RNA-Seq Reveals the Roles of Long Non-Coding RNAs (lncRNAs) in Cashmere Fiber Production Performance of Cashmere Goats in China
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Isolation and RNA-Seq
2.3. RNA-Seq Data Processing and Screening of LncRNAs in Caprine Skin Tissue
2.4. Screening of Differentially Expressed LncRNAs and Validation of the RNA-Seq Results
2.5. Functional Enrichment Analysis of the Target Genes of Differentially Expressed LncRNAs and a Network Construction of LncRNA-mRNA
2.6. Prediction of Binding miRNAs of Seven LncRNAs Selected
3. Results
3.1. Overview of RNA-Seq Data
3.2. Screening and Expression of LncRNAs
3.3. Characteristic of LncRNAs
3.4. Differential Expression Analysis and Verification of LncRNAs
3.5. Function Enrichment Analysis of the Target Genes of Differentially Expressed LncRNAs
3.6. A LncRNA and mRNA Network
3.7. The Association Analysis of LncRNA with miRNA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McGregor, B.A.; Kerven, C.; Toigonbaev, S. Sources of variation affecting cashmere grown in the Pamir mountain districts of Tajikistan and implications for industry development. Small Ruminant Res. 2011, 99, 7–15. [Google Scholar] [CrossRef]
- Hui, T.Y.; Zheng, Y.Y.; Yue, C.; Wang, Y.R.; Bai, Z.X.; Sun, J.M.; Cai, W.D.; Zhang, X.J.; Bai, W.L.; Wang, Z.Y. Screening of cashmere fineness-related genes and their ceRNA network construction in cashmere goats. Sci. Rep. 2021, 11, 21977. [Google Scholar] [CrossRef]
- Wang, S.H.; Ge, W.; Luo, Z.X.; Guo, Y.; Jiao, B.L.; Qu, L.; Zhang, Z.Y.; Wang, X. Integrated analysis of coding genes and non-coding RNAs during hair follicle cycle of cashmere goat (Capra hircus). BMC Genom. 2017, 18, 767. [Google Scholar] [CrossRef]
- Guttman, M.; Rinn, J.L. Modular regulatory principles of large non-coding RNAs. Nature 2012, 482, 339–346. [Google Scholar] [CrossRef]
- Quinn, J.J.; Chang, H.Y. Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 2016, 17, 47–62. [Google Scholar] [CrossRef]
- Hao, Z.Y.; Luo, Y.Z.; Wang, J.Q.; Hu, J.; Liu, X.; Li, S.B.; Jin, X.Y.; Ke, N.; Zhao, M.L.; Hu, L.Y.; et al. RNA-seq reveals the expression profiles of long non-coding RNAs in lactating mammary gland from two sheep breeds with divergent milk phenotype. Animals 2020, 10, 1565. [Google Scholar] [CrossRef]
- Lv, X.Y.; Chen, W.H.; Sun, W.; Hussain, Z.; Wang, S.H.; Wang, J.Y. Analysis of lncRNAs expression profiles in hair follicle of Hu sheep lambskin. Animals 2020, 10, 1035. [Google Scholar] [CrossRef]
- Zheng, Y.Y.; Sheng, S.D.; Hui, T.Y.; Yue, C.; Sun, J.M.; Guo, D.; Guo, S.L.; Li, B.J.; Xue, H.L.; Wang, Z.Y.; et al. An integrated analysis of cashmere fineness lncRNAs in cashmere goats. Genes 2019, 10, 266. [Google Scholar] [CrossRef]
- Zhou, G.X.; Kang, D.J.; Ma, S.; Wang, X.T.; Gao, Y.; Yang, Y.X.; Wang, X.L.; Chen, Y.L. Integrative analysis reveals ncRNA-mediated molecular regulatory network driving secondary hair follicle regression in cashmere goats. BMC Genom. 2018, 19, 222. [Google Scholar] [CrossRef]
- Fu, X.F.; Zhao, B.R.; Tian, K.C.; Wu, Y.J.; Suo, L.D.; Ba, G.; Ciren, D.; De, J.; Awang, C.; Gun, S.B.; et al. Integrated analysis of lncRNA and mRNA reveals novel insights into cashmere fineness in Tibetan cashmere goats. Peer J. 2020, 8, e10217. [Google Scholar] [CrossRef]
- Bhat, B.; Singh, A.; Iqbal, Z.; Kaushik, J.K.; Rao, A.R.; Ahmad, S.M.; Bhat, H.; Ayaz, A.; Sheikh, F.D.; Kalra, S.; et al. Comparative transcriptome analysis reveals the genetic basis of coat color variation in Pashmina goat. Sci. Rep. 2019, 9, 6361. [Google Scholar] [CrossRef]
- Qin, Y.; Xu, Y.; Zhang, Y.; Gu, M.; Cai, W.D.; Bai, Z.X.; Zhang, X.J.; Chen, R.; Sun, Y.G.; Wu, Y.Z.; et al. Transcriptomics analysis of cashmere fineness functional genes. Anim. Biotechnol. 2022, 4, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.L. Analysis of Skin Transcriptome Profiling and Effect of KRTAP Genes on Cashmere Quality in Goats (in Chinese). Ph.D. Thesis, Gansu Agricultural University, LanZhou, China, 2021. [Google Scholar]
- Bao, G.L.; Li, S.B.; Zhao, F.F.; Wang, J.Q.; Liu, X.; Hu, J.; Shi, B.G.; Wen, Y.L.; Zhao, L.; Luo, Y.Z. Comprehensive transcriptome analysis reveals the role of lncRNA in fatty acid metabolism in the longissimus thoracis muscle of Tibetan sheep at different ages. Front. Nutr. 2022, 9, 847077. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.F.; Zhou, Y.Q.; Chen, Y.R.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. BioRxiv 2018, 34, 884–890. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 1, 357. [Google Scholar] [CrossRef]
- Sun, L.; Luo, H.T.; Bu, D.C.; Zhao, G.G.; Yu, K.T.; Zhang, C.H.; Liu, Y.N.; Chen, R.S.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, 166. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, 68–73. [Google Scholar] [CrossRef]
- Wu, Y.G.; Wei, B.; Liu, H.Z.; Li, T.X.; Rayner, S. MiRPara: A SVM-based software tool for prediction of most probable microRNA coding regions in genome scale sequences. BMC Bioinform. 2011, 12, 1. [Google Scholar] [CrossRef]
- Nie, Y.F.; Li, S.M.; Zheng, X.T.; Chen, W.S.; Li, X.E.; Liu, Z.W.; Hu, Y.; Qiao, H.S.; Qi, Q.S.; Pei, Q.B.; et al. Transcriptome reveals long non-coding RNAs and mRNAs involved in primary wool follicle induction in carpet sheep fetal skin. Front Physiol. 2018, 9, 446. [Google Scholar] [CrossRef]
- Li, X.B.; Liu, Z.F.; Ye, S.H.; Liu, Y.; Chen, Q.; Guan, W.J.; Pu, Y.B.; Jiang, L.; He, X.H.; Ma, Y.H.; et al. Integrated analysis of lncRNA and mRNA reveals novel insights into wool bending in zhongwei goat. Animals 2021, 11, 3326. [Google Scholar] [CrossRef]
- Virador, V.M.; Santis, C.; Furumura, M.; Kalbacher, H.; Hearing, V.J. Bioactive motifs of agouti signal protein. Exp Cell Res. 2000, 259, 54–63. [Google Scholar] [CrossRef]
- Xiong, Q.; Tao, H.; Zhang, N.; Zhang, L.; Wang, G.Q.; Li, X.F.; Suo, X.J.; Zhang, F.; Liu, Y.; Chen, M.X. Skin transcriptome profiles associated with black- and white-coated regions in Boer and Macheng black crossbred goats. Genomics 2020, 112, 1853–1860. [Google Scholar] [CrossRef]
- Li, Y.X.; Zhang, X.H.; Pang, Y.Z.; Qi, Y.X.; Zhao, S.J. Construction of MC1R and ASIP eukaryotic expression vector and its regulation of plumage color in Japanese quail (Coturnix japonica). J Poult Sci. 2019, 56, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Ren, H.X.; Wang, G.F.; Jiang, J.; Li, J.; Fu, L.; Liu, L.J.; Li, N.F.; Zhao, J.H.; Sun, X.Y.; Zhang, L.; et al. Comparative transcriptome and histological analyses provide insights into the prenatal skin pigmentation in goat (Capra hircus). Physiol. Genom. 2017, 49, 703–711. [Google Scholar] [CrossRef]
- Imokawa, G.; Kobayashi, T.; Miyagishi, M.; Higashi, K.; Yada, Y. The role of endothelin-1 in epidermal hyperpigmentation and signaling mechanisms of mitogenesis and melanogenesis. Pigment Cell Res. 1997, 10, 218–228. [Google Scholar] [CrossRef]
- Anello, M.; Fernández, E.; Daverio, M.S.; Vidal-Rioja, L.; Di Rocco, F. TYR gene in llamas: Polymorphisms and expression study in different color phenotypes. Front. Genet. 2019, 12, 568. [Google Scholar] [CrossRef]
- Hawkins, D.P.; Ragnarsdóttir, K.V. The Cu, Mn and Zn concentration of sheep wool: Influence of washing procedures.; age and colour of matrix. Sci. Total Environ. 2009, 407, 4140–4148. [Google Scholar] [CrossRef]
- Ancans, J.; Tobin, D.J.; Hoogduijn, M.J.; Smit, N.P.; Wakamatsu, K.; Thody, A.J. Melanosomal pH controls rate of melanogenesis, eumelanin/phaeomelanin ratio and melanosome maturation in melanocytes and melanoma cells. Exp. Cell Res. 2001, 268, 26–35. [Google Scholar] [CrossRef]
- Cruz, C.F.; Fernandes, M.M.; Gomes, A.C.; Coderch, L.; Martí, M.; Méndez, S.; Gales, L.; Azoia, N.G.; Shimanovich, U.; Cavaco-Paulo, A. Keratins and lipids in ethnic hair. Int. J. Cosmet. Sci. 2013, 35, 244–249. [Google Scholar] [CrossRef]
- Qi, Y.; Fu, S.; He, X.; Wang, B.; Liu, Y. Preliminary comparison of skin transcriptome from sheep with different wool fibre diameters. Anim. Prod. Sci. 2021, 61, 708–714. [Google Scholar] [CrossRef]
- Tan, Y.; Gan, M.L.; Fan, Y.; Li, L.; Zhong, Z.J.; Li, X.W.; Bai, L.; Zhao, Y.; Niu, L.; Shang, Y.S.; et al. miR-10b-5p regulates 3T3-L1 cells differentiation by targeting Apol6. Gene 2019, 687, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Pan, S.F.; Yang, X.J.; Jia, Y.M.; Li, R.S.; Zhao, R.Q. Microvesicle-shuttled miR-130b reduces fat deposition in recipient primary cultured porcine adipocytes by inhibiting PPAR-g expression. J. Cell Physiol. 2014, 229, 631–639. [Google Scholar] [CrossRef] [PubMed]
- Nie, L.; Pascoa, T.C.; Pike, A.C.W.; Bushell, S.R.; Quigley, A.; Ruda, G.F.; Chu, A.; Cole, V.; Speedman, D.; Moreira, T. The structural basis of fatty acid elongation by the ELOVL elongases. Nat. Struct. Mol. Biol. 2021, 28, 512–520. [Google Scholar] [CrossRef] [PubMed]
- Tu, Y.J.; Su, Y.J.H.; Li, G.H.; Zhang, Y.X.; Tong, H.B. Expression of lipid metabolism-associated genes in male and female white feather chicken. J. Poult. Sci. 2016, 53, 118–123. [Google Scholar] [CrossRef]
- Zhang, M.; Zheng, D.; Peng, Z.M.; Zhu, Y.T.; Li, R.R.; Wu, Q.; Li, Y.; Li, H.Y.; Xu, W.H.; Zhang, M.; et al. Identification of differentially expressed genes and lipid metabolism signaling pathways between muscle and fat tissues in broiler chickens. J. Poult. Sci. 2021, 58, 131–137. [Google Scholar] [CrossRef]
- Stelnicki, E.J.; Kömüves, L.G.; Kwong, A.O.; Holmes, D.; Klein, P.; Rozenfeld, S.; Lawrence, H.J.; Adzick, N.S.; Harrison, M.; Largman, C. HOX homeobox genes exhibit spatial and temporal changes in expression during human skin development. J. Investig. Dermatol. 1998, 110, 110–115. [Google Scholar] [CrossRef]
- Liu, N.; Bu, R.; He, J.; Cheng, M.; Liu, K.; Liu, J.; Zhao, J. Effects of HOX gene family on wool traits of fine-wool sheep. Chinese J. Anim. Sci. 2014, 50, 6–10. [Google Scholar]
- Yue, Y.J.; Guo, T.T.; Liu, J.B.; Guo, J.; Yuan, C.; Feng, R.L.; Niu, C.; Sun, X.P.; Yang, B.H. Exploring differentially expressed genes and natural antisense transcripts in sheep (ovis aries) skin with different wool fiber diameters by digital gene expression profiling. PLoS ONE 2015, 10, 129249. [Google Scholar] [CrossRef]
- Yue, Y.J.; Liu, J.B.; Yang, M.; Han, J.L.; Guo, T.T.; Guo, J.; Fen, R.L.; Yang, B.H. De novo assembly and characterization of skin transcriptome using RNAseq in sheep (ovis aries). Genet. Mol. Res. 2015, 14, 1371–1384. [Google Scholar] [CrossRef]
- Maneli, M.H.; Mkentane, K.; Khumalo, N.P. Lipid distribution and influence on hair structure. Int. J. Cosmet. Sci. 2013, 35, 523. [Google Scholar] [CrossRef] [PubMed]
- Fonollosa, J.; Campos, L.; Martí, M.; de la Maza, A.; Parra, J.L.; Coderch, L. X-ray diffraction analysis of internal wool lipids. Chem. Phys. Lipids. 2004, 130, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Paraskevopoulou, M.D.; Hatzigeorgiou, A.G. Analyzing MiRNA-LncRNA Interactions. Methods Mol. Biol. 2016, 1402, 271–286. [Google Scholar] [CrossRef] [PubMed]
- Hu, T.Y.; Huang, S.N.; Lv, X.Y.; Wang, S.H.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Sun, W. miR-143 Targeting CUX1 to Regulate Proliferation of Dermal Papilla Cells in Hu Sheep. Genes 2021, 12, 2017. [Google Scholar] [CrossRef]
- Ji, K.Y.; Zhang, P.Q.; Zhang, J.Z.; Fan, R.W.; Liu, Y.; Yang, S.S.; Hu, S.P.; Liu, X.X.; Dong, C.S. MicroRNA 143-5p regulates alpaca melanocyte migration, proliferation and melanogenesis. Exp. Dermatol. 2018, 27, 166–171. [Google Scholar] [CrossRef]
- Shang, F.Z.; Wang, Y.; Ma, R.; Rong, Y.J.; Wang, M.; Wu, Z.H.; Hai, E.; Pan, J.F.; Liang, L.L.; Wang, Z.Y.; et al. Screening of microRNA and mRNA related to secondary hair follicle morphogenesis and development and functional analysis in cashmere goats. Funct. Integr. Genom. 2022, 22, 835–848. [Google Scholar] [CrossRef]






| Name | Forward (5′→3′) | Reverse (5′→3′) | Amplicon Size (bp) |
|---|---|---|---|
| MSTRG.18612.3 | GTTGAAAAGAACTTTGAAGAGAGAG | CGGAGGGAGGGCGGGTGGAGGG | 180 |
| MSTRG.13442.1 | GTCCAGCTCTCTGCAACCCCGTGGA | CAGGAGATGTAGGCGACCC | 151 |
| MSTRG.12234.1 | TAACTGGTTAGTCTAATGGTCTGTT | GGTTCCAGGTCAATCCAG | 150 |
| MSTRG.18609.1 | CCAGTCAGTGTAGCGCGCGTGCAGC | CGATTCCGTGGGTGGTGGTGCA | 231 |
| MSTRG.18613.1 | GGGGCCGGCGGGGGACCGCCCCCCG | CGCGGCGACGAGGGCTGGCTC | 241 |
| MSTRG.300.17 | GCTGCCCTTTCCTGTAAGCA | GGTTGGGCAGAGAGACTCGT | 186 |
| MSTRG.2390.1 | GGCCTCAGTAGACAGTTGACAGGGT | TGAAGGATGACAGTGGGAAG | 245 |
| MSTRG.15153.3 | ATCACCTCCCGTTGTCTCTC | AGTTCAGCTTGGAGTGGGAC | 129 |
| MSTRG.12739.2 | CAGGGTTGGTTGAGCAGGCAGCTGG | GGAGCAAGTGGGAATGGGTA | 192 |
| GAPDH | ATCTCGCTCCTGGAAGATG | TCGGAGTGAACGGATTCG | 227 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, X.; Gu, Y.; Li, S.; Guo, S.; Wang, J.; Luo, Y.; Hu, J.; Liu, X.; Li, S.; Hao, Z.; et al. RNA-Seq Reveals the Roles of Long Non-Coding RNAs (lncRNAs) in Cashmere Fiber Production Performance of Cashmere Goats in China. Genes 2023, 14, 384. https://doi.org/10.3390/genes14020384
Wu X, Gu Y, Li S, Guo S, Wang J, Luo Y, Hu J, Liu X, Li S, Hao Z, et al. RNA-Seq Reveals the Roles of Long Non-Coding RNAs (lncRNAs) in Cashmere Fiber Production Performance of Cashmere Goats in China. Genes. 2023; 14(2):384. https://doi.org/10.3390/genes14020384
Chicago/Turabian StyleWu, Xinmiao, Yuanhua Gu, Shiqiang Li, Shiwei Guo, Jiqing Wang, Yuzhu Luo, Jiang Hu, Xiu Liu, Shaobin Li, Zhiyun Hao, and et al. 2023. "RNA-Seq Reveals the Roles of Long Non-Coding RNAs (lncRNAs) in Cashmere Fiber Production Performance of Cashmere Goats in China" Genes 14, no. 2: 384. https://doi.org/10.3390/genes14020384
APA StyleWu, X., Gu, Y., Li, S., Guo, S., Wang, J., Luo, Y., Hu, J., Liu, X., Li, S., Hao, Z., Li, M., & Shi, B. (2023). RNA-Seq Reveals the Roles of Long Non-Coding RNAs (lncRNAs) in Cashmere Fiber Production Performance of Cashmere Goats in China. Genes, 14(2), 384. https://doi.org/10.3390/genes14020384

