Whole-Genome Profile of Greek Patients with Teratozοοspermia: Identification of Candidate Variants and Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Selection of Patients and Biological Material
2.2. Sample Preparation and Whole-Genome Sequencing
2.3. Variant Prioritization
3. Results
3.1. Variant Calling and Annotation of WGS Data
3.2. High Impact Variants Identification
3.3. Moderate Impact Variant Identification
3.4. Gene Investigation and Enrichment Analysis
4. Discussion
4.1. Genes Associated with Male Infertility
4.2. Genes with Potential Role in Male Infertility and Teratozoospermia
4.3. The Special Case of BRCA2
4.4. The Role of Genes Associated with Cilia and Flagellum Malformation
4.5. The Role of the Extracellular Matrix in Teratozoospermia
4.6. Prioritized Variants’ Effect on Gene Expression
4.7. Directions for Future Studies
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zegers-Hochschild, F.; Adamson, G.D.; Dyer, S.; Racowsky, C.; de Mouzon, J.; Sokol, R.; Rienzi, L.; Sunde, A.; Schmidt, L.; Cooke, I.D.; et al. The International Glossary on Infertility and Fertility Care, 2017. Fertil. Steril. 2017, 108, 393–406. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Huangfu, C.; Li, J.; Liu, H.; Tang, N. Psychological Resilience as the Mediating Factor Between Stigma and Social Avoidance and Distress of Infertility Patients in China: A Structural Equation Modeling Analysis. Psychol. Res. Behav. Manag. 2022, 15, 391. [Google Scholar] [CrossRef] [PubMed]
- Slade, P.; O’Neill, C.; Simpson, A.J.; Lashen, H. The Relationship between Perceived Stigma, Disclosure Patterns, Support and Distress in New Attendees at an Infertility Clinic. Hum. Reprod. 2007, 22, 2309–2317. [Google Scholar] [CrossRef]
- Wu, A.K.; Odisho, A.Y.; Washington, S.L.; Katz, P.P.; Smith, J.F. Out-of-Pocket Fertility Patient Expense: Data from a Multicenter Prospective Infertility Cohort. J. Urol. 2014, 191, 427–432. [Google Scholar] [CrossRef] [PubMed]
- Inhorn, M.C.; Patrizio, P. Infertility around the Globe: New Thinking on Gender, Reproductive Technologies and Global Movements in the 21st Century. Hum. Reprod. Update 2015, 21, 411–426. [Google Scholar] [CrossRef]
- Agarwal, A.; Mulgund, A.; Hamada, A.; Chyatte, M.R. A Unique View on Male Infertility around the Globe. Reprod. Biol. Endocrinol. 2015, 13, 37. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, A.; Baskaran, S.; Parekh, N.; Cho, C.L.; Henkel, R.; Vij, S.; Arafa, M.; Panner Selvam, M.K.; Shah, R. Male Infertility. Lancet 2021, 397, 319–333. [Google Scholar] [CrossRef]
- Kothandaraman, N.; Agarwal, A.; Abu-Elmagd, M.; Al-Qahtani, M.H. Pathogenic Landscape of Idiopathic Male Infertility: New Insight towards Its Regulatory Networks. NPJ Genom. Med. 2016, 1, 16023. [Google Scholar] [CrossRef]
- Krausz, C.; Riera-Escamilla, A. Genetics of Male Infertility. Nat. Rev. Urol. 2018, 15, 369–384. [Google Scholar] [CrossRef]
- De Braekeleer, M.; Nguyen, M.H.; Morel, F.; Perrin, A. Genetic Aspects of Monomorphic Teratozoospermia: A Review. J. Assist. Reprod. Genet. 2015, 32, 615. [Google Scholar] [CrossRef] [Green Version]
- Spitzer, T.; Fujimoto, V. Ethnic Differences in Assisted Reproductive Technologies Outcomes. Semin. Reprod. Med. 2013, 31, 360–364. [Google Scholar] [CrossRef] [PubMed]
- Lawrenz, B.; Coughlan, C.; Melado, L.; Fatemi, H.M. Ethnical and Sociocultural Differences Causing Infertility Are Poorly Understood—Insights from the Arabian Perspective. J. Assist. Reprod. Genet. 2019, 36, 661. [Google Scholar] [CrossRef] [PubMed]
- Pierre, A.S.; Génin, E. How Important Are Rare Variants in Common Disease? Brief. Funct. Genomics 2014, 13, 353–361. [Google Scholar] [CrossRef]
- Yazdani, A.; Yazdani, A.; Liu, X.; Boerwinkle, E. Identification of Rare Variants in Metabolites of the Carnitine Pathway by Whole Genome Sequencing Analysis. Genet. Epidemiol. 2016, 40, 486. [Google Scholar] [CrossRef]
- Meienberg, J.; Bruggmann, R.; Oexle, K.; Matyas, G. Clinical Sequencing: Is WGS the Better WES? Hum. Genet. 2016, 135, 359–362. [Google Scholar] [CrossRef]
- Chandra, A.; Copen, C.E.; Stephen, E.H. Infertility and Impaired Fecundity in the United States, 1982-2010: Data from the National Survey of Family Growth. Natl. Health Stat. Rep. 2013, 67, 1–19. [Google Scholar]
- Skakkebaek, N.E.; Rajpert-De Meyts, E.; Buck Louis, G.M.; Toppari, J.; Andersson, A.M.; Eisenberg, M.L.; Jensen, T.K.; Jørgensen, N.; Swan, S.H.; Sapra, K.J.; et al. Male Reproductive Disorders and Fertility Trends: Influences of Environment and Genetic Susceptibility. Physiol. Rev. 2016, 96, 55–97. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Howe, K.L.; Achuthan, P.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Ridwan Amode, M.; Armean, I.M.; Azov, A.G.; Bennett, R.; Bhai, J.; et al. Ensembl 2021. Nucleic Acids Res. 2021, 49, D884–D891. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve Years of SAMtools and BCFtools. Gigascience 2021, 10, giab008. [Google Scholar] [CrossRef] [PubMed]
- Garrison, E.; Marth, G. Haplotype-Based Variant Detection from Short-Read Sequencing. arXiv 2012, arXiv:1207.3907. [Google Scholar]
- McCarthy, D.J.; Humburg, P.; Kanapin, A.; Rivas, M.A.; Gaulton, K.; Cazier, J.B.; Donnelly, P. Choice of Transcripts and Software Has a Large Effect on Variant Annotation. Genome Med. 2014, 6, 26. [Google Scholar] [CrossRef] [PubMed]
- Sherry, S.T.; Ward, M.H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E.M.; Sirotkin, K. DbSNP: The NCBI Database of Genetic Variation. Nucleic Acids Res. 2001, 29, 308. [Google Scholar] [CrossRef] [PubMed]
- Auton, A.; Abecasis, G.R.; Altshuler, D.M.; Durbin, R.M.; Bentley, D.R.; Chakravarti, A.; Clark, A.G.; Donnelly, P.; Eichler, E.E.; Flicek, P.; et al. A Global Reference for Human Genetic Variation. Nature 2015, 526, 68–74. [Google Scholar] [CrossRef]
- Gudmundsson, S.; Singer-Berk, M.; Watts, N.A.; Phu, W.; Goodrich, J.K.; Solomonson, M.; Rehm, H.L.; MacArthur, D.G.; O’Donnell-Luria, A. Variant Interpretation Using Population Databases: Lessons from GnomAD. Hum. Mutat. 2021, 43, 1012–1030. [Google Scholar] [CrossRef]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A Method and Server for Predicting Damaging Missense Mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef]
- Vaser, R.; Adusumalli, S.; Ngak Leng, S.; Sikic, M.; Ng, P.C. SIFT Missense Predictions for Genomes. Nat. Protoc. 2015, 11, 1–9. [Google Scholar] [CrossRef]
- Rentzsch, P.; Witten, D.; Cooper, G.M.; Shendure, J.; Kircher, M. CADD: Predicting the Deleteriousness of Variants throughout the Human Genome. Nucleic Acids Res. 2019, 47, D886–D894. [Google Scholar] [CrossRef]
- Reva, B.; Antipin, Y.; Sander, C. Predicting the Functional Impact of Protein Mutations: Application to Cancer Genomics. Nucleic Acids Res. 2011, 39, e118. [Google Scholar] [CrossRef]
- McLaren, W.; Pritchard, B.; Rios, D.; Chen, Y.; Flicek, P.; Cunningham, F. Deriving the Consequences of Genomic Variants with the Ensembl API and SNP Effect Predictor. Bioinformatics 2010, 26, 2069–2070. [Google Scholar] [CrossRef]
- Deboever, C.; Tanigawa, Y.; Lindholm, M.E.; McInnes, G.; Lavertu, A.; Ingelsson, E.; Chang, C.; Ashley, E.A.; Bustamante, C.D.; Daly, M.J.; et al. Medical Relevance of Protein-Truncating Variants across 337,205 Individuals in the UK Biobank Study. Nat. Commun. 2018, 9, 1612. [Google Scholar] [CrossRef] [Green Version]
- Rivas, M.A.; Pirinen, M.; Conrad, D.F.; Lek, M.; Tsang, E.K.; Karczewski, K.J.; Maller, J.B.; Kukurba, K.R.; DeLuca, D.S.; Fromer, M.; et al. Impact of Predicted Protein-Truncating Genetic Variants on the Human Transcriptome. Science 2015, 348, 666. [Google Scholar] [CrossRef] [PubMed]
- Kryukov, G.V.; Pennacchio, L.A.; Sunyaev, S.R. Most Rare Missense Alleles Are Deleterious in Humans: Implications for Complex Disease and Association Studies. Am. J. Hum. Genet. 2007, 80, 727–739. [Google Scholar] [CrossRef]
- Zeng, J.; Slodkowicz, G.; James, L.C. Rare Missense Variants in the Human Cytosolic Antibody Receptor Preserve Antiviral Function. Elife 2019, 8, e48339. [Google Scholar] [CrossRef] [PubMed]
- Lonsdale, J.; Thomas, J.; Salvatore, M.; Phillips, R.; Lo, E.; Shad, S.; Hasz, R.; Walters, G.; Garcia, F.; Young, N.; et al. The Genotype-Tissue Expression (GTEx) Project. Nat. Genet. 2013, 45, 580. [Google Scholar] [CrossRef]
- Anand, L.; Rodriguez Lopez, C.M. ChromoMap: An R package for interactive visualization of multi-omics data and annotation of chromosomes. BMC Bioinform. 2019, 23, 33. [Google Scholar] [CrossRef]
- Stelzer, G.; Rosen, N.; Plaschkes, I.; Zimmerman, S.; Twik, M.; Fishilevich, S.; Stein, T.I.; Nudel, R.; Lieder, I.; Mazor, Y.; et al. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr. Protoc. Bioinforma. 2016, 54, 1.30.1–1.30.33. [Google Scholar] [CrossRef] [PubMed]
- Farooq, Q.l.A.; Shaukat, Z.; Aiman, S.; Li, C.-H. Protein-Protein Interactions: Methods, Databases, and Applications in Virus-Host Study. World J. Virol. 2021, 10, 288–300. [Google Scholar] [CrossRef]
- Bateman, A.; Martin, M.J.; Orchard, S.; Magrane, M.; Agivetova, R.; Ahmad, S.; Alpi, E.; Bowler-Barnett, E.H.; Britto, R.; Bursteinas, B.; et al. UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [Google Scholar] [CrossRef]
- Bader, G.D.; Hogue, C.W. An Automated Method for Finding Molecular Complexes in Large Protein Interaction Networks. BMC Bioinform. 2003, 4, 2. [Google Scholar] [CrossRef]
- Roca, I.; Fernández-Marmiesse, A.; Gouveia, S.; Segovia, M.; Couce, M.L. Prioritization of Variants Detected by Next Generation Sequencing According to the Mutation Tolerance and Mutational Architecture of the Corresponding Genes. Int. J. Mol. Sci. 2018, 19, 1584. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Juhari, W.K.W.; Noordin, K.B.A.A.; Zakaria, A.D.; Rahman, W.F.W.A.; Mokhter, W.M.M.W.M.; Hassan, M.R.A.; Sidek, A.S.M.; Zilfalil, B.A. Whole-Genome Profiles of Malay Colorectal Cancer Patients with Intact Mmr Proteins. Genes 2021, 12, 1448. [Google Scholar] [CrossRef]
- Dashti, M.J.S.; Gamieldien, J. A Practical Guide to Filtering and Prioritizing Genetic Variants. Biotechniques 2017, 62, 18–30. [Google Scholar] [CrossRef] [PubMed]
- Stefl, S.; Nishi, H.; Petukh, M.; Panchenko, A.R.; Alexov, E. Molecular Mechanisms of Disease-Causing Missense Mutations. J. Mol. Biol. 2013, 425, 3919. [Google Scholar] [CrossRef] [PubMed]
- Tardif, S.; Cormier, N. Role of Zonadhesin during Sperm–Egg Interaction: A Species-Specific Acrosomal Molecule with Multiple Functions. Mol. Hum. Reprod. 2011, 17, 661–668. [Google Scholar] [CrossRef]
- Ebert, B.; Kisiela, M.; Maser, E. Human DCXR—Another “moonlighting Protein” Involved in Sugar Metabolism, Carbonyl Detoxification, Cell Adhesion and Male Fertility? Biol. Rev. Camb. Philos. Soc. 2015, 90, 254–278. [Google Scholar] [CrossRef]
- Sabetian, S.; Shamsir, M.S. Systematic Analysis of Protein Interaction Network Associated with Azoospermia. Int. J. Mol. Sci. 2016, 17, 1857. [Google Scholar] [CrossRef]
- Da Ros, M.; Lehtiniemi, T.; Olotu, O.; Fischer, D.; Zhang, F.P.; Vihinen, H.; Jokitalo, E.; Sironen, A.; Toppari, J.; Kotaja, N. FYCO1 and Autophagy Control the Integrity of the Haploid Male Germ Cell-Specific RNP Granules. Autophagy 2017, 13, 302–321. [Google Scholar] [CrossRef]
- Omolaoye, T.S.; Omolaoye, V.A.; Kandasamy, R.K.; Hachim, M.Y.; Du Plessis, S.S. Omics and Male Infertility: Highlighting the Application of Transcriptomic Data. Life 2022, 12, 280. [Google Scholar] [CrossRef]
- Jamsai, D.; Sarraj, M.A.; Merriner, D.J.; Drummond, A.E.; Jones, K.T.; McLachlan, R.I.; O’Bryan, M.K. GGN1 in the Testis and Ovary and Its Variance within the Australian Fertile and Infertile Male Population. Int. J. Androl. 2011, 34, 624–632. [Google Scholar] [CrossRef] [PubMed]
- Moretti, E.; Vindigni, C.; Tripodi, S.A.; Mazzi, L.; Nuti, R.; Figura, N.; Collodel, G. Immunolocalisation of Ghrelin and Obestatin in Human Testis, Seminal Vesicles, Prostate and Spermatozoa. Andrologia 2014, 46, 979–985. [Google Scholar] [CrossRef] [PubMed]
- Moretti, E.; Collodel, G.; Iacoponi, F.; Geminiani, M.; Pascarelli, N.A.; Campagna, S.; Franci, B.; Figura, N. Detection of Obestatin in Seminal Plasma and Its Relationship with Ghrelin and Semen Parameters. Fertil. Steril. 2011, 95, 2303–2309. [Google Scholar] [CrossRef] [PubMed]
- Lachance, C.; Leclerc, P. Mediators of the Jak/STAT Signaling Pathway in Human Spermatozoa. Biol. Reprod. 2011, 85, 1222–1231. [Google Scholar] [CrossRef] [PubMed]
- Sagare-Patil, V.; Modi, D. Progesterone Activates Janus Kinase 1/2 and Activators of Transcription 1 (JAK1-2/STAT1) Pathway in Human Spermatozoa. Andrologia 2013, 45, 178–186. [Google Scholar] [CrossRef] [PubMed]
- Malm, J.; Nordahl, E.A.; Bjartell, A.; Sørensen, O.E.; Frohm, B.; Dentener, M.A.; Egesten, A. Lipopolysaccharide-Binding Protein Is Produced in the Epididymis and Associated with Spermatozoa and Prostasomes. J. Reprod. Immunol. 2005, 66, 33–43. [Google Scholar] [CrossRef]
- D’Cruz, O.J.; Vassilev, A.O.; Uckun, F.M. Members of the Janus Kinase/Signal Transducers and Activators of Transcription (JAK/STAT) Pathway Are Present and Active in Human Sperm. Fertil. Steril. 2001, 76, 258–266. [Google Scholar] [CrossRef]
- Ni, K.; Dansranjavin, T.; Rogenhofer, N.; Oeztuerk, N.; Deuker, J.; Bergmann, M.; Schuppe, H.C.; Wagenlehner, F.; Weidner, W.; Steger, K.; et al. TET Enzymes Are Successively Expressed during Human Spermatogenesis and Their Expression Level Is Pivotal for Male Fertility. Hum. Reprod. 2016, 31, 1411–1424. [Google Scholar] [CrossRef]
- White-Cooper, H.; Bausek, N. Evolution and Spermatogenesis. Philos. Trans. R. Soc. B Biol. Sci. 2010, 365, 1465. [Google Scholar] [CrossRef]
- Kobayashi, K.; Endo, T.; Matsumura, T.; Lu, Y.; Yu, Z.; Matzuk, M.M.; Ikawa, M. Prss55 but Not Prss51 Is Required for Male Fertility in Mice. Biol. Reprod. 2020, 103, 223–234. [Google Scholar] [CrossRef]
- Shang, X.; Shen, C.; Liu, J.; Tang, L.; Zhang, H.; Wang, Y.; Wu, W.; Chi, J.; Zhuang, H.; Fei, J.; et al. Serine Protease PRSS55 Is Crucial for Male Mouse Fertility via Affecting Sperm Migration and Sperm-Egg Binding. Cell. Mol. Life Sci. 2018, 75, 4371–4384. [Google Scholar] [CrossRef] [PubMed]
- Marjanović, M.; Sánchez-Huertas, C.; Terré, B.; Gómez, R.; Scheel, J.F.; Pacheco, S.; Knobel, P.A.; Martínez-Marchal, A.; Aivio, S.; Palenzuela, L.; et al. CEP63 Deficiency Promotes P53-Dependent Microcephaly and Reveals a Role for the Centrosome in Meiotic Recombination. Nat. Commun. 2015, 6, 7676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Geng, Q.; Ni, L.; Ouyang, B.; Hu, Y.; Zhao, Y.; Guo, J. A Novel Testis-Specific Gene, Ccdc136, Is Required for Acrosome Formation and Fertilization in Mice. Reprod. Sci. 2016, 23, 1387–1396. [Google Scholar] [CrossRef] [PubMed]
- Zakrzewski, P.; Suwińska, A.; Lenartowski, R.; Rȩdowicz, M.J.; Buss, F.; Lenartowska, M. Myosin VI Maintains the Actin-Dependent Organization of the Tubulobulbar Complexes Required for Endocytosis during Mouse Spermiogenesis. Biol. Reprod. 2020, 102, 863. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zheng, J.; Li, G.; Lin, Z.; Li, D.; Liu, D.; Feng, H.; Cao, D.; Ng, E.H.Y.; Li, R.H.W.; et al. The Male Germline-Specific Protein MAPS Is Indispensable for Pachynema Progression and Fertility. Proc. Natl. Acad. Sci. USA 2021, 118, e2025421118. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Yang, Y.; Ji, X.; He, W.; Fan, J.; Huang, Y.; Wang, Y. NGF Rescues Spermatogenesis in Azoospermic Mice. Reprod. Sci. 2021, 28, 2780–2788. [Google Scholar] [CrossRef] [PubMed]
- Yeh, C.H.; Kuo, P.L.; Wang, Y.Y.; Wu, Y.Y.; Chen, M.F.; Lin, D.Y.; Lai, T.H.; Chiang, H.S.; Lin, Y.H. SEPT12/SPAG4/LAMINB1 Complexes Are Required for Maintaining the Integrity of the Nuclear Envelope in Postmeiotic Male Germ Cells. PLoS ONE 2015, 10, e0120722. [Google Scholar] [CrossRef]
- Yang, K.; Adham, I.M.; Meinhardt, A.; Hoyer-Fender, S. Ultra-Structure of the Sperm Head-to-Tail Linkage Complex in the Absence of the Spermatid-Specific LINC Component SPAG4. Histochem. Cell Biol. 2018, 150, 49–59. [Google Scholar] [CrossRef]
- Horvath, A.; Korde, L.; Greene, M.H.; Libe, R.; Osorio, P.; Faucz, F.R.; Raffin-Sanson, M.L.; Kit, M.T.; Drori-Herishanu, L.; Patronas, Y.; et al. Functional Phosphodiesterase 11A Mutations May Modify the Risk of Familial and Bilateral Testicular Germ Cell Tumors. Cancer Res. 2009, 69, 5301–5306. [Google Scholar] [CrossRef]
- Wayman, C.; Phillips, S.; Lunny, C.; Webb, T.; Fawcett, L.; Baxendale, R.; Burgess, G. Phosphodiesterase 11 (PDE11) Regulation of Spermatozoa Physiology. Int. J. Impot. Res. 2005, 17, 216–223. [Google Scholar] [CrossRef]
- Yap, Y.T.; Li, Y.H.; Li, W.; Banerjee, P.; Zhang, Z. ATP8a1, an IFT27 Binding Partner, Is Dispensable for Spermatogenesis and Male Fertility. Mol. Reprod. Dev. 2021, 88, 371–375. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, H.; Li, W.; Zhang, Z.; Shang, X.; Zhang, D.; Li, Y.; Zhang, S.; Liu, J.; Hess, R.A.; et al. Intraflagellar Transporter Protein (IFT27), an IFT25 Binding Partner, Is Essential for Male Fertility and Spermiogenesis in Mice. Dev. Biol. 2017, 432, 125–139. [Google Scholar] [CrossRef] [PubMed]
- Fouchecourt, S.; Livera, G.; Messiaen, S.; Fumel, B.; Parent, A.S.; Marine, J.C.; Monget, P. Apoptosis of Sertoli Cells after Conditional Ablation of Murine Double Minute 2 (Mdm2) Gene Is P53-Dependent and Results in Male Sterility. Cell Death Differ. 2016, 23, 521–530. [Google Scholar] [CrossRef] [PubMed]
- Tomar, A.K.; Rajak, S.K.; Aslam MK, M.; Chhikara, N.; Ojha, S.K.; Nayak, S.; Chhillar, S.; Kumaresan, A.; Yadav, S. Sub-Fertility in Crossbred Bulls: Identification of Proteomic Alterations in Spermatogenic Cells Using High Throughput Comparative Proteomics Approach. Theriogenology 2021, 169, 65–75. [Google Scholar] [CrossRef]
- Zhao, S.; Chen, T.; Luo, X.; Chen, S.; Wang, J.; Lai, S.; Jia, X. Identification of Novel LncRNA and Differentially Expressed Genes (DEGs) of Testicular Tissues among Cattle, Yak, and Cattle-Yak Associated with Male Infertility. Animals 2021, 11, 2420. [Google Scholar] [CrossRef]
- Zhao, W.; Mengal, K.; Yuan, M.; Quansah, E.; Li, P.; Wu, S.; Xu, C.; Yi, C.; Cai, X. Comparative RNA-Seq Analysis of Differentially Expressed Genes in the Epididymides of Yak and Cattleyak. Curr. Genom. 2019, 20, 293–305. [Google Scholar] [CrossRef]
- Zhao, Y.; Gao, N.; Li, X.; El-Ashram, S.; Wang, Z.; Zhu, L.; Jiang, W.; Peng, X.; Zhang, C.; Chen, Y.; et al. Identifying Candidate Genes Associated with Sperm Morphology Abnormalities Using Weighted Single-Step GWAS in a Duroc Boar Population. Theriogenology 2020, 141, 9–15. [Google Scholar] [CrossRef]
- Cui, Y.; Zhang, Y.; Wei, Z.; Gao, J.; Yu, T.; Chen, R.; Lv, X.; Pan, C. Pig KDM5B: MRNA Expression Profiles of Different Tissues and Testicular Cells and Association Analyses with Testicular Morphology Traits. Gene 2018, 650, 27–33. [Google Scholar] [CrossRef]
- Häger, M.; Gawlik, K.; Nyström, A.; Sasaki, T.; Durbeej, M. Laminin {α}1 Chain Corrects Male Infertility Caused by Absence of Laminin {α}2 Chain. Am. J. Pathol. 2005, 167, 823–833. [Google Scholar] [CrossRef]
- Sha, Y.; Xu, Y.; Wei, X.; Liu, W.; Mei, L.; Lin, S.; Ji, Z.; Wang, X.; Su, Z.; Qiu, P.; et al. CCDC9 Is Identified as a Novel Candidate Gene of Severe Asthenozoospermia. Syst. Biol. Reprod. Med. 2019, 65, 465–473. [Google Scholar] [CrossRef]
- Pasek, R.C.; Malarkey, E.; Berbari, N.F.; Sharma, N.; Kesterson, R.A.; Tres, L.L.; Kierszenbaum, A.L.; Yoder, B.K. Coiled-Coil Domain Containing 42 (Ccdc42) Is Necessary for Proper Sperm Development and Male Fertility in the Mouse. Dev. Biol. 2016, 412, 208–218. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Yin, Q.; Ma, X.; Tong, M.H.; Zhou, Y. Ccdc87 Is Critical for Sperm Function and Male Fertility. Biol. Reprod. 2018, 99, 817–827. [Google Scholar] [CrossRef]
- Cunha, S.R.; Mohler, P.J. Ankyrin Protein Networks in Membrane Formation and Stabilization. J. Cell. Mol. Med. 2009, 13, 4364–4376. [Google Scholar] [CrossRef] [PubMed]
- Manfrevola, F.; Martinez, G.; Coutton, C.; Rocco, D.; Reynaud, K.; Le Vern, Y.; Froment, P.; Beauclair, L.; Aubert, D.; Pierantoni, R.; et al. Ankrd31 in Sperm and Epididymal Integrity. Front. Cell Dev. Biol. 2021, 9, 741975. [Google Scholar] [CrossRef] [PubMed]
- Liu, F.J.; Liu, X.X.; Liu, X.; Li, T.; Zhu, P.; Liu, Z.Y.; Xue, H.; Wang, W.J.; Yang, X.L.; Liu, J.; et al. Integrated Analyses of Phenotype and Quantitative Proteome of CMTM4 Deficient Mice Reveal Its Association with Male Fertility. Mol. Cell. Proteom. 2019, 18, 1070–1084. [Google Scholar] [CrossRef] [PubMed]
- Luconi, M.; Cantini, G.; Baldi, E.; Forti, G. Role of A-Kinase Anchoring Proteins (AKAPs) in Reproduction. Front. Biosci. 2011, 16, 1315–1330. [Google Scholar] [CrossRef]
- Audet-Walsh, É.; Bellemare, J.; Lacombe, L.; Fradet, Y.; Fradet, V.; Douville, P.; Guillemette, C.; Lévesque, É. The Impact of Germline Genetic Variations in Hydroxysteroid (17-β) Dehydrogenases on Prostate Cancer Outcomes After Prostatectomy. Eur. Urol. 2012, 62, 88–96. [Google Scholar] [CrossRef]
- LaVoie, H.A. The Role of GATA in Mammalian Reproduction. Exp. Biol. Med. 2003, 228, 1282–1290. [Google Scholar] [CrossRef]
- Emami, N.; Diamandis, E.P. Potential Role of Multiple Members of the Kallikrein-Related Peptidase Family of Serine Proteases in Activating Latent TGF β 1 in Semen. Biol. Chem. 2010, 391, 85–95. [Google Scholar] [CrossRef]
- Emami, N.; Scorilas, A.; Soosaipillai, A.; Earle, T.; Mullen, B.; Diamandis, E.P. Association between Kallikrein-Related Peptidases (KLKs) and Macroscopic Indicators of Semen Analysis: Their Relation to Sperm Motility. Biol. Chem. 2009, 390, 921–929. [Google Scholar] [CrossRef]
- Fardilha, M.; Esteves, S.L.C.; Korrodi-Gregório, L.; Vintém, A.P.; Domingues, S.C.; Rebelo, S.; Morrice, N.; Cohen, P.T.W.; Da Cruz E Silva, O.A.B.; Da Cruz E Silva, E.F. Identification of the Human Testis Protein Phosphatase 1 Interactome. Biochem. Pharmacol. 2011, 82, 1403–1415. [Google Scholar] [CrossRef] [PubMed]
- Zhoucun, A.; Zhang, S.; Yang, Y.; Ma, Y.; Zhang, W.; Lin, L. The Common Variant N372H in BRCA2 Gene May Be Associated with Idiopathic Male Infertility with Azoospermia or Severe Oligozoospermia. Eur. J. Obstet. Gynecol. Reprod. Biol. 2006, 124, 61–64. [Google Scholar] [CrossRef] [PubMed]
- Ji, G.; Yan, L.; Liu, W.; Huang, C.; Gu, A.; Wang, X. Polymorphisms in Double-Strand Breaks Repair Genes Are Associated with Impaired Fertility in Chinese Population. Reproduction 2013, 145, 463–470. [Google Scholar] [CrossRef] [PubMed]
- Ghasemi, H.; Khodadadi, I.; Fattahi, A.; Moghimbeigi, A.; Tavilani, H. Polymorphisms of DNA Repair Genes XRCC1 and LIG4 and Idiopathic Male Infertility. Syst. Biol. Reprod. Med. 2017, 63, 382–390. [Google Scholar] [CrossRef] [PubMed]
- Brandsma, I.; Sato, K.; van Rossum-Fikkert, S.E.; van Vliet, N.; Sleddens, E.; Reuter, M.; Odijk, H.; van den Tempel, N.; Dekkers, D.H.W.; Bezstarosti, K.; et al. HSF2BP Interacts with a Conserved Domain of BRCA2 and Is Required for Mouse Spermatogenesis. Cell Rep. 2019, 27, 3790–3798.e7. [Google Scholar] [CrossRef] [PubMed]
- Tu, C.; Cong, J.; Zhang, Q.; He, X.; Zheng, R.; Yang, X.; Gao, Y.; Wu, H.; Lv, M.; Gu, Y.; et al. Bi-Allelic Mutations of DNAH10 Cause Primary Male Infertility with Asthenoteratozoospermia in Humans and Mice. Am. J. Hum. Genet. 2021, 108, 1466–1477. [Google Scholar] [CrossRef]
- Gao, Y.; Tian, S.; Sha, Y.; Zha, X.; Cheng, H.; Wang, A.; Liu, C.; Lv, M.; Ni, X.; Li, Q.; et al. Novel Bi-Allelic Variants in DNAH2 Cause Severe Asthenoteratozoospermia with Multiple Morphological Abnormalities of the Flagella. Reprod. Biomed. Online 2021, 42, 963–972. [Google Scholar] [CrossRef] [PubMed]
- Zhu, D.; Zhang, H.; Wang, R.; Liu, X.; Jiang, Y.; Feng, T.; Liu, R.; Zhang, G. Association of DNAH11 Gene Polymorphisms with Asthenozoospermia in Northeast Chinese Patients. Biosci. Rep. 2019, 39, 20181450. [Google Scholar] [CrossRef]
- Lu, S.; Gu, Y.; Wu, Y.; Yang, S.; Li, C.; Meng, L.; Yuan, W.; Jiang, T.; Zhang, X.; Li, Y.; et al. Bi-Allelic Variants in Human WDR63 Cause Male Infertility via Abnormal Inner Dynein Arms Assembly. Cell Discov. 2021, 7, 110. [Google Scholar] [CrossRef]
- King, S.M. Axonemal Dynein Arms. Cold Spring Harb. Perspect. Biol. 2016, 8, a028100. [Google Scholar] [CrossRef]
- Nielsen, M.G.; Turner, F.R.; Hutchens, J.A.; Raff, E.C. Axoneme-Specific β-Tubulin Specialization: A Conserved C-terminal Motif Specifies the Central Pair. Curr. Biol. 2001, 11, 529–533. [Google Scholar] [CrossRef]
- Kollmar, M. Fine-Tuning Motile Cilia and Flagella: Evolution of the Dynein Motor Proteins from Plants to Humans at High Resolution. Mol. Biol. Evol. 2016, 33, 3249–3267. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sironen, A.; Shoemark, A.; Patel, M.; Loebinger, M.R.; Mitchison, H.M. Sperm Defects in Primary Ciliary Dyskinesia and Related Causes of Male Infertility. Cell. Mol. Life Sci. 2020, 77, 2029. [Google Scholar] [CrossRef]
- Pazour, G.J.; Agrin, N.; Walker, B.L.; Witman, G.B. Identification of Predicted Human Outer Dynein Arm Genes: Candidates for Primary Ciliary Dyskinesia Genes. J. Med. Genet. 2006, 43, 62–73. [Google Scholar] [CrossRef] [PubMed]
- Ben Khelifa, M.; Coutton, C.; Zouari, R.; Karaouzène, T.; Rendu, J.; Bidart, M.; Yassine, S.; Pierre, V.; Delaroche, J.; Hennebicq, S.; et al. Mutations in DNAH1, Which Encodes an Inner Arm Heavy Chain Dynein, Lead to Male Infertility from Multiple Morphological Abnormalities of the Sperm Flagella. Am. J. Hum. Genet. 2014, 94, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Fassad, M.R.; Shoemark, A.; Legendre, M.; Hirst, R.A.; Koll, F.; le Borgne, P.; Louis, B.; Daudvohra, F.; Patel, M.P.; Thomas, L.; et al. Mutations in Outer Dynein Arm Heavy Chain DNAH9 Cause Motile Cilia Defects and Situs Inversus. Am. J. Hum. Genet. 2018, 103, 984–994. [Google Scholar] [CrossRef]
- Sha, Y.; Yang, X.; Mei, L.; Ji, Z.; Wang, X.; Ding, L.; Li, P.; Yang, S. DNAH1 Gene Mutations and Their Potential Association with Dysplasia of the Sperm Fibrous Sheath and Infertility in the Han Chinese Population. Fertil. Steril. 2017, 107, 1312–1318.e2. [Google Scholar] [CrossRef]
- Wiedemann, I.; Maehlmeyer, A.; Jansen, S.; Sharifi, A.R.; Knorr, C. SNP g.1007A>G within the Porcine DNAL4 Gene Affects Sperm Motility Traits and Percentage of Midpiece Abnormalities. Reprod. Domest. Anim. 2018, 53, 401–413. [Google Scholar] [CrossRef]
- Shi, L.; Zhou, T.; Huang, Q.; Zhang, S.; Li, W.; Zhang, L.; Hess, R.A.; Pazour, G.J.; Zhang, Z. Intraflagellar Transport Protein 74 Is Essential for Spermatogenesis and Male Fertility in Mice. Biol. Reprod. 2019, 101, 188–199. [Google Scholar] [CrossRef]
- Wambergue, C.; Zouari, R.; Fourati Ben Mustapha, S.; Martinez, G.; Devillard, F.; Hennebicq, S.; Satre, V.; Brouillet, S.; Halouani, L.; Marrakchi, O.; et al. Patients with Multiple Morphological Abnormalities of the Sperm Flagella Due to DNAH1 Mutations Have a Good Prognosis Following Intracytoplasmic Sperm Injection. Hum. Reprod. 2016, 31, 1164–1172. [Google Scholar] [CrossRef]
- Siu, M.K.Y.; Yan Cheng, C. Extracellular Matrix and Its Role in Spermatogenesis. Adv. Exp. Med. Biol. 2008, 636, 74. [Google Scholar] [CrossRef] [PubMed]
- Siu, M.K.Y.; Cheng, C.Y. Dynamic Cross-Talk between Cells and the Extracellular Matrix in the Testis. BioEssays 2004, 26, 978–992. [Google Scholar] [CrossRef] [PubMed]
- Lui, W.Y.; Lee, W.M. Regulation of Junction Dynamics in the Testis—Transcriptional and Post-Translational Regulations of Cell Junction Proteins. Mol. Cell. Endocrinol. 2006, 250, 25–35. [Google Scholar] [CrossRef]
- Lehmann, D.; Temminck, B.; Da Rugna, D.; Leibundgut, B.; Sulmoni, A.; Müller, H. Role of Immunological Factors in Male Infertility. Immunohistochemical and Serological Evidence. Lab. Invest. 1987, 57, 21–28. [Google Scholar]
- Sala-Newby, G.B.; Newby, A.C. Cloning of a Mouse Cytosolic 5′-Nucleotidase-I Identifies a New Gene Related to Human Autoimmune Infertility-Related Protein. Biochim. Biophys. Acta 2001, 1521, 12–18. [Google Scholar] [CrossRef]
- Hodge, S.H.; Watts, A.; Marley, R.; Baines, R.A.; Hafen, E.; MacDougall, L.K. Twitchy, the Drosophila Orthologue of the Ciliary Gating Protein FBF1/Dyf-19, Is Required for Coordinated Locomotion and Male Fertility. Biol. Open 2021, 10, bio058531. [Google Scholar] [CrossRef]
- Soini, S.; Ibarreta, D.; Anastasiadou, V.; Aymé, S.; Braga, S.; Cornel, M.; Coviello, D.A.; Evers-Kiebooms, G.; Geraedts, J.; Gianaroli, L.; et al. The Interface between Assisted Reproductive Technologies and Genetics: Technical, Social, Ethical and Legal Issues. Eur. J. Hum. Genet. 2006, 14, 588–645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Demographics | Normozoospermic (n = 10) | Teratozoospermic (n = 5) |
---|---|---|
Age | 28–53 Mean = 36 | 31–49 Mean = 38 |
BMI | 19.5–40.4 Mean = 26.97 | 24.8–33 Mean = 29.24 |
Smoking | 30% Not Smoking, 70% Smoking | 60% Not Smoking, 40% Smoking |
Alcohol | 100% ≤ 2 drinks/week | 80% ≤ 2 drinks/week |
Drug Use | 75% No | 80% No |
Nationality | Greek | Greek |
Variant | Gene | Ref | Obs | Frequency (Europe) | Type of Mutation |
---|---|---|---|---|---|
rs11571833 | BRCA2 | A | Τ | 0.011 | Nonsense |
rs766173 | BRCA2 | A | C | 0.035 | Missense |
- (7:55621478-55621503) | VOPP1 | ACACACACACACACACACACACTCAC | CAC | - | Splice Disrupting |
rs201023957 | VOPP1 | C | T | 0.000471 (gnomAD) | Missense |
KEGG Enrichment Analysis | ||||
---|---|---|---|---|
Enrichment FDR | Number of Genes | Pathway Genes | Fold Enrichment | Pathways |
0.0220 | 6 | 88 | 7.7 | ECM–receptor interaction |
Enriched Annotated Keywords According to Uniprot | |||
---|---|---|---|
Description term | Count in network | Strength | FDR |
Coiled Coil | 43 of 2139 | 0.290 | 0.0114 |
Cluster 2 | |
RIOK2 | RIO Kinase 2 |
MPHOSPH10 | M-Phase Phosphoprotein 10 |
RPP40 | Ribonuclease P/MRP Subunit P40 |
UTP20 | UTP20 Small Subunit Processome Component |
Cluster 3 | |
NT5C1B | 5′-Nucleotidase, Cytosolic IB |
NT5C1B-RDH14 | NT5C1B-RDH14 Readthrough |
PDE11A | Phosphodiesterase 11A |
Variant | Gene | Tissues |
---|---|---|
rs61742596 | NT5C1B | Testis |
rs61742596 | NT5C1B-RDH14 | Testis |
rs61095568 | MADCAM1 | Testis |
rs78440807 | UTP20 | Testis |
rs113062332 | FBF1 | Testis |
rs112138627 | GGN | Testis |
rs77267061 | ZNF559 | Testis |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kyrgiafini, M.-A.; Giannoulis, T.; Chatziparasidou, A.; Christoforidis, N.; Mamuris, Z. Whole-Genome Profile of Greek Patients with Teratozοοspermia: Identification of Candidate Variants and Genes. Genes 2022, 13, 1606. https://doi.org/10.3390/genes13091606
Kyrgiafini M-A, Giannoulis T, Chatziparasidou A, Christoforidis N, Mamuris Z. Whole-Genome Profile of Greek Patients with Teratozοοspermia: Identification of Candidate Variants and Genes. Genes. 2022; 13(9):1606. https://doi.org/10.3390/genes13091606
Chicago/Turabian StyleKyrgiafini, Maria-Anna, Themistoklis Giannoulis, Alexia Chatziparasidou, Nikolaos Christoforidis, and Zissis Mamuris. 2022. "Whole-Genome Profile of Greek Patients with Teratozοοspermia: Identification of Candidate Variants and Genes" Genes 13, no. 9: 1606. https://doi.org/10.3390/genes13091606
APA StyleKyrgiafini, M.-A., Giannoulis, T., Chatziparasidou, A., Christoforidis, N., & Mamuris, Z. (2022). Whole-Genome Profile of Greek Patients with Teratozοοspermia: Identification of Candidate Variants and Genes. Genes, 13(9), 1606. https://doi.org/10.3390/genes13091606