Exploring Immune-Related Gene Profiling and Infiltration of Immune Cells in Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma
Abstract
:1. Introduction
2. Methods
2.1. Data Collection
2.2. Pathological Analysis
2.3. Cell Culture
2.4. Immune Infiltrate Analysis
3. Results
3.1. Differential Gene Screening
3.2. Immune Gene Acquisition
3.3. Pathological Analysis of HE Staining in Cervical Carcinoma
3.4. Immunohistochemical Results of Immune Genes in Cervical Cancer
3.5. Functional Enrichment Analysis
3.6. PPI Analysis of DEGs
3.7. CXCL8 and CXCL10 Interaction Network Construction and Gene Ontology
3.8. Expression Analysis of CXCL8 and CXCL10 in CESC
3.9. The Role of CXCL8 and CXCL10 in Immune Infiltration within CESC
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bruni, L.; Serrano, B.; Roura, E.; Alemany, L.; Cowan, M.; Herrero, R.; Poljak, M.; Murillo, R.; Broutet, N.; Riley, L.M.; et al. Cervical cancer screening programmes and age-specific coverage estimates for 202 countries and territories worldwide: A review and synthetic analysis. Lancet Glob. Health 2022, 10, e1115–e1127. [Google Scholar]
- Zhou, J.; Xu, L.; Zhou, H.; Wang, J.; Xing, X. Prediction of Prognosis and Chemotherapeutic Sensitivity Based on Cuproptosis-Associated lncRNAs in Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma. Genes 2023, 14, 1381. [Google Scholar] [CrossRef]
- Monk, B.J.; Toita, T.; Wu, X.; Vázquez Limón, J.C.; Tarnawski, R.; Mandai, M.; Shapira-Frommer, R.; Mahantshetty, U.; Del Pilar Estevez-Diz, M.; Zhou, Q.; et al. Durvalumab versus placebo with chemoradiotherapy for locally advanced cervical cancer (CALLA): A randomised, double-blind, phase 3 trial. Lancet Oncol. 2023, 24, 1334–1348. [Google Scholar] [CrossRef]
- Paul, A.M.; Pillai, M.R.; Kumar, R. Prognostic Significance of Dysregulated Epigenomic and Chromatin Modifiers in Cervical Cancer. Cells 2021, 10, 2665. [Google Scholar] [CrossRef]
- Ding, H.; Xiong, X.X.; Fan, G.L.; Yi, Y.X.; Chen, Y.R.; Wang, J.T.; Zhang, W. The New Biomarker for Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma (CESC) Based on Public Database Mining. Biomed Res. Int. 2020, 2020, 5478574. [Google Scholar]
- Wright, J.D.; Matsuo, K.; Huang, Y.; Tergas, A.I.; Hou, J.Y.; Khoury-Collado, F.; St Clair, C.M.; Ananth, C.V.; Neugut, A.I.; Hershman, D.L. Prognostic Performance of the 2018 International Federation of Gynecology and Obstetrics Cervical Cancer Staging Guidelines. Obstet. Gynecol. 2019, 134, 49–57. [Google Scholar] [CrossRef]
- Yang, C.; Xia, B.R.; Zhang, Z.C.; Zhang, Y.J.; Lou, G.; Jin, W.L. Immunotherapy for Ovarian Cancer: Adjuvant, Combination, and Neoadjuvant. Front. Immunol. 2020, 11, 577869. [Google Scholar] [CrossRef]
- Cappello, P.; Bulfamante, S.; Mandili, G.; Novelli, F. Discovery of Targets for Cancer Immunoprevention. Methods Mol. Biol. 2022, 2435, 19–33. [Google Scholar]
- Schmitz, J.M.; McCracken, V.J.; Dimmitt, R.A.; Lorenz, R.G. Expression of CXCL15 (Lungkine) in murine gastrointestinal, urogenital, and endocrine organs. J. Histochem. Cytochem. 2007, 55, 515–524. [Google Scholar] [CrossRef]
- Lee, N.H.; Nikfarjam, M.; He, H. Functions of the CXC ligand family in the pancreatic tumor microenvironment. Pancreatology 2018, 18, 705–716. [Google Scholar]
- Zeng, Q.; Sun, S.; Li, Y.; Li, X.; Li, Z.; Liang, H. Identification of Therapeutic Targets and Prognostic Biomarkers among CXC Chemokines in the Renal Cell Carcinoma Microenvironment. Front. Oncol. 2019, 9, 1555. [Google Scholar] [CrossRef]
- Gao, X.; Cheng, Y.H.; Enten, G.A.; DeSantis, A.J.; Gaponenko, V.; Majetschak, M. Regulation of the thrombin/protease-activated receptor 1 axis by chemokine (CXC motif) receptor 4. J. Biol. Chem. 2020, 295, 14893–14905. [Google Scholar]
- Baggiolini, M. CXCL8—The First Chemokine. Front. Immunol. 2015, 6, 285. [Google Scholar]
- Dai, J.; Pan, Y.; Chen, Y.; Yao, S. A panel of seven immune-related genes can serve as a good predictive biomarker for cervical squamous cell carcinoma. Front. Genet. 2022, 13, 1024508. [Google Scholar]
- Liu, K.; Lai, M.; Wang, S.; Zheng, K.; Xie, S.; Wang, X. Construction of a CXC Chemokine-Based Prediction Model for the Prognosis of Colon Cancer. Biomed. Res. Int. 2020, 2020, 6107865. [Google Scholar] [CrossRef]
- Hu, J.; Zhao, Q.; Kong, L.Y.; Wang, J.; Yan, J.; Xia, X.; Jia, Z.; Heimberger, A.B.; Li, S. Regulation of tumor immune suppression and cancer cell survival by CXCL1/2 elevation in glioblastoma multiforme. Sci. Adv. 2021, 7, eabc2511. [Google Scholar] [CrossRef]
- Zhang, W.; Wu, Q.; Wang, C.; Yang, L.; Liu, P.; Ma, C. AKIP1 promotes angiogenesis and tumor growth by upregulating CXC-chemokines in cervical cancer cells. Mol. Cell Biochem. 2018, 448, 311–320. [Google Scholar] [CrossRef] [PubMed]
- Sukkurwala, A.Q.; Martins, I.; Wang, Y.; Schlemmer, F.; Ruckenstuhl, C.; Durchschlag, M.; Michaud, M.; Senovilla, L.; Sistigu, A.; Ma, Y.; et al. Immunogenic calreticulin exposure occurs through a phylogenetically conserved stress pathway involving the chemokine CXCL8. Cell Death Differ. 2014, 21, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Sharma, K.; Machalek, D.A.; Toh, Z.Q.; Amenu, D.; Muchengeti, M.; Ndlovu, A.K.; Mremi, A.; McHome, B.; Vallely, A.J.; Denny, L.; et al. No woman left behind: Achieving cervical cancer elimination among women living with HIV. Lancet HIV 2023, 10, e412–e420. [Google Scholar] [CrossRef] [PubMed]
- Chelimo, C.; Wouldes, T.A.; Cameron, L.D.; Elwood, J.M. Risk factors for and prevention of human papillomaviruses (HPV), genital warts and cervical cancer. J. Infect. 2013, 66, 207–217. [Google Scholar] [CrossRef]
- Adiga, D.; Eswaran, S.; Pandey, D.; Sharan, K.; Kabekkodu, S.P. Molecular landscape of recurrent cervical cancer. Crit. Rev. Oncol. Hematol. 2021, 157, 103178. [Google Scholar] [CrossRef]
- Oura, K.; Morishita, A.; Tani, J.; Masaki, T. Tumor Immune Microenvironment and Immunosuppressive Therapy in Hepatocellular Carcinoma: A Review. Int. J. Mol. Sci. 2021, 22, 5801. [Google Scholar] [CrossRef] [PubMed]
- Do, H.T.T.; Lee, C.H.; Cho, J. Chemokines and their Receptors: Multifaceted Roles in Cancer Progression and Potential Value as Cancer Prognostic Markers. Cancers 2020, 12, 287. [Google Scholar] [CrossRef]
- Xiao, Y.C.; Yang, Z.B.; Cheng, X.S.; Fang, X.B.; Shen, T.; Xia, C.F.; Liu, P.; Qian, H.H.; Sun, B.; Yin, Z.F.; et al. CXCL8, overexpressed in colorectal cancer, enhances the resistance of colorectal cancer cells to anoikis. Cancer Lett. 2015, 361, 22–32. [Google Scholar] [CrossRef]
- Chung, C.; Seo, W.; Silwal, P.; Jo, E.K. Crosstalks between inflammasome and autophagy in cancer. J. Hematol. Oncol. 2020, 13, 100. [Google Scholar] [CrossRef]
- Tokunaga, R.; Zhang, W.; Naseem, M.; Puccini, A.; Berger, M.D.; Soni, S.; McSkane, M.; Baba, H.; Lenz, H.J. CXCL9, CXCL10, CXCL11/CXCR3 axis for immune activation—A target for novel cancer therapy. Cancer Treat. Rev. 2018, 63, 40–47. [Google Scholar] [CrossRef]
- Bronger, H.; Singer, J.; Windmüller, C.; Reuning, U.; Zech, D.; Delbridge, C.; Dorn, J.; Kiechle, M.; Schmalfeldt, B.; Schmitt, M.; et al. CXCL9 and CXCL10 predict survival and are regulated by cyclooxygenase inhibition in advanced serous ovarian cancer. Br. J. Cancer 2016, 115, 553–563. [Google Scholar] [CrossRef]
- Deng, Z.; Huang, K.; Liu, D.; Luo, N.; Liu, T.; Han, L.; Du, D.; Lian, D.; Zhong, Z.; Peng, J. Key Candidate Prognostic Biomarkers Correlated with Immune Infiltration in Hepatocellular Carcinoma. J. Hepatocell. Carcinoma 2021, 8, 1607–1622. [Google Scholar]
- Arneth, B. Tumor Microenvironment. Medicina 2019, 56, 15. [Google Scholar] [CrossRef]
- Li, N.; Li, B.; Zhan, X. Comprehensive Analysis of Tumor Microenvironment Identified Prognostic Immune-Related Gene Signature in Ovarian Cancer. Front. Genet. 2021, 12, 616073. [Google Scholar] [CrossRef]
- Boutilier, A.J.; Elsawa, S.F. Macrophage Polarization States in the Tumor Microenvironment. Int. J. Mol. Sci. 2021, 22, 6995. [Google Scholar] [CrossRef] [PubMed]
- Heinecke, J.L.; Ridnour, L.A.; Cheng, R.Y.; Switzer, C.H.; Lizardo, M.M.; Khanna, C.; Glynn, S.A.; Hussain, S.P.; Young, H.A.; Ambs, S.; et al. Tumor microenvironment-based feed-forward regulation of NOS2 in breast cancer progression. Proc. Natl. Acad. Sci. USA 2014, 111, 6323–6328. [Google Scholar] [CrossRef] [PubMed]
- Wenbo, L.; Wang, J. Uncovering the underlying mechanism of cancer tumorigenesis and development under an immune microenvironment from global quantification of the landscape. J. R. Soc. Interface 2017, 14. [Google Scholar]
Gene | Primer Sequences | |
---|---|---|
GAPDH | F | GGAGCGAGATCCCTCCAAAAT |
R | GGCTGTTGTCATACTTCTCATGG | |
CXCL8 | F | TTTTGCCAAGGAGTGCTAAAGA |
R | AACCCTCTGCACCCAGTTTTC | |
CXCL10 | F | GTGGCATTCAAGGAGTACCTC |
R | TGATGGCCTTCGATTCTGGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Xi, J. Exploring Immune-Related Gene Profiling and Infiltration of Immune Cells in Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma. Genes 2024, 15, 121. https://doi.org/10.3390/genes15010121
Li J, Xi J. Exploring Immune-Related Gene Profiling and Infiltration of Immune Cells in Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma. Genes. 2024; 15(1):121. https://doi.org/10.3390/genes15010121
Chicago/Turabian StyleLi, Jialu, and Juqun Xi. 2024. "Exploring Immune-Related Gene Profiling and Infiltration of Immune Cells in Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma" Genes 15, no. 1: 121. https://doi.org/10.3390/genes15010121