Japanese Flounder pol-miR-155 Is Involved in Edwardsiella tarda Infection via ATG3
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Cell Lines
2.3. In Vivo Infection of E. tarda
2.4. Intracellular Replication Assay of E. tarda
2.5. Quantitative Real-Time PCR (qRT-PCR)
2.6. Luciferase Reporter Assay
2.7. Western Blot
2.8. Effect of pol-miR-155 and ATG3 on E. tarda Infection
2.9. MiRNA Mimic and siRNA
2.10. Statistical Analysis
3. Results
3.1. The Expression of pol-miR-155 and ATG3 during E. tarda Infection
3.2. Effects of pol-miR-155 and ATG3 on E. tarda Infection
3.3. Identification of ATG3 as a Target Gene of pol-miR-155
3.4. Effects of ATG3 and pol-miR-155 on Autophagy
3.5. The Influence of E. tarda and pol-miR-155 on the Activity of the NF-κB Pathway
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Correia de Sousa, M.; Gjorgjieva, M.; Dolicka, D.; Sobolewski, C.; Foti, M. Deciphering miRNAs’ Action through miRNA Editing. Int. J. Mol. Sci. 2019, 20, 6249. [Google Scholar] [CrossRef]
- Hill, M.; Tran, N. miRNA interplay: Mechanisms and consequences in cancer. Dis. Model. Mech. 2021, 14, dmm047662. [Google Scholar] [CrossRef] [PubMed]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Liu Gao, M.Y.; Zhang, L.; He, F.L.; Shi, Y.K.; Pan, X.H.; Wang, H. MicroRNA-155 affects oxidative damage through regulating autophagy in endothelial cells. Oncol. Lett. 2019, 17, 2237–2243. [Google Scholar] [CrossRef]
- Cui, Z.; Liu, L.; Kwame Amevor, F.; Zhu, Q.; Wang, Y.; Li, D.; Shu, G.; Tian, Y.; Zhao, X. High Expression of miR-204 in Chicken Atrophic Ovaries Promotes Granulosa Cell Apoptosis and Inhibits Autophagy. Front. Cell Dev. Biol. 2020, 8, 580072. [Google Scholar] [CrossRef] [PubMed]
- Zhu, D.; Pan, C.; Li, L.; Bian, Z.; Lv, Z.; Shi, L.; Zhang, J.; Li, D.; Gu, H.; Zhang, C.Y.; et al. MicroRNA-17/20a/106a modulate macrophage inflammatory responses through targeting signal-regulatory protein α. J. Allergy Clin. Immunol. 2013, 132, 426–436. [Google Scholar] [CrossRef]
- Rao, L.; Meng, F.L.; Fang, R.; Cai, C.Y.; Zhao, X.L. Molecular mechanism of microRNA in regulating cochlear hair cell development. Yi Chuan Hered. 2019, 41, 994–1008. [Google Scholar]
- Cazzanelli, P.; Wuertz-Kozak, K. MicroRNAs in Intervertebral Disc Degeneration, Apoptosis, Inflammation, and Mechanobiology. Int. J. Mol. Sci. 2020, 21, 3601. [Google Scholar] [CrossRef]
- Zhao, Z.; Sun, W.; Guo, Z.; Zhang, J.; Yu, H.; Liu, B. Mechanisms of lncRNA/microRNA interactions in angiogenesis. Life Sci. 2020, 254, 116900. [Google Scholar] [CrossRef] [PubMed]
- Bushati, N.; Cohen, S.M. microRNA Functions. Annu. Rev. Cell Dev. Biol. 2007, 23, 175–205. [Google Scholar] [CrossRef]
- Mishra, R.; Krishnamoorthy, P.; Kumar, H. MicroRNA-30e-5p Regulates SOCS1 and SOCS3 during Bacterial Infection. Front. Cell. Infect. Microbiol. 2021, 10, 604016. [Google Scholar] [CrossRef]
- Cui, J.; Li, Z.; Cui, K.; Gao, Y.; Zhang, B.; Niu, J.; Wang, Y. MicroRNA-20a-3p regulates the host immune response to facilitate the mycobacterium tuberculosis infection by targeting IKKβ/NF-κB pathway. Int. Immunopharmacol. 2021, 91, 107286. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Cui, H.; Ni, S.; Yan, Y.; Qin, Q. Comprehensive identification and profiling of host miRNAs in response to Singapore grouper iridovirus (SGIV) infection in grouper (Epinephelus coioides). Dev. Comp. Immunol. 2015, 52, 226–235. [Google Scholar] [CrossRef]
- Zhang, B.-C.; Zhou, Z.-J.; Sun, L. pol-miR-731, a teleost miRNA upregulated by megalocytivirus, negatively regulates virus-induced type I interferon response, apoptosis and cell cycle arrest. Sci. Rep. 2016, 6, 28354. [Google Scholar] [CrossRef] [PubMed]
- Nie, L.; Cai, S.-Y.; Sun, J.; Chen, J. MicroRNA-155 promotes pro-inflammatory functions and augments apoptosis of monocytes/macrophages during Vibrio anguillarum infection in ayu, Plecoglossus altivelis. Fish Shellfish Immunol. 2019, 86, 70–81. [Google Scholar] [CrossRef]
- Li, W.-R.; Guan, X.-L.; Jiang, S.; Sun, L. The novel fish miRNA pol-miR-novel_171 and its target gene FAM49B play a critical role in apoptosis and bacterial infection. Dev. Comp. Immunol. 2020, 106, 103616. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Wang, L.; He, J.; Zhu, X.; Huang, W.; Wang, S.; Qin, Q.; Sun, H. MicroRNA-124 Promotes Singapore Grouper Iridovirus Replication and Negatively Regulates Innate Immune Response. Front. Immunol. 2021, 12, 767813. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chen, Y. AMPK and Autophagy. Adv. Exp. Med. Biol. 2019, 1206, 85–108. [Google Scholar]
- White, E.; Mehnert, J.M.; Chan, C.S. Autophagy, Metabolism, and Cancer. Clin. Cancer Res. 2015, 21, 5037–5046. [Google Scholar] [CrossRef]
- Mizushima, N. Autophagy: Process and function. Genes Dev. 2007, 21, 2861–2873. [Google Scholar] [CrossRef] [PubMed]
- Wong, S.Q.; Kumar, A.V.; Mills, J.; Lapierre, L.R. Autophagy in aging and longevity. Hum. Genet. 2020, 139, 277–290. [Google Scholar] [CrossRef] [PubMed]
- Mao, J.; Lin, E.; He, L.; Yu, J.; Tan, P.; Zhou, Y. Autophagy and Viral Infection. Adv. Exp. Med. Biol. 2019, 1209, 55–78. [Google Scholar]
- Keller, M.D.; Torres, V.J.; Cadwell, K. Autophagy and microbial pathogenesis. Cell Death Differ. 2020, 27, 872–886. [Google Scholar] [CrossRef] [PubMed]
- Deretic, V. Autophagy in infection. Curr. Opin. Cell Biol. 2010, 22, 252–262. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Shen, Y.; Zhang, S.; Xiao, Y.; Shi, S. Salmonella Interacts with Autophagy to Offense or Defense. Front. Microbiol. 2020, 11, 721. [Google Scholar] [CrossRef]
- Wang, M.; Fan, Z.; Han, H. Autophagy in Staphylococcus aureus Infection. Front. Cell. Infect. Microbiol. 2021, 11, 750222. [Google Scholar] [CrossRef] [PubMed]
- Lou, L.; Tian, M.; Chang, J.; Li, F.; Zhang, G. MiRNA-192-5p attenuates airway remodeling and autophagy in asthma by targeting MMP-16 and ATG7. Biomed. Pharmacother. Biomed. Pharmacother. 2020, 122, 109692. [Google Scholar] [CrossRef]
- Lu, X.; Zhang, Y.; Zheng, Y.; Chen, B. The miRNA-15b/USP7/KDM6B axis engages in the initiation of osteoporosis by modulating osteoblast differentiation and autophagy. J. Cell. Mol. Med. 2021, 25, 2069–2081. [Google Scholar] [CrossRef]
- Zhang, H.; Liang, J.; Chen, N. The Potential Role of miRNA-Regulated Autophagy in Alzheimer’s Disease. Int. J. Mol. Sci. 2022, 23, 7789. [Google Scholar] [CrossRef]
- Chen, D.; Chen, Y.; Lin, C.; Lo, C.; Liu, H.; Liao, T. MicroRNA-889 Inhibits Autophagy To Maintain Mycobacterial Survival in Patients with Latent Tuberculosis Infection by Targeting TWEAK. mBio 2020, 11, e03045-19. [Google Scholar] [CrossRef]
- Jia, P.; Pan, H.; Cui, K.; Jia, K.; Yi, M. MicroRNA expression profiling of sea perch brain cells reveals the roles of microRNAs in autophagy induced by RGNNV infection. J. Fish Dis. 2021, 44, 1305–1314. [Google Scholar] [CrossRef]
- Li, W.; Guan, X. PUF60 of Japanese flounder is regulated by pol-miR-novel_395 and involved in pathogen infection, autophagy, and apoptosis. Dev. Comp. Immunol. 2021, 123, 104170. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, T.; Tooze, S.A. Emerging roles of ATG proteins and membrane lipids in autophagosome formation. Cell Discov. 2020, 6, 32. [Google Scholar] [CrossRef] [PubMed]
- Wesselborg, S.; Stork, B. Autophagy signal transduction by ATG proteins: From hierarchies to networks. Cell. Mol. Life Sci. 2015, 72, 4721–4757. [Google Scholar] [CrossRef] [PubMed]
- Tsukada, M.; Ohsumi, Y. Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS Lett. 1993, 333, 169–174. [Google Scholar] [CrossRef]
- Mizushima, N.; Yoshimori, T.; Ohsumi, Y. The role of Atg proteins in autophagosome formation. Annu. Rev. Cell Dev. Biol. 2011, 27, 107–132. [Google Scholar] [CrossRef]
- Mizushima, N. The ATG conjugation systems in autophagy. Curr. Opin. Cell Biol. 2020, 63, 1–10. [Google Scholar] [CrossRef]
- Vergne, I.; Lafont, F.; Espert, L.; Esclatine, A.; Biard-Piechaczyk, M. Autophagy, ATG proteins and infectious diseases. Med. Sci. 2017, 33, 312–318. [Google Scholar]
- Fang, D.; Xie, H.; Hu, T.; Shan, H.; Li, M. Binding Features and Functions of ATG3. Front. Cell Dev. Biol. 2021, 9, 685625. [Google Scholar] [CrossRef]
- Qiu, Y.; Zheng, Y.; Grace, C.R.R.; Liu, X.; Klionsky, D.J.; Schulman, B.A. Allosteric regulation through a switch element in the autophagy E2, Atg3. Autophagy 2020, 16, 183–184. [Google Scholar] [CrossRef]
- Sou, Y.S.; Waguri, S.; Iwata, J.; Ueno, T.; Fujimura, T.; Hara, T.; Sawada, N.; Yamada, A.; Mizushima, N.; Uchiyama, Y.; et al. The Atg8 conjugation system is indispensable for proper development of autophagic isolation membranes in mice. Mol. Biol. Cell 2008, 19, 4762–4775. [Google Scholar] [CrossRef] [PubMed]
- Radoshevich, L.; Murrow, L.; Chen, N.; Fernandez, E.; Roy, S.; Fung, C.; Debnath, J. ATG12 conjugation to ATG3 regulates mitochondrial homeostasis and cell death. Cell 2010, 142, 590–600. [Google Scholar] [CrossRef]
- Altman, B.J.; Jacobs, S.R.; Mason, E.F.; Michalek, R.D.; MacIntyre, A.N.; Coloff, J.L.; Ilkayeva, O.; Jia, W.; He, Y.W.; Rathmell, J.C. Autophagy is essential to suppress cell stress and to allow BCR-Abl-mediated leukemogenesis. Oncogene 2011, 30, 1855–1867. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.; Park, S.; Biering, S.B.; Selleck, E.; Liu, C.Y.; Zhang, X.; Fujita, N.; Saitoh, T.; Akira, S.; Yoshimori, T.; et al. The parasitophorous vacuole membrane of Toxoplasma gondii is targeted for disruption by ubiquitin-like conjugation systems of autophagy. Immunity 2014, 40, 924–935. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Yu, N.; Qian, M.; Feng, J.; Cao, S.; Yin, J.; Zhang, Q. ERK-mediated autophagy promotes inactivated Sendai virus (HVJ-E)-induced apoptosis in HeLa cells in an Atg3-dependent manner. Cancer Cell Int. 2018, 18, 200. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.; Fu, W.; Tang, M.; Zhang, C.; Hou, T.; Li, R.; Lu, X.; Wang, Y.; Zhou, J.; Li, X.; et al. PTK2-mediated degradation of ATG3 impedes cancer cells susceptible to DNA damage treatment. Autophagy 2017, 13, 579–591. [Google Scholar] [CrossRef] [PubMed]
- Park, S.B.; Aoki, T.; Jung, T.S. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet. Res. 2012, 43, 67. [Google Scholar] [CrossRef]
- Guan, X.L.; Zhang, B.C.; Sun, L. Japanese flounder pol-miR-3p-2 suppresses Edwardsiella tarda infection by regulation of autophagy via p53. Dev. Comp. Immunol. 2020, 103, 103531. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Ning, X.; Sun, L. Megalocytivirus Induces Complicated Fish Immune Response at Multiple RNA Levels Involving mRNA, miRNA, and circRNA. Int. J. Mol. Sci. 2021, 22, 3156. [Google Scholar] [CrossRef]
- Wang, H.R.; Hu, Y.H.; Zhang, W.W.; Sun, L. Construction of an attenuated Pseudomonas fluorescens strain and evaluation of its potential as a cross-protective vaccine. Vaccine 2009, 27, 4047–4055. [Google Scholar] [CrossRef] [PubMed]
- Tong, S.-L.; Li, H.; Miao, H.-Z. The establishment and partial characterization of a continuous fish cell line FG-9307 from the gill of flounder Paralichthys olivaceus. Aquaculture 1997, 156, 327–333. [Google Scholar] [CrossRef]
- Sun, K.; Wang, H.-L.; Zhang, M.; Xiao, Z.-Z.; Sun, L. Genetic mechanisms of multi-antimicrobial resistance in a pathogenic Edwardsiella tarda strain. Aquaculture 2009, 289, 134–139. [Google Scholar] [CrossRef]
- Staedel, C.; Darfeuille, F. MicroRNAs and bacterial infection. Cell Microbiol. 2013, 15, 1496–1507. [Google Scholar] [CrossRef] [PubMed]
- Gottwein, E.; Cullen, B.R. Viral and cellular microRNAs as determinants of viral pathogenesis and immunity. Cell Host Microbe 2008, 3, 375–387. [Google Scholar] [CrossRef]
- Huang, C.W.; Tsai, K.N.; Chen, Y.S.; Chang, R.Y. Differential miRNA Expression Profiling Reveals Correlation of miR125b-5p with Persistent Infection of Japanese Encephalitis Virus. Int. J. Mol. Sci. 2021, 22, 4218. [Google Scholar] [CrossRef]
- Andreassen, R.; Høyheim, B. miRNAs associated with immune response in teleost fish. Dev. Comp. Immunol. 2017, 75, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, C.; Mano, M.; Eulalio, A. MicroRNAs at the Host-Bacteria Interface: Host Defense or Bacterial Offense. Trends Microbiol. 2019, 27, 206–218. [Google Scholar] [CrossRef]
- Johnston, D.G.W.; Kearney, J.; Zaslona, Z.; Williams, M.A.; O’Neill, L.A.J.; Corr, S.C. MicroRNA-21 Limits Uptake of Listeria monocytogenes by Macrophages to Reduce the Intracellular Niche and Control Infection. Front. Cell. Infect. Microbiol. 2017, 7, 201. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Yu, J.; Zhang, Y.; Li, L.; Chen, Y.; Li, D.; Liu, F.; Zhang, C.Y.; Gu, H.; Zen, K. Salmonella enterica serovar enteritidis modulates intestinal epithelial miR-128 levels to decrease macrophage recruitment via macrophage colony-stimulating factor. J. Infect. Dis. 2014, 209, 2000–2011. [Google Scholar] [CrossRef]
- Khan, M.; Harms, J.S.; Liu, Y.; Eickhoff, J.; Tan, J.W.; Hu, T.; Cai, F.; Guimaraes, E.; Oliveira, S.C.; Dahl, R.; et al. Brucella suppress STING expression via miR-24 to enhance infection. PLoS Pathog. 2020, 16, e1009020. [Google Scholar] [CrossRef]
- Li, M.; Wu, M.; Sun, Y.; Sun, L. Edwardsiella tarda TraT is an anti-complement factor and a cellular infection promoter. Commun. Biol. 2022, 5, 637. [Google Scholar] [CrossRef] [PubMed]
- Leung, K.Y.; Siame, B.A.; Tenkink, B.J.; Noort, R.J.; Mok, Y.K. Edwardsiella tarda—Virulence mechanisms of an emerging gastroenteritis pathogen. Microbes Infect. 2012, 14, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Lei, Y.; Li, H.; Lu, K. Autophagy Regulation of Bacterial Pathogen Invasion. Adv. Exp. Med. Biol. 2019, 1209, 43–54. [Google Scholar]
- Tanida, I.; Ueno, T.; Kominami, E. LC3 conjugation system in mammalian autophagy. Int. J. Biochem. Cell Biol. 2004, 36, 2503–2518. [Google Scholar] [CrossRef]
- Hu, J.; Huang, S.; Liu, X.; Zhang, Y.; Wei, S.; Hu, X. miR-155: An Important Role in Inflammation Response. J. Immunol. Res. 2022, 2022, 7437281. [Google Scholar] [CrossRef]
- Maciak, K.; Dziedzic, A.; Miller, E.; Saluk-Bijak, J. miR-155 as an Important Regulator of Multiple Sclerosis Pathogenesis. A Review. Int. J. Mol. Sci. 2021, 22, 4332. [Google Scholar] [CrossRef]
- Park, M.; Choi, S.; Kim, S.; Kim, J.; Lee, D.K.; Park, W.; Kim, T.; Jung, J.; Hwang, J.Y.; Won, M.H.; et al. NF-kappaB-responsive miR-155 induces functional impairment of vascular smooth muscle cells by downregulating soluble guanylyl cyclase. Exp. Mol. Med. 2019, 51, 1–12. [Google Scholar] [PubMed]
- Jiang, K.; Yang, J.; Guo, S.; Zhao, G.; Wu, H.; Deng, G. Peripheral Circulating Exosome-Mediated Delivery of miR-155 as a Novel Mechanism for Acute Lung Inflammation. Mol. Ther. J. Am. Soc. Gene Ther. 2019, 27, 1758–1771. [Google Scholar] [CrossRef]
- Singh, A.; Srivastava, N.; Yadav, A.; Ateeq, B. Targeting AGTR1/NF-kappaB/CXCR4 axis by miR-155 attenuates oncogenesis in glioblastoma. Neoplasia 2020, 22, 497–510. [Google Scholar] [CrossRef]
Primers | Sequence (5′-3′) a |
---|---|
3UTR-ATG3-F | TCTAGTTGTTTAAACGAGCTCACACATAGAGATGAAACT |
3UTR-ATG3-R | CCTGCAGGTCGACTCTAGAGTCACAGTCTGTACAGAC |
pol-miR-155-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT |
pol-miR-155-F | CGCGTTAATGCTAATCGTGAT |
pol-miR-155-R | AGTGCAGGGTCCGAGGTATT |
ATG3-qRT-F | AAACAGATGAGGCGACCCTG |
ATG3-qRT-R | GAGTCGAGGGGTCTGGTAGT |
IL-6-qRT-F | CTCCAGTCGAATACGAGCCC |
IL-6-qRT-R | ACTCTTTCTGGTGGTGAGCG |
IL-8-qRT-F | GCCTGAGAAGCCTAGGAGTG |
IL-8-qRT-R | TGACTCTCTTCACCCACGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Guan, X. Japanese Flounder pol-miR-155 Is Involved in Edwardsiella tarda Infection via ATG3. Genes 2023, 14, 958. https://doi.org/10.3390/genes14050958
Zhang Z, Guan X. Japanese Flounder pol-miR-155 Is Involved in Edwardsiella tarda Infection via ATG3. Genes. 2023; 14(5):958. https://doi.org/10.3390/genes14050958
Chicago/Turabian StyleZhang, Zhanwei, and Xiaolu Guan. 2023. "Japanese Flounder pol-miR-155 Is Involved in Edwardsiella tarda Infection via ATG3" Genes 14, no. 5: 958. https://doi.org/10.3390/genes14050958
APA StyleZhang, Z., & Guan, X. (2023). Japanese Flounder pol-miR-155 Is Involved in Edwardsiella tarda Infection via ATG3. Genes, 14(5), 958. https://doi.org/10.3390/genes14050958