TPD1-like Gene as a Suitable Marker for Early Sex Determination in Date Palm (Phoenix dactylifera L.)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. DNA Sequence Retrieval and Primer Designing
2.3. Extraction of DNA
2.4. RNA Extraction and cDNA Synthesis
2.5. Polymerase Chain Reaction
2.6. Semi qPCR Analysis of TPD1-like Gene
2.7. Real-Time PCR Analysis of TPD1-like Gene
2.8. In Silico Analysis of TPD1-like Gene
2.8.1. Functional Annotation of Protein
2.8.2. Subcellular Localization and Signal Peptide Determination
2.8.3. Protein Structure Analysis
2.8.4. Glycosylation Sites Prediction
2.8.5. Acetylation and Phosphorylation Sites
2.8.6. Sequence Analysis of Promoter
3. Results
3.1. TPD1-like Gene Amplification on DNA of Selected Date Palm Suckers
3.2. Semi qPCR Analysis of TPDI-like Gene on the Leaves of Date Palm Suckers
3.3. Real-Time PCR Analysis of TPD1-like Gene on the Leaves of Date Palm Suckers
3.4. Semi-qPCR Analysis of TPD1-like Gene on the Leaves of Unknown Seedling of Date Palm
3.5. Real-Time PCR Analysis of TPD1-like Gene on the Leaves of Unknown Seedling of Date Palm
3.6. In Silico Analysis of TPD1-like Gene
3.6.1. Coding Sequence of TPD1-like Gene
3.6.2. Subcellular Localization
3.6.3. Signal Peptide Analysis
3.6.4. Acetylation and Phosphorylation Sites
3.6.5. Promoter Analysis of TPD1-like Gene
3.6.6. BLASTx Analysis of TPD1-like Promoter Sequence
3.6.7. PLANTPAN Analysis of Promoter
3.6.8. Promoter Cis-Acting Regulatory Elements’ Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dransfield, J.; Baker, W.J.; Harley, M.M.; Asmussen, C.; Lewis, C.E. Genera Palmarum, the Evolution and Classification of Palms; Royal Botanic Gardens: London, UK, 2008. [Google Scholar]
- Al-Khalifha, N.; Askari, S.E.; Khan, A.S. Molecular and Morphological identification of some elite varieties of date palms in Saudi Arabia. Emir. J. Food Agric. 2012, 24, 456–461. [Google Scholar]
- Ghnimi, S.; Syed, U.; Azharul, K.; Kamal-Eldin, A. Date fruit as food security crop in the arid lands seeking industrial valorization. Nutr. Food Sci. J. 2017, 5, 10–15. [Google Scholar]
- Yaish, M.W.; Kumar, P.P. Salt tolerance research in date palm tree (Phoenix dactylifera L.), past, present and future perspectives. Front. Plant Sci. 2015, 6, 348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Farsi, M.A.; Lee, C.Y. Nutritional and functional properties of dates: A review. Crit. Rev. Food Sci. Nutr. 2008, 48, 877–887. [Google Scholar] [CrossRef] [PubMed]
- Abdullahi, M.; Garko, M. Medicinal value of date palm (Phoenix dactylifera L. In ). In Proceedings of the Agricultural Society of Nigeria Conference, Nsukka, Nigeria, 11–14 March 2012. [Google Scholar]
- Khalid, S.; Khalid, N.; Khan, R.S.; Ahmed, H.; Ahmad, A. A review on chemistry and pharmacology of Ajwa date fruit and pit. Trends Food Sci. Tech. 2017, 63, 60–69. [Google Scholar] [CrossRef]
- Salomón-Torres, R.; Ortiz-Uribe, N.; Valdez-Salas, B.; Rosas-González, N.; García-González, C.; Chávez, D.; Krueger, R. Nutritional assessment, phytochemical composition and antioxidant analysis of the pulp and seed of medjool date grown in Mexico. Peer J. 2019, 7, e6821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carpenter, J.B. Breeding of date palm in California. Date Grow. Inst. Rep. 1979, 54, 13–16. [Google Scholar]
- Aberlenc-Bertossi, F.; Daher, A.; Chabrillange, N.; Tregear, J.; Mohamed, N. Sex determination in date palm: New perspectives on an old theme. In Proceedings of the Plant and Animal Genomes XIX Conference, San Diego, CA, USA, 15–19 January 2011. [Google Scholar]
- Sarkar, S.; Banerjee, J.; Gantait, S. Sex-oriented research on dioecious crops of Indian subcontinent: An updated review. Biotechnol. J. 2017, 7, 93–109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heikrujam, M.; Sharma, K.; Prasad, M.; Agrawal, V. Review on different mechanisms of sex determination and sex-linked molecular markers in dioecious crops: A current update. Euphytica 2015, 201, 161–194. [Google Scholar] [CrossRef]
- Ageez, A.; Madboly, E.A. Identification of male specific molecular markers in date palm sewi cultivar. Egypt. J. Genet. Cytol. 2011, 40, 201–214. [Google Scholar] [CrossRef] [Green Version]
- Siljak-Yakovlev, S.; Cerbah, M.; Sarr, A.; Benmalek, S.; Bounaga, N.; Coba de la Pena, T.; Brown, S.C. Chromosomal sex determination and heterochromatin structure in date palm. Sex. Plant Reprod. 1996, 9, 127–132. [Google Scholar] [CrossRef]
- El-Kharbotly, A.; El-Mardi, M.; Al-Saadi, N.; Al-Maharuki, Y. Towards the construction of a genetic map of date palm using the amplified fragment length polymorphism technique (AFLP). In Proceedings of the First International Conference on Date Palm, Al-Ain, United Arab Emirates, 8–10 March 1998. [Google Scholar]
- Lohman, B.K.; Stutz, W.E.; Bolnick, D.I. Gene expression stasis and plasticity following migration into a foreign environment. Mol. Ecol. 2017, 26, 4657–4670. [Google Scholar] [CrossRef]
- Garson, J.; Grant, P.R.; Ayliffe, U.; Ferns, R.B.; Tedder, R.S. Real-time PCR quantitation of hepatitis B virus DNA using automated sample preparation and murine cytomegalovirus internal control. J. Virol. Methods 2005, 126, 207–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, S.L.; Xie, L.F.; Mao, H.Z.; Puah, C.S.; Yang, W.C.; Jiang, L.; Ye, D. Tapetum determinant1 is required for cell specialization in the Arabidopsis anther. Plant Cell 2003, 15, 2792–2804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, G.; Liu, X.; Owen, H.A.; Zhao, D. Signaling of cell fate determination by the TPD1 small protein and EMS1 receptor kinase. Proc. Natl. Acad. Sci. USA 2008, 105, 2220–2225. [Google Scholar] [CrossRef] [Green Version]
- Aboul-Maaty, N.A.F.; Oraby, H.A.S. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull. Natl. Res. Cent. 2019, 43, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Han, R. A method for extracting high-quality total RNA from plant rich in polysaccharides and polyphenols using Dendrobium huoshanense. PLoS ONE 2018, 13, e0196592. [Google Scholar] [CrossRef]
- Lorenz, T.C. Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. J. Vis. Exp. 2012, 63, e3998. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Armenteros, J.J.; Salvatore, A.; Emanuelsson, M.; Winther, O.; Von Heijne, G.; Elofsson, A.; Nielsen, H. Detecting sequence signals in targeting peptides using deep learning. Life Sci. Alliance 2019, 2, e201900429. [Google Scholar] [CrossRef] [Green Version]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Qacif, N.; Baaziz, M.; Bendiab, K. Biochemical investigations on peroxidase contents of male and female inflorescences of date palm (Phoenix dactylifera). Sci. Hortic. 2007, 114, 298–301. [Google Scholar] [CrossRef]
- Dhawan, C.; Kharb, P.; Sharma, R.; Uppal, S.; Aggarwal, R.K. Development of male-specific SCAR marker in date palm (Phoenix dactylifera L.). Tree Genet. Genomes 2013, 9, 1143–1150. [Google Scholar] [CrossRef]
- Torres, M.F.; Mathew, L.S.; Ahmed, I.; Al-Azwani, I.K.; Krueger, R.; Rivera-Nuñez, D.; Malek, J.A. Genus-wide sequencing supports a two-locus model for sex-determination in Phoenix. Nat. Commun. 2018, 9, 3969. [Google Scholar] [CrossRef] [Green Version]
- Mitsis, T.; Efthimiadou, A.; Bacopoulou, F.; Vlachakis, D.; Chrousos, G.P.; Eliopoulos, E. Transcription factors and evolution: An integral part of gene expression. World Acad. Sci. J. 2020, 2, 3–8. [Google Scholar] [CrossRef] [Green Version]
- Bekheet, S.A.; Hanafy, M.S. Towards sex determination of date palm. Arab J. Biotechnol. 2011, 26, 551–566. [Google Scholar]
- Al-Dous, E.K.; George, B.E.; Al-Mahmoud, M.; Al-Jaber, M.Y.; Wang, H.; Salameh, Y.M.; Al-Azwani, E.K.; Chaluvadi, S.R.; Pontaroli, A.C.; DeBarry, J. De novo genome sequencing and comparative genomics of date palm (Phoenix dactylifera). Nat. Biotechnol. 2011, 29, 521–527. [Google Scholar] [CrossRef] [PubMed]
- Al-Mahmoud, M.E.; Al-Dous, E.K.; Al-Azwani, E.K.; Malek, J.A. DNA-based assays to distinguish date palm (Arecaceae) gender. Am. J. Bot. 2012, 99, 7–10. [Google Scholar] [CrossRef]
- Elmeer, K.; Mattat, I. Marker-assisted sex differentiation in date palm using simple sequence repeats. Biotechnol. J. 2012, 2, 241–247. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Williams, R.; Prakash, C.S.; He, G. Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.). BMC Plant Biol. 2012, 12, 237. [Google Scholar] [CrossRef] [Green Version]
- Cherif, E.; Zehdi, S.; Castillo, K.; Chabrillange, N.; Abdoulkader, S.; Pintaud, J.C.; Santoni, S.; Salhi-Hannachi, A.; Glémin, S.; Aberlenc-Bertossi, F. Male-specific DNA markers provide genetic evidence of an XY chromosome system, a recombination arrest and allow the tracing of paternal lineages in date palm. New Phytol. 2013, 197, 409–415. [Google Scholar] [CrossRef]
- Wang, Y.; Ihase, L.O.; Htwe, Y.M.; Shi, P.; Zhang, D.; Li, D.; Iserhienrhien, A. Development of sex-linked SSR marker in the genus Phoenix and validation in P. dactylifera. Crop Sci. 2020, 60, 2452–2466. [Google Scholar] [CrossRef]
- Intha, N.; Chaiprasart, P. Sex determination in date palm (Phoenix dactylifera L.) by PCR based marker analysis. Sci. Hortic. 2018, 236, 251–255. [Google Scholar] [CrossRef]
- Khan, A.L.; Al-Harrasi, A.; Numan, M.; AbdulKareem, N.M.; Mabood, F.; Al-Rawahi, A. Spectroscopic and molecular methods to differentiate gender in immature date palm (Phoenix dactylifera L.). Plants 2021, 10, 536. [Google Scholar] [CrossRef]
- Jin, H.; Martin, C. Multifunctionality and diversity within the plant MYB-gene family. Plant Mol. Biol. 1999, 41, 577–585. [Google Scholar] [CrossRef] [PubMed]
- Li, S.F.; Higginson, T.; Parish, R.W. A novel MYB-related gene from Arabidopsis thaliana expressed in developing anthers. Plant Cell Physiol. 1999, 40, 343–347. [Google Scholar] [CrossRef] [Green Version]
- Albrecht, C.; Russinova, E.; Hecht, V.; Baaijens, E.; de Vries, S. The Arabidopsis thaliana somatic embryogenesis receptor-like kinases1 and 2 control male sporogenesis. Plant Cell 2005, 17, 3337–3349. [Google Scholar] [CrossRef] [Green Version]
Gene Abbreviation | Name of Gene and Accession No. | Primer Length (bp) | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|---|---|
Tapetum Determinant 1-Like | PdTPD1-like (>XM_026801684.2) | 152 | ATCGGACGCATCCACCTCAG | GAGTTGGCGTACTGGAAGGACA |
Site Name | Organism | Position Standard | Sequence | Function |
---|---|---|---|---|
ABRE | A. thaliana | +1030 | ACGTG | cis-acting component involved in abscisic acid responsiveness |
ABRE | Hordeum vulgare | +205 | CGCACGTGTC | cis-acting component involved in abscisic acid responsiveness |
ABRE | A. thaliana | +207 | CACGTG | cis-acting component involved in abscisic acid responsiveness |
ABRE | A. thaliana | +208 | ACGTG | cis-acting element involved in the abscisic acid responsiveness |
ABRE | A. thaliana | −547 | ACGTG | cis-acting component involved in abscisic acid responsiveness |
AE-box | A. thaliana | +1195 | AGAAACAA | part of a module for light response |
CAAT-box | P. sativum | +60 | CAAAT | common cis-acting element in promoter and enhancer regions |
CAAT-box | P. sativum | +139 | CAAAT | cis-acting component involved in abscisic acid responsiveness |
CAAT-box | N. glutinosa | +725 | CAAT | common cis-acting element in promoter and enhancer regions |
CGTCA-motif | H. vulgare | −285 | CGTCA | cis-acting regulatory element involved in the MeJA-responsiveness |
G-box | A. thaliana | +207 | CACGTG | cis-acting regulatory element involved in light responsiveness |
G-box | Zea mays | −479 | CACGAC | cis-acting regulatory element involved in light responsiveness |
GA-motif | A. thaliana | +763 | ATAGATAA | part of a light-responsive element |
GC-motif | Z. mays | −231 | CCCCCG | enhancer-like element involved in anoxic specific inducibility |
GC-motif | Z. mays | −371 | CCCCCG | enhancer-like element involved in anoxic specific inducibility |
LTR | H. vulgare | −76 | CCGAAA | cis-acting element involved in low-temperature responsiveness |
MBS | A. thaliana | +355 | CAACTG | MYB binding site involved in drought-inducibility |
Myb | A. thaliana | +355 | CAACTG | Stress inducubility |
Myc | A. thaliana | −1095 | TCTCTTA | Stress inducubility |
P-box | Oryza sativa | +611 | CCTTTTG | gibberellin-responsive element |
Sp1 | O. sativa | +416 | GGGCGG | Light-responsive element |
TGACG-motif | H. vulgare | +285 | TGACG | cis-acting regulatory element involved in the MeJA-responsiveness |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khanum, P.; Khan, A.A.; Khan, I.A.; Ghaffar, A.; Khan, Z. TPD1-like Gene as a Suitable Marker for Early Sex Determination in Date Palm (Phoenix dactylifera L.). Genes 2023, 14, 907. https://doi.org/10.3390/genes14040907
Khanum P, Khan AA, Khan IA, Ghaffar A, Khan Z. TPD1-like Gene as a Suitable Marker for Early Sex Determination in Date Palm (Phoenix dactylifera L.). Genes. 2023; 14(4):907. https://doi.org/10.3390/genes14040907
Chicago/Turabian StyleKhanum, Plosha, Asif Ali Khan, Iqrar Ahmad Khan, Abdul Ghaffar, and Zulqurnain Khan. 2023. "TPD1-like Gene as a Suitable Marker for Early Sex Determination in Date Palm (Phoenix dactylifera L.)" Genes 14, no. 4: 907. https://doi.org/10.3390/genes14040907
APA StyleKhanum, P., Khan, A. A., Khan, I. A., Ghaffar, A., & Khan, Z. (2023). TPD1-like Gene as a Suitable Marker for Early Sex Determination in Date Palm (Phoenix dactylifera L.). Genes, 14(4), 907. https://doi.org/10.3390/genes14040907