Molecular Characterization of UDP-N-Acetylglucosamine Pyrophosphorylase and Its Role in the Growth and Development of the White-Backed Planthopper Sogatella furcifera (Hemiptera: Delphacidae)
Abstract
1. Introduction
2. Materials and Methods
2.1. Rearing S. furcifera
2.2. Total RNA Isolation and cDNA Preparation
2.3. Cloning SfUAP Using Reverse Transcription Polymerase Chain Reaction (RT-PCR) and RACE
2.4. cDNA and Amino Acid Sequence Analysis
2.5. SfUAP Expression in Different Developmental Stages and Tissues Using Quantitative Real-Time PCR (qPCR)
2.6. Functional Analysis of SfUAP
2.7. Statistical Analysis
3. Results
3.1. Identification and Characterization of SfUAP
3.2. Homology Comparison and Phylogenetic Analysis
3.3. Expression of SfUAP at Different Developmental Stages and Tissues
3.4. Functional Analysis of SfUAP
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hu, S.-J.; Liu, X.-F.; Fu, D.-Y.; Huang, W.; Wang, X.-Y.; Liu, X.-J.; Lü, J.-P.; Ye, H. Projecting distribution of the overwintering population of Sogatella furcifera (Hemiptera: Delphacidae), in Yunnan, China with analysis on key influencing climatic factors. J. Insect Sci. 2015, 15, 148. [Google Scholar] [CrossRef]
- Wang, Z.; Zhou, C.; Long, G.-Y.; Yang, H.; Jin, D.-C. Sublethal effects of buprofezin on development, reproduction, and chitinsynthase 1 gene (SfCHS1) expression in the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae). J. Asia-Pac. Entomol. 2018, 21, 585–591. [Google Scholar] [CrossRef]
- Zhou, C.; Liu, L.-L.; Yang, H.; Wang, Z.; Long, G.-Y.; Jin, D.-C. Sublethal effects of imidacloprid on the development, reproduction, and susceptibility of the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae). J. Asia-Pac. Entomol. 2017, 20, 996–1000. [Google Scholar] [CrossRef]
- Zhou, G.-H.; Xu, D.-L.; Xu, D.-G.; Zhang, M.-X. Southern rice black-streaked dwarf virus: A white-backed planthopper-transmitted fijivirus threatening rice production in Asia. Front. Microbiol. 2013, 4, 270. [Google Scholar] [CrossRef] [PubMed]
- Matsukura, K.; Towata, T.; Sakai, J.; Onuki, M.; Okuda, M.; Matsumura, M. Dynamics of Southern rice black-streaked dwarf virus in Rice and Implication for Virus Acquisition. Phytopathology 2013, 103, 509–512. [Google Scholar] [CrossRef]
- Matsumura, M.; Sanada-Morimura, S.; Otuka, A.; Sonoda, S.; Van Thanh, D.; VanChien, H.; VanTuong, P.; Loc, P.M.; Liu, Z.-W.; Zhu, Z.-R.; et al. Insecticide susceptibilities of the two rice planthoppers Nilaparvata lugens and Sogatella furcifera in East Asia, the Red River Delta, and the Mekong Delta. Pest Manag. Sci. 2018, 74, 456–464. [Google Scholar] [CrossRef]
- Matsukawa-Nakata, M.; Chung, N.H.; Kobori, Y. Insecticide application and its effect on the density of rice planthoppers, Nilaparvata lugens and Sogatella furcifera, in paddy fields in the Red River Delta, Vietnam. J. Pestic. Sci. 2019, 44, 129–135. [Google Scholar] [CrossRef]
- Daimon, T.; Hamada, K.; Mita, K.; Okano, K.; Suzuki, M.G.; Kobayashi, M.; Shimada, T. A Bombyx mori gene, BmChi-h, encodes a protein homologous to bacterial and baculovirus chitinases. Insect Biochem. Mol. Biol. 2003, 33, 749–759. [Google Scholar] [CrossRef]
- Merzendorfer, H. Insect chitin synthases: A review. J. Comp. Physiol. B 2006, 176, 1–15. [Google Scholar] [CrossRef]
- Merzendorfer, H.; Zimoch, L. Chitin metabolism in insects: Structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 2003, 206, 4393–4412. [Google Scholar] [CrossRef]
- Minamoto, T.; Takahashi, N.; Kitahara, S.; Shinozaki, Y.; Hirano, T.; Hakamata, W.; Nishio, T. Saccharification of beta-chitin from squid pen by a fermentation method using recombinant chitinase-secreting Escherichia coli. Appl. Biochem. Biotechnol. 2015, 175, 3788–3799. [Google Scholar] [CrossRef] [PubMed]
- Aranda-Martinez, A.; Lenfant, N.; Escudero, N.; Zavala-Gonzalez, E.A.; Henrissat, B.; Lopez-Llorca, L.V. CAZyme content of Pochonia chlamydosporia reflects that chitin and chitosan modification are involved in nematode parasitism. Environ. Microbiol. 2016, 18, 4200–4215. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.J.; Fernandez, J.G.; Sohn, J.J.; Amemiya, C.T. Chitin Is Endogenously Produced in Vertebrates. Curr. Biol. 2015, 25, 897–900. [Google Scholar] [CrossRef]
- Phillips, M.; Tang, W.J.; Robinson, M.; Daza, D.O.; Hassan, K.; Leppert, V.; Hirst, L.S.; Amemiya, C.T. Evidence of chitin in the ampullae of Lorenzini of chondrichthyan fishes. Curr. Biol. 2020, 30, R1254–R1255. [Google Scholar] [CrossRef]
- Moussian, B.; Letizia, A.; Martínez-Corrales, G.; Rotstein, B.; Casali, A.; Llimargas, M. Deciphering the Genetic Programme Triggering Timely and Spatially-Regulated Chitin Deposition. PLoS Genet. 2015, 11, e1004939. [Google Scholar] [CrossRef][Green Version]
- Chen, C.; Yang, H.; Tang, B.; Yang, W.-J.; Jin, D.-C. Identification and functional analysis of chitinase 7 gene in white-backed planthopper, Sogatella furcifera. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 208–209, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Muthukrishnan, S.; Arakane, Y.; Yang, Q.; Zhang, C.-X.; Zhang, J.; Zhang, W.; Moussian, B. Future questions in insect chitin biology: A microreview. Arch. Insect Biochem. Physiol. 2018, 98, e21454. [Google Scholar] [CrossRef] [PubMed]
- Arakane, Y.; Muthukrishnan, S.; Kramer, K.J.; Specht, C.A.; Tomoyasu, Y.; Lorenzen, M.D.; Kanost, M.; Beeman, R.W. The Tribolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix. Insect Mol. Biol. 2005, 14, 453–463. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Liu, X.; Zhang, J.; Li, D.; Sun, Y.; Guo, Y.; Ma, E.; Zhu, K.Y. Silencing of two alternative splicing-derived mRNA variants of chitin synthase 1 gene by RNAi is lethal to the oriental migratory locust, Locusta migratoria manilensis (Meyen). Insect Biochem. Mol. Biol. 2010, 40, 824–833. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, H.; Li, S.; Zhu, K.Y.; Ma, E.; Zhang, J. Characterization of a midgut-specific chitin synthase gene (LmCHS2) responsible for biosynthesis of chitin of peritrophic matrix in Locusta migratoria. Insect Biochem. Mol. Biol. 2012, 42, 902–910. [Google Scholar] [CrossRef]
- Yang, W.-J.; Xu, K.-K.; Cong, L.; Wang, J.-J. Identification, mRNA Expression, and Functional Analysis of Chitin Synthase 1 Gene and Its Two Alternative Splicing Variants in Oriental Fruit Fly, Bactrocera dorsalis. Int. J. Biol. Sci. 2013, 9, 331–342. [Google Scholar] [CrossRef] [PubMed]
- Kelkenberg, M.; Odman-Naresh, J.; Muthukrishnan, S.; Merzendorfer, H. Chitin is a necessary component to maintain the barrier function of the peritrophic matrix in the insect midgut. Insect Biochem. Mol. Biol. 2015, 56, 21–28. [Google Scholar] [CrossRef] [PubMed]
- Zhai, Y.; Fan, X.; Yin, Z.; Yue, X.; Men, X.; Zheng, L.; Zhang, W. Identification and Functional Analysis of Chitin Synthase A in Oriental Armyworm, Mythimna separata. Proteomics 2017, 17, 1700165. [Google Scholar] [CrossRef] [PubMed]
- Cohen, E. Chitin synthesis and inhibition: A revisit. Pest Manag. Sci. 2001, 57, 946–950. [Google Scholar] [CrossRef]
- Liu, X.; Li, F.; Li, D.; Ma, E.; Zhang, W.; Zhu, K.Y.; Zhang, J. Molecular and Functional Analysis of UDP-N-Acetylglucosamine Pyrophosphorylases from the Migratory Locust, Locusta migratoria. PLoS ONE 2013, 8, e71970. [Google Scholar] [CrossRef] [PubMed]
- Peneff, C.; Ferrari, P.; Charrier, V.; Taburet, Y.; Monnier, C.; Zamboni, V.; Winter, J.; Harnois, M.; Fassy, F.; Bourne, Y. Crystal structures of two human pyrophosphorylase isoforms in complexes with UDPGlc(Gal)NAc: Role of the alternatively spliced insert in the enzyme oligomeric assembly and active site architecture. EMBO J. 2001, 20, 6191–6202. [Google Scholar] [CrossRef]
- Yang, W.-J.; Wu, Y.-B.; Chen, L.; Xu, K.-K.; Xie, Y.-F.; Wang, J.-J. Two chitin biosynthesis pathway genes in Bactrocera dorsalis (Diptera: Tephritidae): Molecular characteristics, expression patterns, and roles in larval-pupal transition. J. Econ. Entomol. 2015, 108, 2433–2442. [Google Scholar] [CrossRef]
- Arakane, Y.; Baguinon, M.C.; Jasrapuria, S.; Chaudhari, S.; Doyungan, A.; Kramer, K.J.; Muthukrishnan, S.; Beeman, R.W. Both UDP N-acetylglucosamine pyrophosphorylases of Tribolium castaneum are critical for molting, survival and fecundity. Insect Biochem. Mol. Biol. 2011, 41, 42–50. [Google Scholar] [CrossRef]
- Chen, J.; Chen, H.-X.; Yao, Q.; Zhang, W.-Q. Molecular cloning, expression patterns and RNAi of UDP-N-acetylglucosamine pyrophosphorylase in Spodoptera exigua. Sci. Agric. Sin. 2014, 47, 1351–1361. [Google Scholar]
- Palaka, B.K.; Singh, N.P.; Kotapati, K.V.; Kumar, S.R.; Ampasala, D.R. UDP-N-acetyl glucosamine pyrophosphorylase as noveltarget for controlling Aedes aegypti-molecular modeling, docking and simulation studies. Int. J. Mosq. Res. 2014, 1, 45–52. [Google Scholar]
- Yu, H.-Z.; Huang, K.-H.; Wang, W.-L.; Liu, M.-H.; Yang, X.; Zhang, Y.; Xu, J.-P. Identification and expression analysis of chitin synthase and related enzymes in the chitin biosynthetic pathway genes of Cnaphalocrocis medinalis. Chin. J. Appl. Entomol. 2015, 52, 1181–1194. [Google Scholar]
- Zhou, Y.-J.; Du, J.; Li, S.-W.; Shakeel, M.; Li, J.-J.; Meng, X.-G. Cloning, characterization, and RNA interference effect of the UDP-N- acetylglucosamine pyrophosphorylase gene in Cnaphalocrocis medinalis. Genes 2021, 12, 464. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.-F.; Fu, J.; Mu, L.-L.; Guo, W.-C.; Li, G.-Q. Two Leptinotarsa uridine diphosphate N-acetylglucosamine pyrophosphorylases are specialized for chitin synthesis in larval epidermal cuticle and midgut peritrophic matrix. Insect Biochem. Mol. Biol. 2016, 68, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Palaka, B.K.; VelmuruganIlavarasi, A.; Sapam, T.D.; Kotapati, K.V.; Nallala, V.S.; Khan, M.B.; Ampasala, D.R. Molecular cloning, gene expression analysis, and in silico characterization of UDP-N-acetylglucosamine pyrophosphorylase from Bombyx mori. Biotechnol. Appl. Biochem. 2019, 66, 880–899. [Google Scholar] [CrossRef]
- Jiang, L.; Mu, L.; Jin, L.; Anjum, A.A.; Li, G. Silencing uridine diphosphate N -acetylglucosamine pyrophosphorylase gene impairs larval development in Henosepilachna vigintioctopunctata. Pest Manag. Sci. 2022. [Google Scholar] [CrossRef]
- Araújo, S.J.; Aslam, H.; Tear, G.; Casanova, J. mummy/cystic encodes anenzyme required for chitin and glycan synthesis, involved in trachea, embryoniccuticle and CNS development–analysis of its role in Drosophila tracheal morphogenesis. Dev. Biol. 2005, 288, 179–193. [Google Scholar] [CrossRef]
- Schimmelpfeng, K.; Strunk, M.; Stork, T.; Klambt, C. mummy encodes an UDP-N-acetylglucosamine-diphosphorylase and is required during Drosophila dorsal closure and nervous system development. Mech. Dev. 2006, 123, 487–499. [Google Scholar] [CrossRef]
- Tonning, A.; Helms, S.; Schwarz, H.; Uv, A.E.; Moussian, B. Hormonal regulation of mummy is needed for apical extracellular matrix formation and epithelial morphogenesis in Drosophila. Development 2006, 133, 331–341. [Google Scholar] [CrossRef]
- Wang, Y.; Fan, H.-W.; Huang, H.-J.; Xue, J.; Wu, W.-J.; Bao, Y.-Y.; Xu, H.-J.; Zhu, Z.-R.; Cheng, J.-A.; Zhang, C.-X. Chitin synthase 1 gene and its two alternative splicing variants from two sap-sucking insects, Nilaparvata lugens and Laodelphax striatellus (Hemiptera: Delphacidae). Insect Biochem. Mol. Biol. 2012, 42, 637–646. [Google Scholar] [CrossRef]
- Wang, Z.; Yang, H.; Zhou, C.; Yang, W.-J.; Jin, D.-C.; Long, G.-Y. Molecular cloning, expression, and functional analysis of the chitin synthase 1 gene and its two alternative splicing variants in the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae). Sci. Rep. 2019, 9, 1087. [Google Scholar] [CrossRef]
- Marschall, H.-U.; Matern, H.; Wietholtz, H.; Egestad, B.; Matern, S.; Sjovall, J. Bile acid N-acetylglucosaminidation. In vivo and in vitro evidence for a selective conjugation reaction of 7 beta-hydroxylated bile acids in humans. J. Clin. Investig. 1992, 89, 1981–1987. [Google Scholar] [CrossRef] [PubMed]
- Eisenhaber, B.; Maurer-Stroh, S.; Novatchkova, M.; Schneider, G.; Eisenhaber, F. Enzymes and auxiliary factors for GPI lipid anchor biosynthesis and post-translational transfer to proteins. BioEssays 2003, 25, 367–385. [Google Scholar] [CrossRef] [PubMed]
- Arakane, Y.; Hogenkamp, D.G.; Zhu, Y.C.; Kramer, K.J.; Specht, C.A.; Beeman, R.W.; Kanost, M.R.; Muthukrishnan, S. Characterization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development. Insect Biochem. Mol. Biol. 2004, 34, 291–304. [Google Scholar] [CrossRef] [PubMed]
- Qu, M.-B.; Yang, Q. A novel alternative splicing site of class A chitin synthase from the insect Ostrinia furnacalis—gene organization, expression pattern and physiological significance. Insect Biochem. Mol. Biol. 2011, 41, 923–931. [Google Scholar] [CrossRef] [PubMed]
- Zhuo, W.; Fang, Y.; Kong, L.; Li, X.; Sima, Y.; Xu, S. Chitin synthase A: A novel epidermal development regulation gene in the larvae of Bombyx mori. Mol. Biol. Rep. 2014, 41, 4177–4186. [Google Scholar] [CrossRef]
- Moreira, M.F.; Dos Santos, A.S.; Marotta, H.R.; Mansur, J.F.; Ramos, I.; Machado, E.A.; Souza, G.H.M.F.; Eberlin, M.N.; Kaiser, C.R.; Kramer, K.J. A chitin-like component in Aedes aegypti eggshells, eggs and ovaries. Insect Biochem. Mol. Biol. 2007, 37, 1249–1261. [Google Scholar] [CrossRef] [PubMed]








| cDNA Fragment | Primer Name | Primer Sequence (5′–3′) | Size (bp) |
|---|---|---|---|
| PCR1 | UAP-F1 | GAACGAGAGGAACTGTGT | 770 |
| UAP-R1 | GTTGGTGACGACTTCTGT | ||
| 5′RACE | UAP-51 | CCGTAAAGGTGTGATGGTAT | 335 |
| UAP-52 | CATCTTGACACAGTTCCTCT | 217 | |
| ORF confirmation | UAP-F | GTTTTTCAACGATGTCAGAC | 1490 |
| UAP-R | GGAGCTGAATTAATGTGAGTT |
| Experiments | Gene Name | Primer Name | Primer Sequence (5′–3′) | Size (bp) |
|---|---|---|---|---|
| qPCR analysis | SfUAP | qUAP-F | CAGCAGTAACCTTGTAGTCT | 179 |
| qUAP-R | CGCAAACGATAGTCTCATT | |||
| 18S RNA | q18S-F | CGGAAGGATTGACAGATTGAT | 151 | |
| q18S-R | CACGATTGCTGATACCACATAC | |||
| dsRNA synthesis | SfUAP | dsUAP-F | TAATACGACTCACTATAGGGCGAGAACACCATCCGAAT | 442 |
| dsUAP-R | TAATACGACTCACTATAGGGTAGAGACCTCCGTTACCAT | |||
| GFP | dsGFP-F | TAATACGACTCACTATAGGGAAGGGCGAGGAGCTGTTCACCG | 707 | |
| dsGFP-R | TAATACGACTCACTATAGGGCAGCAGGACCATGTGATCGCGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Long, G.-Y.; Zhou, C.; Jin, D.-C.; Yang, H.; Yang, W.-J. Molecular Characterization of UDP-N-Acetylglucosamine Pyrophosphorylase and Its Role in the Growth and Development of the White-Backed Planthopper Sogatella furcifera (Hemiptera: Delphacidae). Genes 2022, 13, 1340. https://doi.org/10.3390/genes13081340
Wang Z, Long G-Y, Zhou C, Jin D-C, Yang H, Yang W-J. Molecular Characterization of UDP-N-Acetylglucosamine Pyrophosphorylase and Its Role in the Growth and Development of the White-Backed Planthopper Sogatella furcifera (Hemiptera: Delphacidae). Genes. 2022; 13(8):1340. https://doi.org/10.3390/genes13081340
Chicago/Turabian StyleWang, Zhao, Gui-Yun Long, Cao Zhou, Dao-Chao Jin, Hong Yang, and Wen-Jia Yang. 2022. "Molecular Characterization of UDP-N-Acetylglucosamine Pyrophosphorylase and Its Role in the Growth and Development of the White-Backed Planthopper Sogatella furcifera (Hemiptera: Delphacidae)" Genes 13, no. 8: 1340. https://doi.org/10.3390/genes13081340
APA StyleWang, Z., Long, G.-Y., Zhou, C., Jin, D.-C., Yang, H., & Yang, W.-J. (2022). Molecular Characterization of UDP-N-Acetylglucosamine Pyrophosphorylase and Its Role in the Growth and Development of the White-Backed Planthopper Sogatella furcifera (Hemiptera: Delphacidae). Genes, 13(8), 1340. https://doi.org/10.3390/genes13081340

