A Lycopene ε-Cyclase TILLING Allele Enhances Lycopene and Carotenoid Content in Fruit and Improves Drought Stress Tolerance in Tomato Plants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Mutant Allele Identification
2.3. Drought Stress Experiments
2.4. Carotenoid Analysis
2.5. ABA Measurement
2.6. Leaf Stomatal Conductance
2.7. Digital Imaging Phenotyping: Data Acquisition and Processing
2.8. Bioristor Measurements
2.9. Statistical Analysis
3. Results
3.1. Discovery and Phenotyping of a Novel SlLCY-E Allele
3.2. First Drought Stress Experiment
3.2.1. Analysis of Leaf Carotenoid Content
3.2.2. ABA Measurements
3.3. Second Drought Stress Experiment
3.3.1. Digital Imaging Results
3.3.2. Bioristor Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, H.; Hou, X.; Du, T. Responses of Tomato Fruit Water Balance and Xylem Hydraulic Property of Pedicel and Calyx to Water Deficit and Salinity Stress. Environ. Exp. Bot. 2023, 206, 105195. [Google Scholar] [CrossRef]
- Conti, V.; Romi, M.; Guarnieri, M.; Cantini, C.; Cai, G. Italian Tomato Cultivars under Drought Stress Show Different Content of Bioactives in Pulp and Peel of Fruits. Foods 2022, 11, 270. [Google Scholar] [CrossRef] [PubMed]
- Taheri, S.; Gantait, S.; Azizi, P.; Mazumdar, P. Drought Tolerance Improvement in Solanum Lycopersicum: An Insight into “OMICS” Approaches and Genome Editing. 3 Biotech 2022, 12, 63. [Google Scholar] [CrossRef] [PubMed]
- Zargar, S.M.; Mir, R.A.; Ebinezer, L.B.; Masi, A.; Hami, A.; Manzoor, M.; Salgotra, R.K.; Sofi, N.R.; Mushtaq, R.; Rohila, J.S.; et al. Physiological and Multi-Omics Approaches for Explaining Drought Stress Tolerance and Supporting Sustainable Production of Rice. Front. Plant Sci. 2022, 12, 803603. [Google Scholar] [CrossRef]
- Gong, P.; Zhang, J.; Li, H.; Yang, C.; Zhang, C.; Zhang, X.; Khurram, Z.; Zhang, Y.; Wang, T.; Fei, Z.; et al. Transcriptional Profiles of Drought-Responsive Genes in Modulating Transcription Signal Transduction, and Biochemical Pathways in Tomato. J. Exp. Bot. 2010, 61, 3563–3575. [Google Scholar] [CrossRef]
- Cunningham, F.X.; Gantt, E. Genes and enzymes of carotenoid biosynthesis in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1998, 49, 557–583. [Google Scholar] [CrossRef]
- Milborrow, B.V. The Pathway of Biosynthesis of Abscisic Acid in Vascular Plants: A Review of the Present State of Knowledge of ABA Biosynthesis. J. Exp. Bot. 2001, 52, 1145–1164. [Google Scholar] [CrossRef]
- Felemban, A.; Braguy, J.; Zurbriggen, M.D.; Al-Babili, S. Apocarotenoids Involved in Plant Development and Stress Response. Front. Plant Sci. 2019, 10, 1168. [Google Scholar] [CrossRef] [Green Version]
- Hadley, C.W.; Miller, E.C.; Schwartz, S.J.; Clinton, S.K. Tomatoes, Lycopene, and Prostate Cancer: Progress and Promise. Exp. Biol. Med. 2002, 227, 869–880. [Google Scholar] [CrossRef]
- Mordente, A.; Guantario, B.; Meucci, E.; Silvestrini, A.; Lombardi, E.; Martorana, G.E.; Giardina, B.; Böhm, V. Lycopene and Cardiovascular Diseases: An Update. Curr. Med. Chem. 2011, 18, 1146–1163. [Google Scholar] [CrossRef]
- Fraser, P.D.; Enfissi, E.M.A.; Halket, J.M.; Truesdale, M.R.; Yu, D.; Gerrish, C.; Bramley, P.M. Manipulation of Phytoene Levels in Tomato Fruit: Effects on Isoprenoids, Plastids, and Intermediary Metabolism. Plant Cell 2007, 19, 3194–3211. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Yuan, B.; Zhang, M.; Wang, L.; Cui, M.; Wang, Q.; Leng, P. Fruit-Specific RNAi-Mediated Suppression of SlNCED1 Increases Both Lycopene and β-Carotene Contents in Tomato Fruit. J. Exp. Bot. 2012, 63, 3097–3108. [Google Scholar] [CrossRef] [Green Version]
- Luo, Z.; Zhang, J.; Li, J.; Yang, C.; Wang, T.; Ouyang, B.; Li, H.; Giovannoni, J.; Ye, Z. A STAY-GREEN Protein SlSGR1 Regulates Lycopene and β-Carotene Accumulation by Interacting Directly with SlPSY1 during Ripening Processes in Tomato. New Phytol. 2013, 198, 442–452. [Google Scholar] [CrossRef]
- Silletti, M.F.; Petrozza, A.; Stigliani, A.L.; Giorio, G.; Cellini, F.; D’Ambrosio, C.; Carriero, F. An Increase of Lycopene Content in Tomato Fruit Is Associated with a Novel Cyc-B Allele Isolated through TILLING Technology. Mol. Breed. 2013, 31, 665–674. [Google Scholar] [CrossRef]
- Li, X.; Wang, Y.; Chen, S.; Tian, H.; Fu, D.; Zhu, B.; Luo, Y.; Zhu, H. Lycopene Is Enriched in Tomato Fruit by CRISPR/Cas9-Mediated Multiplex Genome Editing. Front. Plant Sci. 2018, 9, 559. [Google Scholar] [CrossRef]
- D’Ambrosio, C.; Giorio, G.; Marino, I.; Merendino, A.; Petrozza, A.; Salfi, L.; Stigliani, A.L.; Cellini, F. Virtually Complete Conversion of Lycopene into β-Carotene in Fruits of Tomato Plants Transformed with the Tomato Lycopene β-Cyclase (Tlcy-b) CDNA. Plant Sci. 2004, 166, 207–214. [Google Scholar] [CrossRef]
- Yu, B.; Lydiate, D.J.; Young, L.W.; Schäfer, U.A.; Hannoufa, A. Enhancing the Carotenoid Content of Brassica Napus Seeds by Downregulating Lycopene Epsilon Cyclase. Transgenic Res. 2008, 17, 573–585. [Google Scholar] [CrossRef]
- Ke, Q.; Kang, L.; Kim, H.S.; Xie, T.; Liu, C.; Ji, C.Y.; Kim, S.H.; Park, W.S.; Ahn, M.-J.; Wang, S.; et al. Down-Regulation of Lycopene ε-Cyclase Expression in Transgenic Sweetpotato Plants Increases the Carotenoid Content and Tolerance to Abiotic Stress. Plant Sci. Int. J. Exp. Plant Biol. 2019, 281, 52–60. [Google Scholar] [CrossRef]
- Kang, C.; Zhai, H.; Xue, L.; Zhao, N.; He, S.; Liu, Q. A Lycopene β-Cyclase Gene, IbLCYB2, Enhances Carotenoid Contents and Abiotic Stress Tolerance in Transgenic Sweetpotato. Plant Sci. 2018, 272, 243–254. [Google Scholar] [CrossRef]
- McCallum, C.M.; Comai, L.; Greene, E.A.; Henikoff, S. Targeting Induced Local Lesions IN Genomes (TILLING) for Plant Functional Genomics. Plant Physiol. 2000, 123, 439–442. [Google Scholar] [CrossRef] [Green Version]
- Minoia, S.; Petrozza, A.; D’Onofrio, O.; Piron, F.; Mosca, G.; Sozio, G.; Cellini, F.; Bendahmane, A.; Carriero, F. A New Mutant Genetic Resource for Tomato Crop Improvement by TILLING Technology. BMC Res. Notes 2010, 3, 69. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janni, M.; Coppede, N.; Bettelli, M.; Briglia, N.; Petrozza, A.; Summerer, S.; Vurro, F.; Danzi, D.; Cellini, F.; Marmiroli, N.; et al. In Vivo Phenotyping for the Early Detection of Drought Stress in Tomato. Plant Phenomics 2019, 2019, 6168209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalmais, M.; Schmidt, J.; Le Signor, C.; Moussy, F.; Burstin, J.; Savois, V.; Aubert, G.; Brunaud, V.; de Oliveira, Y.; Guichard, C.; et al. UTILLdb, a Pisum Sativum in Silico Forward and Reverse Genetics Tool. Genome Biol. 2008, 9, R43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Triques, K.; Sturbois, B.; Gallais, S.; Dalmais, M.; Chauvin, S.; Clepet, C.; Aubourg, S.; Rameau, C.; Caboche, M.; Bendahmane, A. Characterization of Arabidopsis Thaliana Mismatch Specific Endonucleases: Application to Mutation Discovery by TILLING in Pea. Plant J. 2007, 51, 1116–1125. [Google Scholar] [CrossRef] [PubMed]
- Stigliani, A.L.; Giorio, G.; D’Ambrosio, C. Characterization of P450 Carotenoid Beta- and Epsilon-Hydroxylases of Tomato and Transcriptional Regulation of Xanthophyll Biosynthesis in Root, Leaf, Petal and Fruit. Plant Cell Physiol. 2011, 52, 851–865. [Google Scholar] [CrossRef]
- Zhou, R.; Squires, T.M.; Ambrose, S.J.; Abrams, S.R.; Ross, A.R.S.; Cutler, A.J. Rapid Extraction of Abscisic Acid and Its Metabolites for Liquid Chromatography-Tandem Mass Spectrometry. J. Chromatogr. A 2003, 1010, 75–85. [Google Scholar] [CrossRef]
- Marko, D.; Briglia, N.; Summerer, S.; Petrozza, A.; Cellini, F.; Iannacone, R. High-Throughput Phenotyping in Plant Stress Response: Methods and Potential Applications to Polyamine Field. Methods Mol. Biol. 2018, 1694, 373–388. [Google Scholar] [CrossRef]
- Coppedè, N.; Villani, M.; Gentile, F. Diffusion Driven Selectivity in Organic Electrochemical Transistors. Sci. Rep. 2014, 4, 4297. [Google Scholar] [CrossRef] [Green Version]
- Tarabella, G.; Villani, M.; Calestani, D.; Mosca, R.; Iannotta, S.; Zappettini, A.; Coppedè, N. A Single Cotton Fiber Organic Electrochemical Transistor for Liquid Electrolyte Saline Sensing. J. Mater. Chem. 2012, 22, 23830–23834. [Google Scholar] [CrossRef]
- Elschner, A.; Kirchmeyer, S.; Lovenich, W.; Merker, U.; Reuter, K. PEDOT: Principles and Applications of an Intrinsically Conductive Polymer; CRC Press: Boca Raton, FL, USA, 2010; ISBN 978-1-4200-6912-9. [Google Scholar]
- Nilsson, D.; Robinson, N.; Berggren, M.; Forchheimer, R. Electrochemical Logic Circuits. Adv. Mater. 2005, 17, 353–358. [Google Scholar] [CrossRef]
- Bernards, D.A.; Macaya, D.J.; Nikolou, M.; DeFranco, J.A.; Takamatsu, S.; Malliaras, G.G. Enzymatic Sensing with Organic Electrochemical Transistors. J. Mater. Chem. 2007, 18, 116–120. [Google Scholar] [CrossRef]
- Kassambara, A.; Mundt, F. Extract and Visualize the Results of Multivariate Data Analyses [R Package Factoextra Version 1.0.7]. 1 April 2020. Available online: https://cran.r-project.org/web/packages/factoextra/index.html(accessed on 27 April 2020).
- Kim, J.; Kim, K.-S.; Kim, Y.; Chung, Y.S. A Short Review: Comparisons of High-Throughput Phenotyping Methods for Detecting Drought Tolerance. Sci. Agric. 2020, 78, 4. [Google Scholar] [CrossRef]
- Kim, S.L.; Kim, N.; Lee, H.; Lee, E.; Cheon, K.-S.; Kim, M.; Baek, J.; Choi, I.; Ji, H.; Yoon, I.S.; et al. High-Throughput Phenotyping Platform for Analyzing Drought Tolerance in Rice. Planta 2020, 252, 38. [Google Scholar] [CrossRef]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under Drought and Salt Stress: Regulation Mechanisms from Whole Plant to Cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef] [Green Version]
- Berger, B.; Parent, B.; Tester, M. High-Throughput Shoot Imaging to Study Drought Responses. J. Exp. Bot. 2010, 61, 3519–3528. [Google Scholar] [CrossRef] [Green Version]
- Danzi, D.; Briglia, N.; Petrozza, A.; Summerer, S.; Povero, G.; Stivaletta, A.; Cellini, F.; Pignone, D.; De Paola, D.; Janni, M. Can High Throughput Phenotyping Help Food Security in the Mediterranean Area? Front. Plant Sci. 2019, 10, 15. [Google Scholar] [CrossRef]
- Ng, P.C.; Henikoff, S. SIFT: Predicting Amino Acid Changes That Affect Protein Function. Nucleic Acids Res. 2003, 31, 3812–3814. [Google Scholar] [CrossRef] [Green Version]
- Lin, T.; Zhu, G.; Zhang, J.; Xu, X.; Yu, Q.; Zheng, Z.; Zhang, Z.; Lun, Y.; Li, S.; Wang, X.; et al. Genomic Analyses Provide Insights into the History of Tomato Breeding. Nat. Genet. 2014, 46, 1220–1226. [Google Scholar] [CrossRef]
- Galpaz, N.; Wang, Q.; Menda, N.; Zamir, D.; Hirschberg, J. Abscisic Acid Deficiency in the Tomato Mutant High-Pigment 3 Leading to Increased Plastid Number and Higher Fruit Lycopene Content. Plant J. Cell Mol. Biol. 2008, 53, 717–730. [Google Scholar] [CrossRef]
- Raza, A.; Mubarik, M.S.; Sharif, R.; Habib, M.; Jabeen, W.; Zhang, C.; Chen, H.; Chen, Z.-H.; Siddique, K.H.M.; Zhuang, W.; et al. Developing Drought-Smart, Ready-to-Grow Future Crops. Plant Genome 2023, 16, e20279. [Google Scholar] [CrossRef]
- Pervez, M.A.; Ayub, C.M.; Khan, H.A.; Shahid, M.A.; Ashraf, I. Effect of Drought Stress on Growth, Yield and Seed Quality of Tomato (Lycopersicon esculentum L.). Pak. J. Agric. Sci. Pak. 2009, 46, 174–178. [Google Scholar]
- Cui, J.; Shao, G.; Lu, J.; Keabetswe, L.; Hoogenboom, G. Yield, Quality and Drought Sensitivity of Tomato to Water Deficit during Different Growth Stages. Sci. Agric. 2020, 77, e20180390. [Google Scholar] [CrossRef] [Green Version]
- Michela, J.; Claudia, C.; Federico, B.; Sara, P.; Filippo, V.; Nicola, C.; Manuele, B.; Davide, C.; Loreto, F.; Zappettini, A. Real-Time Monitoring of Arundo Donax Response to Saline Stress through the Application of in Vivo Sensing Technology. Sci. Rep. 2021, 11, 18598. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence 5′-3′ |
---|---|
Fw-ext | TCAGACACGACGCTCAATCT |
Rev-ext | TGTCGTTTTCGTTCTTGTGG |
Fw-int | CCAACACGAGTCTTTTTCGAG |
Rev-int | AGTACAGAGGCGCATTTTGG |
Violaxanthin | Zeaxanthin | Neoxanthin | Lutein | β-Carotene | Lycopene | Total Carotenoids | |
---|---|---|---|---|---|---|---|
Leaf | |||||||
M | 288.51 ± 53.74 a | 31.95 ± 3.86 a | 101.25 ± 22.37 a | 396.55 ± 56.82 a | 444.33 ± 31.96 a | 1262.6 ± 98.16 a | |
WT | 144.18 ± 18.35 b | 22.05 ± 2.79 b | 101.31 ± 15.66 a | 615.02 ± 14.08 b | 395.19 ± 10.49 a | 1277.74 ± 36.4 a | |
Fruit | |||||||
M | 7.2 ± 1.20 a | 37.27 ± 6.26 a | 1819.28 ± 104.53 a | 1874.5 ± 110.33 a | |||
WT | 20.59 ± 2.04 b | 54.62 ± 7.86 b | 1474.40 ± 51.08 b | 1571.18 ± 49.08 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Petrozza, A.; Summerer, S.; Melfi, D.; Mango, T.; Vurro, F.; Bettelli, M.; Janni, M.; Cellini, F.; Carriero, F. A Lycopene ε-Cyclase TILLING Allele Enhances Lycopene and Carotenoid Content in Fruit and Improves Drought Stress Tolerance in Tomato Plants. Genes 2023, 14, 1284. https://doi.org/10.3390/genes14061284
Petrozza A, Summerer S, Melfi D, Mango T, Vurro F, Bettelli M, Janni M, Cellini F, Carriero F. A Lycopene ε-Cyclase TILLING Allele Enhances Lycopene and Carotenoid Content in Fruit and Improves Drought Stress Tolerance in Tomato Plants. Genes. 2023; 14(6):1284. https://doi.org/10.3390/genes14061284
Chicago/Turabian StylePetrozza, Angelo, Stephan Summerer, Donato Melfi, Teresa Mango, Filippo Vurro, Manuele Bettelli, Michela Janni, Francesco Cellini, and Filomena Carriero. 2023. "A Lycopene ε-Cyclase TILLING Allele Enhances Lycopene and Carotenoid Content in Fruit and Improves Drought Stress Tolerance in Tomato Plants" Genes 14, no. 6: 1284. https://doi.org/10.3390/genes14061284
APA StylePetrozza, A., Summerer, S., Melfi, D., Mango, T., Vurro, F., Bettelli, M., Janni, M., Cellini, F., & Carriero, F. (2023). A Lycopene ε-Cyclase TILLING Allele Enhances Lycopene and Carotenoid Content in Fruit and Improves Drought Stress Tolerance in Tomato Plants. Genes, 14(6), 1284. https://doi.org/10.3390/genes14061284