Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Chromosome Preparation
2.3. Fluorescence In Situ Hybridization
2.4. DNA Extraction and PCR Amplification of 5S and 18S rDNA
2.5. 18S rDNA Sequence Analysis
3. Results
3.1. Phenotypic Analysis of 13 Ipomoea Species
3.2. Number and Length of Chromosomes
3.3. 5S rDNA FISH Signal Sites and Amplified Fragment Polymorphisms
3.4. 18S rDNA Sites and Sequence Polymorphisms
3.5. Polymorphisms in 18S rDNA Sequences
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Khoury, C.K.; Heider, B.; Castañeda-Álvarez, N.P.; Achicanoy, H.A.; Sosa, C.C.; Miller, R.E.; Scotland, R.W.; Wood, J.R.I.; Rossel, G.; Eserman, L.A.; et al. Distributions, ex situ conservation priorities, and genetic resource potential of crop wild relatives of sweetpotato [Ipomoea batatas (L.) Lam., I. series Batatas]. Front. Plant Sci. 2015, 6, 251. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.X.; Nie, H.Z.; Wang, Y.Z.; Wang, X.Y.; Jarret, R.; Zhao, J.M.; Wang, H.X.; Yang, J. Exploring and exploiting genetics and genomics for sweetpotato improvement: Status and perspectives. Plant Commun. 2022, 3, 100332. [Google Scholar] [CrossRef]
- Liu, D.G.; Zhao, N.; Zhai, H.; Yu, X.X.; Jie, Q.; Wang, L.J.; He, S.Z.; Liu, Q.C. AFLP Fingerprinting and Genetic Diversity of Main Sweetpotato Varieties in China. J. Integr. Agric. 2012, 11, 1424–1433. [Google Scholar] [CrossRef]
- Heslop-Harrison, J.S. Comparative Genome Organization in Plants: From Sequence and Markers to Chromatin and Chromosomes. Plant Cell 2000, 12, 617–635. [Google Scholar] [CrossRef] [PubMed]
- Niu, K.; Chen, C.B.; Liu, H.J.; Gu, Y.; Wang, C.G.; Sun, D.L.; Song, W.Q. Localization of rDNA Sequences in a Variety of Vegetable & Fruit Plants on Chromosome. Acta Sci. Nat. Univ. Nankaiensis 2017, 50, 67–75. [Google Scholar]
- Srisuwan, S.; Sihachakr, D.; Siljak-Yakovlev, S. The origin and evolution of sweet potato (Ipomoea batatas Lam.) and its wild relatives through the cytogenetic approaches. Plant Sci. 2006, 171, 424–433. [Google Scholar] [CrossRef] [PubMed]
- An, T.T.; Tang, J.L.; Sun, J.Y.; Cao, Q.H.; Ma, D.F.; Li, Z.Y. rDNA-FISH Analysis and DAPI-kayotype of Ipomoea batatas cv. and Ipomoea hederacea Jacq. Acta Bot. Boreali-Occident. Sin. 2012, 32, 682–687. [Google Scholar]
- He, J.; Lin, S.S.; Yu, Z.Y.; Song, A.P.; Guan, Z.Y.; Fang, W.M.; Chen, S.M.; Zhang, F.; Jiang, J.F.; Chen, F.D.; et al. Identification of 5S and 45S rDNA sites in Chrysanthemum species by using oligonucleotide fluorescence in situ hybridization (Oligo-FISH). Mol. Biol. Rep. 2021, 48, 21–31. [Google Scholar] [CrossRef]
- Liu, Y.L.; Liu, L.J.; Peng, R.H. Development of FISH and Its Application in Plant Genome Research. Mol. Plant Breed. 2018, 16, 5696–5703. [Google Scholar]
- Wang, L.J.; Sheng, M.Y.; Ren, X.L. Chromosomal Localization of 5S and 18S rDNA in Eight Nicotiana Species and the Implications for Genome Evolution of Genus Nicotiana. Cytologia 2021, 86, 149–154. [Google Scholar] [CrossRef]
- Xin, H.Y.; Zhang, T.; Wu, Y.F.; Zhang, W.L.; Zhang, P.D.; Xi, M.L.; Jiang, J.M. An extraordinarily stable karyotype of the woody Populus species revealed by chromosome painting. Plant J. 2019, 101, 253–264. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.P.; Wang, Z.X.; Du, Y.P.; Li, J.W.; He, H.B.; Jia, G.X. Fluorescence in situ hybridization of 35S rDNA sites and karyotype of wild Lilium (Liliaceae) species from China: Taxonomic and phylogenetic implications. Genet. Resour. Crop Evol. 2020, 67, 10011–11017. [Google Scholar] [CrossRef]
- Su, D.; Chen, L.; Sun, J.Y.; Zhang, L.Y.; Gao, R.F.; Li, Q.; Han, Y.H.; Li, Z.Y. Comparative Chromosomal Localization of 45S and 5S rDNA Sites in 76 Purple-Fleshed Sweet Potato Cultivars. Plants 2020, 9, 865–876. [Google Scholar] [CrossRef]
- Chen, L.Q.; Zhang, Z.R.; Yang, J.B.; Li, D.Z.; Yu, W.B. Plastid phylogenomic insights into the phylogeny of Convolvulaceae. Guihaia 2021, 42, 1740–1749. [Google Scholar]
- Liu, Z.; Zhang, H.Y. ITS Sequence Analysis of Convolvulaceae Plants. J. West China For. Sci. 2012, 41, 70–74. [Google Scholar]
- Yu, L.X.; Liu, M.Y.; Cao, Q.H.; Yu, Y.C.; Xie, Y.P.; Luo, Y.H.; Han, Y.H.; Li, Z.Y. Analysis of nrDNA ITS Sequences in Ipomoea batatas and its Relative Wild Species. Plant Sci. J. 2014, 32, 40–49. [Google Scholar]
- Chelomina, G.N.; Rozhkovan, K.V.; Voronova, A.N.; Burundukova, O.L.; Muzarok, T.I.; Zhuravlev, Y.N. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer). J. Ginseng Res. 2016, 40, 176–184. [Google Scholar] [CrossRef]
- Huamén, Z. Descriptors for Sweet Potato; International Board for Plant Genetic Resources: Rome, Italy, 1991. [Google Scholar]
- Zhang, J.; Jiang, Y.; Wang, Y.; Guo, Y.L.; Long, H.; Deng, G.B.; Chen, Q.; Xuan, P. Molecular markers and cytogenetics to characterize a wheat-Dasypyrum villosum 3V (3D) substitution line conferring resistance to stripe rust. PLoS ONE 2018, 13, e0202033. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.H.; Wang, H.J.; Xu, Y.F.; Li, Y.S.; Lang, T.; Yang, Z.J.; Li, G.R. Characterization of Chromosomal Rearrangement in New Wheat—Thinopyrum intermedium Addition Lines Carrying Thinopyrum—Specific Grain Hardness Genes. Agronomy 2019, 9, 18. [Google Scholar] [CrossRef]
- Zheng, L.Y.; Jia, D.H.; Fei, X.F.; Luo, X.; Yang, Z.R. An assessment of the genetic diversity within Ganoderma strains with AFLP and ITS PCR-RFLP. Microbiol. Res. 2009, 164, 312–321. [Google Scholar] [CrossRef]
- Jiang, F.Y.; Huang, H.; Yang, N.; Ma, J. Cloning and Sequence Analysis of 18s rRNA Genes of Several Large Green Algae in Hainan Province. Chin. J. Trop. Agric. 2017, 37, 49–54. [Google Scholar]
- Choi, E.Y.; Seo, J.H.; Seo, B.B. Sequence Polymorphism and Chromosomal Localization of 5S rDNA of Three Cultivated Varieties of Sweetpotato (Ipomoea batatas (L.) Lam.). Genes Genom. 2009, 31, 325–332. [Google Scholar] [CrossRef]
- Xie, J.M.; Chen, Y.R.; Cai, G.J.; Cai, R.L.; Hu, Z.; Wang, H. Tree Visualization by One Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023, 51, W587–W592. [Google Scholar] [CrossRef] [PubMed]
- Acosta-Gallegos, J.A.; Kelly, J.D.; Gepts, P. Prebreeding in Common Bean and Use of Genetic Diversity from Wild Germplasm. Crop Science 2007, 47, S44–S59. [Google Scholar] [CrossRef]
- Feuillet, C.; Langridge, P.; Waugh, R. Cereal breeding takes a walk on the wild side. Trends Genet. 2008, 24, 24–32. [Google Scholar] [CrossRef]
- Song, W.H.; Hou, M.; Zhang, Y.G.; Li, Q. Research Advance on Mechanism of Expansion in Sweetpotato Storage Roots. Mol. Plant Breed. 2024, 22, 6796–6804. [Google Scholar]
- Wang, L.P.; Qin, K.J.; Zhao, L.C.; Yan, Z.G.; Huang, Z.Q.; Tu, D.P. Research progress of plant root expansion. Hubei Agric. Sci. 2020, 59, 5–9. [Google Scholar]
- Wang, Q.M.; Zhang, L.M.; Wang, Z.L. Formation and Thickening of Tuberous Roots in Relation to the Endogenous Hormone Concentrations in Sweetpotato. Sci. Agric. Sin. 2005, 38, 2414–2420. [Google Scholar]
- Tanaka, M.; Takahata, Y.; Nakatani, M. Analysis of genes developmentally regulated during storage root formation of sweet potato. J. Plant Physiol. 2005, 162, 91–102. [Google Scholar] [CrossRef]
- Tanaka, M.; Kato, N.; Nakayama, H.; Nakatani, M.; Takahata, Y. Expression of class I knotted1-like homeobox genes in the storage roots of sweetpotato (Ipomoea batatas). J. Plant Physiol. 2008, 165, 1726–1735. [Google Scholar] [CrossRef]
- Eserman, L.A.; Jarret, R.L.; Leebens-Mack, J.H. Parallel evolution of storage roots in morning glories (Convolvulaceae). BMC Plant Biol. 2018, 18, 95. [Google Scholar] [CrossRef] [PubMed]
- Ravi, V.; Chakrabarti, S.K.; Makeshkumar, T.; Saravanan, R. Molecular Regulation of Storage Root Formation and Development in Sweet Potato. Hortic. Rev. 2014, 42, 157–208. [Google Scholar]
- Wang, H.X.; Yang, J.; Zhang, M.; Fan, W.J.; Firon, N.; Pattanaik, S.; Yuan, L.; Zhang, P. Altered Phenylpropanoid Metabolism in the Maize Lc-Expressed Sweet Potato (Ipomoea batatas) Affects Storage Root Development. Sci. Rep. 2016, 6, 18645. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Zuo, Z.D.; Zhu, Y.X.; Feng, Y.X.; Wang, Y.; Zhao, H.Q.; Zhao, N.; Zhang, H.; He, S.Z.; Liu, Q.C.; et al. Fast track to obtain heritable transgenic sweet potato inspired by its evolutionary history as a naturally transgenic plant. Plant Biotechnol. J. 2023, 21, 671–673. [Google Scholar] [CrossRef]
- Kyndt, T.; Quispe, D.; Zhai, H.; Jarret, R.; Ghislain, M.; Liu, Q.H.; Gheysen, G.; Kreuze, J.F. The genome of cultivated sweet potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop. Proc. Natl. Acad. Sci. USA 2015, 112, 5844–5849. [Google Scholar] [CrossRef]
- Hoshino, A.; Jayakumar, V.; Nitasaka, E.; Toyoda, A.; Noguchi, H.; Itoh, T.; Shin-I, T.; Minakuchi, Y.; Koda, Y.; Nagano, A.J.; et al. Genome sequence and analysis of the Japanese morning glory Ipomoea nil. Nat. Commun. 2016, 7, 13295. [Google Scholar] [CrossRef]
- Huo, K.S.; Zhao, D.L.; Chen, Y.L.; Zhou, Z.L.; Wang, Y.; Tang, J.; Zhu, G.P.; Cao, Q.H. Analysis of Genome Size and Characteristics of Salt-tolerant Plant Ipomoea pes-caprae (L.) R. Br. J. Plant Genet. Resour. 2019, 20, 728–735. [Google Scholar]
- Sampathkumar, R. Karyomorphological Studies in Some South Indian Convolvulaceae. Cytologia 1979, 44, 275–286. [Google Scholar] [CrossRef]
- Sampathkumar, R. On the chromosome numbers of some Convolvulaceae from South India. In Proceedings of the 55th Indian Science Congress, Calcutta, India, 3 January 1968; pp. 361–362. [Google Scholar]
- Bir, S.S.; Sidhu, M. Evolutionary status of weed flora of cultivated lands in Punjab, India. In Current Approaches in Cytogenetics; Sinha, R.R., Sinha, U., Eds.; Spectrum Publishing House: Delhi, India, 1983; pp. 135–144. [Google Scholar]
- Kaur, K.; Ramanpreet; Gupta, R.C.; Kumari, S. Cyto-Morphological Studies of Some Dicot Plants from Rajasthan (India). Cytologia 2015, 80, 353–362. [Google Scholar] [CrossRef][Green Version]
- Ibiapino, A.; García, M.A.; Amorim, B.; Baez, M.; Costea, M.; Stefanović, S.; Pedrosa-Harand, A. The Evolution of Cytogenetic Traits in Cuscuta (Convolvulaceae), the Genus with the Most Diverse Chromosomes in Angiosperms. Front. Plant Sci. 2022, 13, 842260. [Google Scholar] [CrossRef]
- Lekhak, M.M.; Patil, S.D.; Kattee, A.V.; Yadav, P.B.; Ghane, S.G.; Gavade, S.K.; Shimpale, V.B.; Yadav, S.R. Cytopalynological studies in some Convolvulaceae members from northern Western Ghats, India. Caryologia 2018, 71, 263–271. [Google Scholar] [CrossRef]
- Wu, S.; Lau, K.H.; Cao, Q.H.; Hamilton, J.P.; Sun, H.H.; Zhou, C.X.; Eserman, L.; Gemenet, D.C.; Olukolu, B.A.; Wang, H.Y.; et al. Genome sequences of two diploid wild relatives of cultivated sweetpotato reveal targets for genetic improvement. Nat. Commun. 2018, 9, 4580. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Su, D.; Sun, J.Y.; Li, Z.Y.; Han, Y.H. Development of a set of chromosome-specific oligonucleotide markers and karyotype analysis in the Japanese morning glory Ipomoea nil. Sci. Hortic. 2020, 273, 109633. [Google Scholar] [CrossRef]
- Pedrosa-Harand, A.; de Almeida, C.C.S.; Mosiolek, M.; Blair, M.W.; Schweizer, D.; Guerra, M. Extensive ribosomal DNA amplification during Andean common bean (Phaseolus vulgaris L.) evolution. Theor. Appl. Genet. 2006, 112, 924–933. [Google Scholar] [CrossRef]
- Shishido, R.; Sano, Y.; Fukui, K. Ribosomal DNAs: An exception to the conservation of gene order in rice genomes. Mol. Gen. Genet. 2000, 263, 586–591. [Google Scholar] [CrossRef]
- Hayasaki, M.; Morikawa, T.; Leggett, J.M. Intraspecific variation of 18S-5.8S-26S rDNA sites vevealed by FISH and RFLP in wild oat, Avena agadiriana. Genes Genet. Syst. 2001, 76, 9–14. [Google Scholar] [CrossRef][Green Version]
- Raskina, O.; Belyayev, A.; Nevo, E. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations. Proc. Natl. Acad. Sci. USA 2004, 101, 14818–14823. [Google Scholar] [CrossRef] [PubMed]
- Li, K.P.; Wu, Y.X.; Zhao, H.; Wang, Y.; Lü, X.M.; Wang, J.M.; Xu, Y.; Li, Z.Y.; Han, Y.H. Cytogenetic relationships among Citrullus species in comparison with some genera of the tribe Benincaseae (Cucurbitaceae) as inferred from rDNA distribution patterns. BMC Evol. Biol. 2016, 16, 85–93. [Google Scholar] [CrossRef]
- Bass, H.W.; Marshall, W.F.; Sedat, J.W.; Agard, D.A.; Cande, W.Z. Telomeres Cluster De Novo before the Initiation of Synapsis: A Three-dimensional Spatial Analysis of Telomere Positions before and during Meiotic Prophase. J. Cell Biol. 1997, 137, 5–18. [Google Scholar] [CrossRef]
- Widarmi, W.D.; Kikuchi, S.; Sassa, H.; Koba, T. Physical localization of rDNAs and microsatellite sequences on the chromosomes of Lactuca saligna using fluorescence in situ hybridization. Chromosome Sci. 2020, 22, 13–18. [Google Scholar]
- Xie, J.H.; Zhao, Y.; Yu, L.Q.; Liu, R.J.; Dou, Q.W. Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes. PLoS ONE 2020, 15, e0227208. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.M.; Liu, J.C. Fluorescence In Situ Hybridization (FISH) Analysis of the Locations of the Oligonucleotides 5S rDNA, (AGGGTTT)3, and (TTG)6 in Three Genera of Oleaceae and Their Phylogenetic Framework. Genes 2019, 10, 375–388. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Xie, J.R.; Wang, S.M. Cloning and sequence analysis of 18s rRNA gene fragment from succulent xerophyte Zygophyllum xanthoxylum. Pratacult. Sci. 2012, 29, 1369–1373. [Google Scholar]
- He, W.G.; Qin, Q.B.; Liu, S.J.; Li, T.L.; Wang, J.; Xiao, J.; Xie, L.H.; Zhang, C.; Liu, Y. Organization and Variation Analysis of 5S rDNA in Different Ploidy-level Hybrids of Red Crucian Carp × Topmouth Culter. PLoS ONE 2012, 7, e38976. [Google Scholar] [CrossRef]
- Pinhal, D.; Gadig, O.B.; Wasko, A.P.; Oliveira, C.; Ron, E.; Foresti, F.; Martins, C. Discrimination of Shark species by simple PCR of 5S rDNA repeats. Genet. Mol. Biol. 2008, 31, 361–365. [Google Scholar] [CrossRef][Green Version]
- Messias, L.H.V.; Ferreira, D.C.; Wasko, A.P.; Oliveira, C.; Foresti, F.; Martins, C. Brief report 5S rDNA organization in the fish Synbranchus marmoratus (Synbranchidae, Synbranchiformes). Hereditas 2003, 139, 228–231. [Google Scholar] [CrossRef][Green Version]
- Fujiwara, M.; Inafuku, J.; Takeda, A.; Watanabe, A.; Fujiwara, A.; Kohno, S.; Kubota, S. Molecular organization of 5S rDNA in bitterlings (Cyprinidae). Genetica 2008, 135, 355–365. [Google Scholar] [CrossRef]
- Campo, D.; Machado-Schiaffino, G.; Horreo, J.L.; Garcia-Vazquez, E. Molecular Organization and Evolution of 5S rDNA in the Genus Merluccius and Their Phylogenetic Implications. J. Mol. Evol. 2009, 68, 208–216. [Google Scholar] [CrossRef]
- Roullier, C.; Duputié, A.; Wennekes, P.; Benoit, L.; Bringas, V.M.F.; Rossel, G.; Tay, D.; McKey, D.; Lebot, V. Disentangling the origins of cultivated sweet potato (Ipomoea batatas (L.) Lam.). PLoS ONE 2017, 8, e62707. [Google Scholar]
- Muñoz-Rodríguez, P.; Carruthers, T.; Wood, J.R.I.; Williams, B.R.M.; Weitemier, K.; Kronmiller, B.; Ellis, D.; Anglin, N.L.; Longway, L.; Harris, S.A.; et al. Reconciling Conflicting Phylogenies in the Origin of Sweet Potato and Dispersal to Polynesia. Curr. Biol. 2018, 28, 1246–1256. [Google Scholar] [CrossRef]
- Austin, D.F. The Ipomoea batatas Complex-I. Taxonomy. Bull. Torrey Bot. Club 1978, 105, 114–129. [Google Scholar] [CrossRef]






| Probe | Sequence | Length (bp) |
|---|---|---|
| 18S-1 | TTTGATGGTACCTACTACTCGGATAACCGTAGT | 33 |
| 18S-2 | GGTAGGATAGTGGCCTACCATGGTGGTGACGGGTG | 35 |
| 18S-3 | TCGAGTCTGGTAATTGGAATGAGTACAATCTAA | 33 |
| 18S-4 | AAAGCAAGCCTACGCTCTGTATACATTAGCATGG | 34 |
| 18S-5 | AGATACCGTCCTAGTCTCAACCATAAACGATGCC | 34 |
| 18S-6 | CTCAACACGGGGAAACTTACCAGGTCCAGACATAG | 35 |
| 18S-7 | GGTCTGTGATGCCCTTAGATGTTCTGGGCCGCACG | 35 |
| 18S-8 | TTGTACACACCGCCCGTCGCTCCTACCGATTGAAT | 35 |
| 5S | TCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC | 41 |
| Species | Chromosome Number | Number of rDNA | |
|---|---|---|---|
| 5S rDNA | 18S rDNA | ||
| Ipomoea muelleri | 2n = 2x = 30 | 2 | 6 |
| Ipomoea murucoides | 2n = 2x = 30 | 2 | 4 |
| Ipomoea trifida | 2n = 2x = 30 | 2 | 6 |
| Ipomoea triloba | 2n = 2x = 30 | 2 | 8 |
| Ipomoea nil | 2n = 2x = 30 | 2 | 14 |
| Ipomoea setosa | 2n = 2x = 30 | 2 | 4 |
| Ipomoea platensis | 2n = 2x = 30 | 2 | 8 |
| Ipomoea quamoclit | 2n = 2x = 30 | 2 | 12 |
| Ipomoea obscura | 2n = 2x = 30 | 2 | 4 |
| Ipomoea pes-tigridis | 2n = 2x = 28 | 2 | 6 |
| Ipomoea pes-caprae | 2n = 2x = 30 | 2 | 4 |
| Ipomoea digitata | 2n = 2x = 30 | 4 | 7 |
| Ipomoea batatas | 2n = 6x = 90 | 6 | 16 |
| Species | Chromosome Length (nm) | ||
|---|---|---|---|
| Maximum | Minimum | Average | |
| Ipomoea muelleri | 0.965 | 0.555 | 0.744 |
| Ipomoea murucoides | 0.943 | 0.369 | 0.707 |
| Ipomoea trifida | 1.226 | 0.667 | 0.955 |
| Ipomoea triloba | 1.120 | 0.534 | 0.871 |
| Ipomoea nil | 1.025 | 0.542 | 0.817 |
| Ipomoea setosa | 1.185 | 0.673 | 0.839 |
| Ipomoea platensis | 1.188 | 0.822 | 0.994 |
| Ipomoea quamoclit | 0.934 | 0.500 | 0.680 |
| Ipomoea obscura | 0.911 | 0.562 | 0.724 |
| Ipomoea pes-tigridis | 0.847 | 0.453 | 0.663 |
| Ipomoea pes-caprae | 1.072 | 0.634 | 0.807 |
| Ipomoea digitata | 1.448 | 0.752 | 1.072 |
| Ipomoea batatas | 0.917 | 0.328 | 0.569 |
| Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 0.000 | ||||||||||||
| 2 | 0.003 | 0.000 | |||||||||||
| 3 | 0.658 | 0.658 | 0.000 | ||||||||||
| 4 | 0.003 | 0.001 | 0.658 | 0.000 | |||||||||
| 5 | 0.657 | 0.657 | 0.002 | 0.657 | 0.000 | ||||||||
| 6 | 0.659 | 0.659 | 0.002 | 0.659 | 0.003 | 0.000 | |||||||
| 7 | 0.657 | 0.657 | 0.001 | 0.657 | 0.003 | 0.003 | 0.000 | ||||||
| 8 | 0.003 | 0.003 | 0.660 | 0.002 | 0.659 | 0.661 | 0.659 | 0.000 | |||||
| 9 | 0.659 | 0.659 | 0.003 | 0.659 | 0.003 | 0.003 | 0.003 | 0.661 | 0.000 | ||||
| 10 | 0.006 | 0.004 | 0.660 | 0.005 | 0.660 | 0.661 | 0.660 | 0.005 | 0.661 | 0.000 | |||
| 11 | 0.003 | 0.003 | 0.661 | 0.004 | 0.661 | 0.663 | 0.661 | 0.004 | 0.663 | 0.005 | 0.000 | ||
| 12 | 0.657 | 0.657 | 0.001 | 0.657 | 0.003 | 0.003 | 0.000 | 0.659 | 0.003 | 0.660 | 0.661 | 0.000 | |
| 13 | 0.658 | 0.658 | 0.000 | 0.658 | 0.002 | 0.002 | 0.001 | 0.660 | 0.003 | 0.660 | 0.661 | 0.001 | 0.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, J.; Lang, T.; Zhang, C.; Yang, F.; Yang, F.; Qu, H.; Pu, Z.; Feng, J. Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes 2024, 15, 1340. https://doi.org/10.3390/genes15101340
Wu J, Lang T, Zhang C, Yang F, Yang F, Qu H, Pu Z, Feng J. Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes. 2024; 15(10):1340. https://doi.org/10.3390/genes15101340
Chicago/Turabian StyleWu, Jingyu, Tao Lang, Cong Zhang, Fan Yang, Feiyang Yang, Huijuan Qu, Zhigang Pu, and Junyan Feng. 2024. "Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea" Genes 15, no. 10: 1340. https://doi.org/10.3390/genes15101340
APA StyleWu, J., Lang, T., Zhang, C., Yang, F., Yang, F., Qu, H., Pu, Z., & Feng, J. (2024). Chromosomal Localization and Diversity Analysis of 5S and 18S Ribosomal DNA in 13 Species from the Genus Ipomoea. Genes, 15(10), 1340. https://doi.org/10.3390/genes15101340

