From First to Second: How Stickler’s Diagnostic Genetics Has Evolved to Match Sequencing Technologies
Abstract
:1. Background
2. Key Considerations in First-Generation Sequencing
3. First-Generation Sequencing of Stickler’s Syndrome
4. The Non-Quantitative Nature of Amplification and Sequencing
5. Diagnostic First-Generation Sequence Data Analyses
6. Comparison of First- and Second-Generation Sequencing Approaches
7. Future Diagnostic Developments
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Primer Name | Sequence | Buffer |
COL2A1_PROM_F*M13F | cacccttcccgcctgtggtcagag | D |
COL2A1_PROM_R | gtgcctaagtcggcgcgctacgac | |
COL2A1_1_F*M13F | atgagggcgcggtagagac | E |
COL2A1_1_R | gtgcctaagtcggcgcgctacgac | |
COL2A1_2_F*M13F | tatgtccaggtggccccagcctac | E |
COL2A1_2_R | ctgtccttcatgtgtcttggaagc | |
COL2A1_3_F*M13F | gtggccctaacaccccaacagagg | E |
COL2A1_3_R | cagcccctgtgttgaggtaccctc | |
COL2A1_4_5_F*M13F | gagggtacctcaacacaggggctg | D |
COL2A1_4_5_R | atgacagcaaggccaggagcctgc | |
COL2A1_6_7_F*M13F | tctttctccgtcccttcctcgctg | D |
COL2A1_6_7_R | cccttagcaccacagtctcatgcc | |
COL2A1_8_F*M13F | cccttccagtgaaatgattttgcc | E |
COL2A1_8_R | agaggttgtcagactctctggctc | |
COL2A1_9_10_F*M13F | tgagagggagcagccactctaggcc | D |
COL2A1_9_10_R | ctgggcagagcctgggagggacagc | |
COL2A1_11_F*M13F | cccaatgtggcaaggaccaccagg | D |
COL2A1_11_R | gtgcctccctgtcactccccaagc | |
COL2A1_12_F | gccctctggggtgcccccactatgc | D |
COL2A1_12_R*M13F | actgcccagcctccctcatgagag | |
COL2A1_14_15_F | gaggccctcctgcagcccagggcag | D |
COL2A1_14_15_R*M13F | atgaactttgcacaaagggagctc | |
COL2A1_13_14_F*M13F | gaggccctcctgcagcccagggcag | D |
COL2A1_13_14_R | atgaactttgcacaaagggagctc | |
COL2A1_16_F | atcctggctagtcaaggagccagc | E |
COL2A1_16_R*M13F | actgtgcagactcagcctgggaag | |
COL2A1_17_F*M13F | gtgtgtccttcgttttctgtaagg | B |
COL2A1_17_R | tgttgagggagcaatgagcaaggg | |
COL2A1_18_F | gtgtgtccttcgttttctgtaagg | B |
COL2A1_18_R*M13F | tgttgagggagcaatgagcaaggg | |
COL2A1_19_F*M13F | gggtgcatgtgcataatttagtgc | A |
COL2A1_19_R | cccacaactgtcagagcaaagtac | |
COL2A1_20_21_F*M13F | ttcattctggcccaatgcctgtcc | D |
COL2A1_20_21_R | ggtggtgggtcagtggggctgagg | |
COL2A1_21_22_F | ttcattctggcccaatgcctgtcc | D |
COL2A1_21_22_R*M13F | ggtggtgggtcagtggggctgagg | |
COL2A1_23_F*M13F | ttcatactctgagtcgaggcttgc | D |
COL2A1_23_R | gactatttcatgtcagtctggtgg | |
COL2A1_24_25_F*M13F | ccaccagactgacatgaaatagtc | B |
COL2A1_24_25_R | atctctcttttcccttgcttcccc | |
COL2A1_25_26_F | ccaccagactgacatgaaatagtc | B |
COL2A1_25_26_R*M13F | atctctcttttcccttgcttcccc | |
COL2A1_27_F*M13F | tgggtgtgatgtggtcaatcctag | E |
COL2A1_27_R | cccaaatcacatacagacccccac | |
COL2A1_28_F*M13F | ggcctcagtccctgcagcccgctc | D |
COL2A1_28_R | cccacattcacatctgtcagctcc | |
COL2A1_29_F*M13F | tgtggaaatggagctcagctgggg | A |
COL2A1_29_R | ctccaccaatgtgggtccacacag | |
COL2A1_30_31_F*M13F | ctactagctgtggctctcagggtc | D |
COL2A1_30_31_R | gggaggtggggaaaggagcaggag | |
COL2A1_32_33_F*M13F | gagtgatattcagccctgctgtgg | D |
COL2A1_32_33_R | tcattcctcctgagcccgctcctc | |
COL2A1_34_F | agaggagcgggctcaggaggaatg | D |
COL2A1_34_R*M13F | ctaacagaaaccttcatcaccagg | |
COL2A1_35_36_F*M13F | gctttccctagcaccccagcctgg | D |
COL2A1_35_36_R | cgcctttggcaggagataagaagg | |
COL2A1_37_F*M13F | caaatgcactttgccctctcccac | E |
COL2A1_37_R | acaagctccgatgcccgagggtgc | |
COL2A1_38_F | caaatgcactttgccctctcccac | E |
COL2A1_38_R*M13F | acaagctccgatgcccgagggtgc | |
COL2A1_39_F*M13F | tcccgcctccatactaatagaacc | E |
COL2A1_39_R | cacagcccacatgccacatggaag | |
COL2A1_40_F*M13F | agccagaaccaagctgctgatctc | G |
COL2A1_40_R | ttaggctggggaccaacgcagggc | |
COL2A1_41_F*M13F | tccataccaggctctgagaccacc | G |
COL2A1_41_R | gaaggccagcctggagctctccag | |
COL2A1_42F_F*M13F | aagcccccagagaggaaactgctg | i |
COL2A1_42F_R | ctgctccctcctaccccatgc | |
COL2A1_42R_F | aagcccccagagaggaaactgctg | i |
COL2A1_42R_R*M13F | ctgctccctcctaccccatgc | |
COL2A1_43_F*M13F | agctcacagagcatggggtagg | D |
COL2A1_43_R | tgacccagcacagagactcacagg | |
COL2A1_44_F | agctcacagagcatggggtagg | D |
COL2A1_44_R*M13F | tgacccagcacagagactcacagg | |
COL2A1_45_F*M13F | ggcctgggcttctgagaggggctg | A |
COL2A1_45_R | gtccttctaggctgagatgagact | |
COL2A1_46_47_F*M13F | agtctcatctcagcctagaaggac | A |
COL2A1_46_47_R | ccacccaagctgaggaatccccgg | |
COL2A1_48_F*M13F | gctgggagggcagccagcctccag | D |
COL2A1_48_R | cccagaagcagcagcatttccctc | |
COL2A1_49_F | gctgggagggcagccagcctccag | D |
COL2A1_49_R*M13F | cccagaagcagcagcatttccctc | |
COL2A1_50_F*M13F | gagtggctggtgctatcaggacag | E |
COL2A1_50_R | tgccctaaaagaggccctgagc | |
COL2A1_51_F*M13F | gagggacactctagtacattctag | A |
COL2A1_51_R | caggggccagggctgcagcttctc | |
COL2A1_52_F*M13F | tctgtctctttcagtcaggcctgg | A |
COL2A1_52_R | tttccctcctctcaagcccaacag | |
COL2A1_53_F*M13F | tcctctgagcttgctccactcctgg | E |
COL2A1_53_R | gccgcgggccaaccctcagccctg | |
COL2A1_54_F*M13F | ttgttcagttttgggcttctgggc | D |
COL2A1_54_R | agagtgactgagattggaaagtac |
Appendix B
Primer Name | Sequence |
COL2A1_Prom-F | cacccttcccgcctgtggtcagag |
COL2A1_Prom-R | ctgtccttcatgtgtcttggaagc |
COL2A1_2-10_F | tatgtccaggtggccccagcctac |
COL2A1_2-10_R | ctggtggtccttgccacatt |
COL2A1_9-15_F | ggggagtgggaaatgagagg |
COL2A1_9-15_R | atgaactttgcacaaagggagctc |
COL2A1_13-17_F | gaggccctcctgcagcccagggcag |
COL2A1_13-17_R | cagagtgctgctgtggttgc |
COL2A1_17-22_F | cgccatcctcgtgctctgc |
COL2A1_17-22_R | ggtggtgggtcagtggggctgagg |
COL2A1_19-26_F | gggtgcatgtgcataatttagtgc |
COL2A1_19-26_R | cccagtgcctaccatctaccc |
COL2A1_24-31_F | ccaccagactgacatgaaatagtc |
COL2A1_24-31_R | gggaggtggggaaaggagcaggag |
COL2A1_30-36_F | ctactagctgtggctctcagggtc |
COL2A1_30-36_R | cgcctttggcaggagataagaagg |
COL2A1_35-41_F | gctttccctagcaccccagcctgg |
COL2A1_35-41_R | gaaggccagcctggagctctccag |
COL2A1_41-45_F | tccataccaggctctgagaccacc |
COL2A1_41-45_R | gtccttctaggctgagatgagact |
COL2A1_45-50_F | ggcctgggcttctgagaggggctg |
COL2A1_45-50_R | tgccctaaaagaggccctgagc |
COL2A1_50-54_F | gagtggctggtgctatcaggacag |
COL2A1_50-54_R | agagtgactgagattggaaagtac |
References
- Clarke, L.A.; Rebelo, C.S.; Gonçalves, J.; Boavida, M.G.; Jordan, P. PCR amplification introduces errors into mononucleotide and dinucleotide repeat sequences. Mol. Pathol. 2001, 54, 351–353. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Armour, J.A.; Sismani, C.; Patsalis, P.C.; Cross, G. Measurement of locus copy number by hybridisation with amplifiable probes. Nucleic Acids Res. 2000, 28, 605–609. [Google Scholar] [CrossRef] [PubMed]
- Schouten, J.P.; McElgunn, C.J.; Waaijer, R.; Zwijnenburg, D.; Diepvens, F.; Pals, G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res. 2002, 30, e57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shestak, A.G.; Bukaeva, A.A.; Saber, S.; Zaklyazminskaya, E.V. Allelic Dropout Is a Common Phenomenon That Reduces the Diagnostic Yield of PCR-Based Sequencing of Targeted Gene Panels. Front. Genet. 2021, 12, 620337. [Google Scholar] [CrossRef] [PubMed]
- Karger, B.L.; Guttman, A. DNA sequencing by CE. Electrophoresis 2009, 30 (Suppl. S1), S196–S202. [Google Scholar] [CrossRef] [PubMed]
- McGinn, S.; Gut, I.G. DNA sequencing—Spanning the generations. N. Biotechnol. 2013, 30, 366–372. [Google Scholar] [CrossRef] [PubMed]
- Giannikou, K.; Lasseter, K.D.; Grevelink, J.M.; Tyburczy, M.E.; Dies, K.A.; Zhu, Z.; Hamieh, L.; Wollison, B.M.; Thorner, A.R.; Ruoss, S.J.; et al. Low-level mosaicism in tuberous sclerosis complex: Prevalence, clinical features, and risk of disease transmission. Genet. Med. 2019, 21, 2639–2643, Erratum in Genet. Med. 2021, 23, 2022. [Google Scholar] [CrossRef] [PubMed]
- Brewer, C.J.; Gillespie, M.; Fierro, J.; Scaringe, W.A.; Li, J.M.; Lee, C.Y.; Yen, H.Y.; Gao, H.; Strom, S.P. The Value of Parental Testing by Next-Generation Sequencing Includes the Detection of Germline Mosaicism. J. Mol. Diagn. 2020, 22, 670–678. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamps, R.; Brandão, R.D.; Bosch, B.J.; Paulussen, A.D.; Xanthoulea, S.; Blok, M.J.; Romano, A. Next-Generation Sequencing in Oncology: Genetic Diagnosis, Risk Prediction and Cancer Classification. Int. J. Mol. Sci. 2017, 18, 308. [Google Scholar] [CrossRef] [PubMed]
- Chimukangara, B.; Samuel, R.; Naidoo, K.; de Oliveira, T. Primary HIV-1 Drug Resistant Minority Variants. AIDS Rev. 2017, 19, 89–96. [Google Scholar] [PubMed]
- McCombie, W.R.; McPherson, J.D.; Mardis, E.R. Next-Generation Sequencing Technologies. Cold Spring Harb. Perspect. Med. 2019, 9, a036798. [Google Scholar] [CrossRef] [PubMed]
- Head, S.R.; Komori, H.K.; LaMere, S.A.; Whisenant, T.; Van Nieuwerburgh, F.; Salomon, D.R.; Ordoukhanian, P. Library construction for next-generation sequencing: Overviews and challenges. Biotechniques 2014, 56, 61–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adey, A.; Morrison, H.G.; Asan, X.; Kitzman, J.O.; Turner, E.H.; Stackhouse, B.; MacKenzie, A.P.; Caruccio, N.C.; Zhang, X.; Shendure, J. Rapid, low-input, low-bias construction of shotgun fragment libraries by high-density in vitro transposition. Genome Biol. 2010, 11, R119. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Zhang, Y.; Ding, J.; Wang, F. mRNA analysis identifies deep intronic variants causing Alport syndrome and overcomes the problem of negative results of exome sequencing. Sci. Rep. 2021, 11, 18097, Erratum in Sci. Rep. 2021, 11, 22225. [Google Scholar] [CrossRef]
- Richards, A.J.; McNinch, A.; Whittaker, J.; Treacy, B.; Oakhill, K.; Poulson, A.; Snead, M.P. Splicing analysis of unclassified variants in COL2A1 and COL11A1 identifies deep intronic pathogenic mutations. Eur. J. Hum. Genet. 2012, 20, 552–558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Richards, A.J.; Snead, M.P. The influence of pre-mRNA splicing on phenotypic modification in Stickler’s syndrome and other type II collagenopathies. Eye 2008, 22, 1243–1250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agrawal, P.; Katragadda, S.; Hariharan, A.K.; Raghavendrachar, V.G.; Agarwal, A.; Dayalu, R.; Awasthy, D.; Sharma, S.C.; Sivasamy, Y.K.; Lakshmana, P.; et al. Validation of whole genome sequencing from dried blood spots. BMC Med. Genom. 2021, 14, 110. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martin, H.; Richards, A.J.; Snead, M.P. From First to Second: How Stickler’s Diagnostic Genetics Has Evolved to Match Sequencing Technologies. Genes 2022, 13, 1123. https://doi.org/10.3390/genes13071123
Martin H, Richards AJ, Snead MP. From First to Second: How Stickler’s Diagnostic Genetics Has Evolved to Match Sequencing Technologies. Genes. 2022; 13(7):1123. https://doi.org/10.3390/genes13071123
Chicago/Turabian StyleMartin, Howard, Allan J. Richards, and Martin P. Snead. 2022. "From First to Second: How Stickler’s Diagnostic Genetics Has Evolved to Match Sequencing Technologies" Genes 13, no. 7: 1123. https://doi.org/10.3390/genes13071123
APA StyleMartin, H., Richards, A. J., & Snead, M. P. (2022). From First to Second: How Stickler’s Diagnostic Genetics Has Evolved to Match Sequencing Technologies. Genes, 13(7), 1123. https://doi.org/10.3390/genes13071123