8 and were developed in the present study.
Table 2. Chromosome and rDNA site numbers of different Ipomoea species.
Table 2. Chromosome and rDNA site numbers of different Ipomoea species.
SpeciesChromosome NumberNumber of rDNA
5S rDNA18S rDNA
Ipomoea muelleri2n = 2x = 3026
Ipomoea murucoides2n = 2x = 3024
Ipomoea trifida2n = 2x = 3026
Ipomoea triloba2n = 2x = 3028
Ipomoea nil2n = 2x = 30214
Ipomoea setosa2n = 2x = 3024
Ipomoea platensis2n = 2x = 3028
Ipomoea quamoclit2n = 2x = 30212
Ipomoea obscura2n = 2x = 3024
Ipomoea pes-tigridis2n = 2x = 2826
Ipomoea pes-caprae2n = 2x = 3024
Ipomoea digitata2n = 2x = 3047
Ipomoea batatas2n = 6x = 90616
Table 3. Chromosome length of 13 Ipomoea species.
Table 3. Chromosome length of 13 Ipomoea species.
SpeciesChromosome Length (nm)
MaximumMinimumAverage
Ipomoea muelleri0.9650.5550.744
Ipomoea murucoides0.9430.3690.707
Ipomoea trifida1.2260.6670.955
Ipomoea triloba1.1200.5340.871
Ipomoea nil1.0250.5420.817
Ipomoea setosa1.1850.6730.839
Ipomoea platensis1.1880.8220.994
Ipomoea quamoclit0.9340.5000.680
Ipomoea obscura0.9110.5620.724
Ipomoea pes-tigridis0.8470.4530.663
Ipomoea pes-caprae1.0720.6340.807
Ipomoea digitata1.4480.7521.072
Ipomoea batatas0.9170.3280.569
Table 4. Genetic distances among 13 Ipomoea species.
Table 4. Genetic distances among 13 Ipomoea species.
Species12345678910111213
10.000
20.0030.000
30.6580.6580.000
40.0030.0010.6580.000
50.6570.6570.0020.6570.000
60.6590.6590.0020.6590.0030.000
70.6570.6570.0010.6570.0030.0030.000
80.0030.0030.6600.0020.6590.6610.6590.000
90.6590.6590.0030.6590.0030.0030.0030.6610.000
100.0060.0040.6600.0050.6600.6610.6600.0050.6610.000
110.0030.0030.6610.0040.6610.6630.6610.0040.6630.0050.000
120.6570.6570.0010.6570.0030.0030.0000.6590.0030.6600.6610.000
130.6580.6580.0000.6580.0020.0020.0010.6600.0030.6600.6610.0010.000
Note: 1: Ipomoea muelleri; 2: Ipomoea murucoides; 3: Ipomoea trifida; 4: Ipomoea triloba; 5: Ipomoea nil; 6: Ipomoea setosa; 7: Ipomoea platensis; 8: Ipomoea quamoclit; 9: Ipomoea obscura; 10: Ipomoea pes-tigridis; 11: Ipomoea pes-caprae; 12: Ipomoea digitata; 13: Ipomoea batatas.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wu, J.; Lang, T.; Zhang, C.; Yang, F.; Yang, F.; Qu, H.; Pu, Z.; Feng, J. Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes 2024, 15, 1340. https://doi.org/10.3390/genes15101340

AMA Style

Wu J, Lang T, Zhang C, Yang F, Yang F, Qu H, Pu Z, Feng J. Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes. 2024; 15(10):1340. https://doi.org/10.3390/genes15101340

Chicago/Turabian Style

Wu, Jingyu, Tao Lang, Cong Zhang, Fan Yang, Feiyang Yang, Huijuan Qu, Zhigang Pu, and Junyan Feng. 2024. "Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea" Genes 15, no. 10: 1340. https://doi.org/10.3390/genes15101340

APA Style

Wu, J., Lang, T., Zhang, C., Yang, F., Yang, F., Qu, H., Pu, Z., & Feng, J. (2024). Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes, 15(10), 1340. https://doi.org/10.3390/genes15101340

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop