In Silico Analysis of Seven PCR Markers Developed from the CHD1, NIPBL and SPIN Genes Followed by Laboratory Testing Shows How to Reliably Determine the Sex of Musophagiformes Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Biological Samples and DNA Extraction
2.2. DNA Amplification
2.3. In Silico Analysis of the Genetic Markers Tested
2.4. In Silico Analysis of the Gene Content of T. erythrolophus Chromosomes
3. Results and Discussion
3.1. In Silico Analysis of the Genetic Markers Tested
3.2. Laboratory Verification of the Usefulness of the Tested Markers for Sex Typing in the Turaco Species Studied
3.2.1. Polymorphism of the Studied Introns in the CHD1 Gene
3.2.2. Length Polymorphism of the 17th Intron in the NIPBL Gene
3.2.3. Testing of the M6 Marker Developed on the Basis of the SPIN Gene
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brusatte, S.L.; O’Connor, J.K.; Jarvis, E.D. The Origin and Diversification of Birds. Curr. Biol. 2015, 25, R888–R898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Çakmak, E.; Akın Pekşen, Ç.; Bilgin, C.C. Comparison of three different primer sets for sexing birds. J. Vet. Diagn. Investig. 2017, 29, 59–63. [Google Scholar] [CrossRef] [PubMed]
- Miyaki, C.Y.; Griffiths, R.; Orr, K.; Nahum, L.A.; Pereira, S.L.; Wajntal, A. Sex identification of parrots, toucans, and curassows by PCR: Perspectives for wild and captive population studies. Zoo Biol. 1998, 17, 415–423. [Google Scholar] [CrossRef]
- Griffiths, R. Sex Identification in Birds. Semin. Avian Exot. Pet Med. 2000, 9, 14–26. [Google Scholar] [CrossRef]
- Richner, H. Avian laparoscopy as a field technique for sexing birds and an assessment of its effect on wild birds. J. Field Ornithol. 1989, 60, 137–142. [Google Scholar]
- Redelman, D.; Fleury, S.A.; Garner, D.L. Flow cytometry for sexing birds. Trends Ecol. Evol. 1997, 12, 489. [Google Scholar] [CrossRef]
- Griffiths, R.; Daan, S.; Dijkstra, C. Sex identification in birds using two CHD genes. Proc. R. Soc. Lond. B 1996, 263, 1251–1256. [Google Scholar]
- Wang, L.C.; Chen, C.T.; Lee, H.Y.; Li, S.H.; Lir, J.T.; Chin, S.C.; Pu, C.E.; Wang, C.H. Sexing a wider range of avian species based on two CHD1 introns with a unified reaction condition. Zoo Biol. 2007, 26, 425–431. [Google Scholar] [CrossRef]
- Ong, A.H.; Vellayan, S. An evaluation of CHD-Specific primer sets for sex typing of birds from feathers. Zoo Biol. 2008, 27, 62–69. [Google Scholar] [CrossRef]
- Lee, J.C.; Tsai, L.C.; Hwa, P.Y.; Chan, C.L.; Huang, A.; Chin, S.C.; Wang, L.C.; Lin, J.T.; Linacre, A.; Hsieh, H.M. A novel strategy for avian species and gender identification using the CHD gene. Mol. Cell. Probes 2010, 24, 27–31. [Google Scholar] [CrossRef]
- Suh, A.; Kriegs, J.O.; Brosius, J.; Schmitz, J. Retroposon insertions and the chronology of avian sex chromosome evolution. Mol. Biol. Evol. 2011, 28, 2993–2997. [Google Scholar] [CrossRef] [Green Version]
- de Kloet, R.S.; de Kloet, S.R. Evolution of the spindlin gene in birds: Independent cessation of the recombination of sex chromosomes at the spindlin locus in neognathous birds and tinamous, a palaeognathous avian family. Genetica 2003, 119, 333–342. [Google Scholar] [CrossRef]
- Li, W.; Xue, F.; Li, L.; Li, X.; Yue, B.; Li, J. A triple-primer PCR approach for the sex identification of endangered Phasianidae birds. Eur. J. Wildl. Res. 2012, 58, 289–294. [Google Scholar] [CrossRef]
- Stevens, L. Sex chromosomes and sex determining mechanisms in birds. Sci. Prog. 1997, 80, 197–216. [Google Scholar]
- Fridolfsson, A.K.; Cheng, H.; Copeland, N.G.; Jenkins, N.A.; Liu, H.C.; Raudsepp, T.; Woddage, T.; Chowdhary, B.; Halverson, J.; Ellegren, H. Evolution of the avian sex chromosomes from an ancestral pair of autosomes. Proc. Natl. Acad. Sci. USA 1998, 95, 8147–8151. [Google Scholar] [CrossRef] [Green Version]
- Morinha, F.; Cabral, J.A.; Bastos, E. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods. Theriogenology 2012, 78, 703–714. [Google Scholar] [CrossRef]
- Fridolfsson, A.K.; Ellegren, H. A simple and universal method for molecular sexing of non-ratite birds. J. Avian Biol. 1999, 30, 116–121. [Google Scholar] [CrossRef]
- Han, J.I.; Kim, J.H.; Kim, S.; Park, S.R.; Na, K.J. A simple and improved DNA test for avian sex determination. Auk 2009, 126, 779–783. [Google Scholar] [CrossRef]
- Vucicevic, M.; Stevanov-Pavlovic, M.; Stevanovic, J.; Bosnjak, J.; Gajic, B.; Aleksic, N.; Stanimirovic, Z. Sex determination in 58 bird species and evaluation of CHD gene as a universal molecular marker in bird sexing. Zoo Biol. 2013, 32, 269–276. [Google Scholar] [CrossRef]
- Dawson, D.A.; Dos Remedios, N.; Horsburgh, G.J. A new marker based on the avian spindling gene that is able to sex most birds, including species problematic to sex with CHD markers. Zoo Biol. 2016, 35, 533–545. [Google Scholar] [CrossRef]
- Romanov, M.N.; Betuel, A.M.; Chemnick, L.G.; Ryder, O.A.; Kulibaba, R.O.; Tereshchenko, O.V.; Payne, W.S.; Delekta, P.C.; Dodgson, J.B.; Tuttle, E.M.; et al. Widely Applicable PCR Markers for Sex Identification in Birds. Russ. J. Genet. 2019, 55, 220–231. [Google Scholar] [CrossRef]
- Kroczak, A.; Wierzbicki, H.; Urantówka, A.D. The Length Polymorphism of the 9th Intron in the Avian CHD1 Gene Allows Sex Determination in Some Species of Palaeognathae. Genes 2022, 13, 507. [Google Scholar] [CrossRef]
- Kroczak, A.; Wołoszyńska, M.; Wierzbicki, H.; Kurkowski, M.; Grabowski, K.A.; Piasecki, T.; Galosi, L.; Urantówka, A.D. New Bird Sexing Strategy Developed in the Order Psittaciformes Involves Multiple Markers to Avoid Sex Misidentification: Debunked Myth of the Universal DNA Marker. Genes 2021, 12, 878. [Google Scholar] [CrossRef]
- Veron, G.; Winney, B.J. Phylogenetic relationships within the turacos (Aves, Musophagidae). IBIS 2000, 142, 446–456. [Google Scholar] [CrossRef]
- Perktaş, U.; Groth, J.G.; Barrowclough, G.F. Phylogeography, Species Limits, Phylogeny, and Classification of the Turacos (Aves: Musophagidae) Based on Mitochondrial and Nuclear DNA Sequences. Am. Mus. Novit. 2020, 3949, 1–61. [Google Scholar] [CrossRef]
- Billerman, S.M.; Keeney, B.K.; Rodewald, P.G.; Schulenberg, T.S. (Eds.) Birds of the World; Cornell Laboratory of Ornithology: Ithaca, NY, USA, 2020. [Google Scholar]
- Jensen, T.; Pernasetti, F.M.; Durrant, B. Conditions for rapid sex determination in 47 avian species by PCR of genomic DNA from blood, shell-membrane bloodvessels, and feathers. Zoo Biol. 2003, 22, 561–571. [Google Scholar] [CrossRef]
- Ogawa, A.; Solovei, I.; Hutchison, N.; Saitoh, Y.; Ikeda, J.E.; Macgregor, H.; Mizuno, S. Molecular characterization and cytological mapping of a non-repetitive DNA sequence region from the W chromosome of chicken and its use as a universal probe for sexing Carinatae birds. Chromosome Res. 1997, 5, 93–101. [Google Scholar] [CrossRef]
- Itoh, Y.; Suzuki, M.; Ogawa, A.; Munechika, I.; Murata, K.; Mizuno, S. Identification of the Sex of a Wide Range of Carinatae Birds by PCR Using Primer Sets Selected from Chicken EE0.6 and Its Related Sequences. J. Hered. 2001, 92, 315–321. [Google Scholar] [CrossRef] [Green Version]
- Boutette, J.B.; Ramsay, E.C.; Potgieter, L.N.D.; Kania, S.A. An Improved Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay for Gender Identification in Birds. J. Avian Med. Surg. 2002, 16, 198–202. [Google Scholar] [CrossRef]
- Purwaningrum, M.; Nugroho, H.A.; Asvan, M.; Karyanti, K.; Alviyanto, B.; Kusuma, R.; Haryanto, A. Molecular techniques for sex identification of captive birds. Vet. World 2019, 12, 1506–1513. [Google Scholar] [CrossRef]
- Clements, J.F.; Schulenberg, T.S.; Iliff, M.J.; Billerman, S.M.; Fredericks, T.A.; Gerbracht, J.A.; Lepage, D.; Sullivan, B.L.; Wood, C.L. The eBird/Clements Checklist of Birds of the World: v2021. 2021. Available online: https://www.birds.cornell.edu/clementschecklist/download/ (accessed on 25 March 2022).
- Gill, F.; Donsker, D.; Rasmussen, P. (Eds.) IOC World Bird List (v12.1); 2022. [Google Scholar] [CrossRef]
- Griffiths, R.; Double, M.C.; Orr, K.; Dawson, R.J.G. A DNA test to sex most birds. Mol. Ecol. 1998, 7, 1071–1075. [Google Scholar] [CrossRef] [PubMed]
- Kahn, N.W.; John, J.S.T.; Quinn, T.W. Chromosome-specific intron size differences in the avian CHD gene provide an efficient method for sex identification in birds. Auk 1998, 115, 1074–1078. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Green Version]
- Rangwala, S.H.; Kuznetsov, A.; Ananiev, V.; Asztalos, A.; Borodin, E.; Evgeniev, V.; Joukov, V.; Lotov, V.; Pannu, R.; Rudnev, D.; et al. Accessing NCBI data using the NCBI Sequence Viewer and Genome Data Viewer (GDV). Genome Res. 2021, 31, 159–169. [Google Scholar] [CrossRef]
- Smeds, L.; Warmuth, V.; Bolivar, P.; Uebbing, S.; Burri, R.; Suh, A.; Nater, A.; Bureš, S.; Garamszegi, L.Z.; Hogner, S. Evolutionary analysis of the female-specific avian W chromosome. Nat. Commun. 2015, 6, 7330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peona, V.; Palacios-Gimenez, O.M.; Blommaert, J.; Liu, J.; Haryoko, T.; Jønsson, K.A.; Irestedt, M.; Zhou, Q.; Jern, P.; Suh, A. The avian W chromosome is a refugium for endogenous retroviruses with likely effects on female-biased mutational load and genetic incompatibilities. Phil. Trans. R. Soc. B 2021, 376, 20200186. [Google Scholar] [CrossRef]
Species | Source | Designation | Male | Female | ||
---|---|---|---|---|---|---|
Clements et al. [32] | Gill et al. [33] | Perktaş et al. [25] | ||||
Corythaixoides personatus | Crinifer personatus | Crinifer personatus | Wrocław Zoo | S1 | 1 | 1 * |
Crinifer piscator | Crinifer piscator | Crinifer piscator | captive, Poland | S2 | 1 | 1 |
Gallirex porphyreolophus | Gallirex porphyreolophus | Gallirex porphyreolophus | captive, Poland | S3 | 1 | 6 |
Tauraco leucotis | Menelikornis leucotis | Menelikornis leucotis | captive, Poland | S4 | 1 | 2 |
Musophaga violacea | Musophaga violacea | Musophaga violacea | Wrocław Zoo | S5 | 3 | 4 |
Tauraco erythrolophus | Tauraco erythrolophus | Proturacus erythrolophus | captive, Poland | S6 | 19 | 13 |
Tauraco leucolophus | Tauraco leucolophus | Proturacus leucolophus | captive, Poland | S7 | 1 | 2 |
Tauraco persa bufoni | Tauraco persa bufoni | Tauraco buffoni | captive, Poland | S8 | 1 | 3 |
Tauraco fischeri | Tauraco fischeri | Tauraco fischeri | captive, Poland | S9 | 1 | 1 |
Tauraco hartlaubi | Tauraco hartlaubi | Tauraco hartlaubi | captive, Poland | S10 | 5 | 2 |
Tauraco livingstonii | Tauraco livingstonii | Tauraco livingstonii | captive, Poland | S11 | 1 | 3 |
Tauraco persa persa | Tauraco persa persa | Tauraco persa | captive, Poland | S12 | 3 | 5 |
Tauraco schalowi | Tauraco schalowi | Tauraco schalowi | captive, Poland | S13 | 2 | 1 |
Tauraco schuettii | Tauraco schuettii | Tauraco schuettii | captive, Poland | S14 | 1 * | 1 |
Marker | Primer | ||
---|---|---|---|
Name | Sequence | Reference | |
M1 | P2 | TCTGCATCGCTAAATCCTTT | [34] |
P8 | CTCCCAAGGATGAGRAAYTG | [34] | |
M2 | 1272H | TCCAGAATATCTTCTGCTCC | [35] |
1237L | GAGAAACTGTGCAAAACAG | [35] | |
M3 | CHD1i9-F | CAGCAGAAATCAATCCAAGAC | [11] |
CHD1i9-R | CAGCCCATTTAACTGATAATCTC | [11] | |
M4 | 2550F | GTTACTGATTCGTCTACGAGA | [17] |
2718R | ATTGAAATGATCCAGTGCTTG | [17] | |
M5 | CHD1i16-F | GTCCTGATTTTCTCACAGATGG | [11] |
CHD1i16-R | ATGATCCAGTGCTTGTTTCC | [11] | |
M6 | USP1 | CTATGCCTACCACMTTCCTATTTGC | [28] |
USP3 | AGAAGATGSWCTGAARTCCAGCT | [28] | |
M7 | NIPBLi16-F | TTGTCAGAGTTGCTGGAGATAC | [11] |
NIPBLi16-R | AATTTGATGGCACATAACTGTAG | [11] |
Marker | Primer | Amplicon Length (bp) | Gene—Localisation | |
---|---|---|---|---|
Name | Position | |||
M1 | P2 | 43,533 | 367 | CHD1-E22(30 bp)/I22 (185 bp)/E23(152 bp) |
P8 | 43,167 | |||
M2 | 1272H | 43,178 | 258 | CHD1-E22(19 bp)/I22 (185 bp)/E23(54 bp) |
1237L | 43,435 | |||
M3 | CHD1i9-F | 29,350 | 2997 | CHD1-E9 (43 bp)/I9 (2852 bp)/E10 (102 bp) |
CHD1i9-R | 32,346 | |||
M4 | 2550F | 38,324 | 504 | CHD1-E16 (112 bp)/I16 (335 bp)/E17 (57 bp) |
2718R | 38,827 | |||
M5 | CHD1i16-F | 38,358 | 464 | CHD1-E16 (78 bp)/I16 (335 bp)/E17 (51 bp) |
CHD1i16-R | 38,821 | |||
M6 | USP1 | unknown | unknown | SPIN-unknown |
USP3 | unknown | |||
M7 | NIPBLi16-F | 68,920 | 923 | NIPBL-E17 (54 bp)/I17 (801 bp)/E18 (68 bp) |
NIPBLi16-R | 69,842 |
Species | Sex | Biosample | M1 | M2 | M3 | |||
---|---|---|---|---|---|---|---|---|
Accession | L (bp) | Accession | L (bp) | Accession | L (bp) | |||
C. concolor | Female | SAMN12253899 | VXAM01002689.1 | 364 | VXAM01002689.1 | 255 | VXAM01004202.1 | 2996 |
C. concolor | Female | SAMN12253899 | VXAM01001990.1 | 364 | VXAM01001990.1 | 255 | − | − |
C. cristata | Male | SAMN12253763 | − | − | − | − | WBMX01005567.1 | 2975 |
T. erythrolophus | Male | SAMN02339893 | NW_010038079.1 | 367 | NW_010038079.1 | 258 | NW_010038079.1 | 2997 |
T. erythrolophus | Female | SAMN12621036 | WOXW01000129.1 | 367 * | WOXW01000129.1 | 258 * | WOXW01000129.1 | 2997 * |
T. erythrolophus | Female | SAMN12621036 | WOXW01000076.1 | 378 ** | WOXW01000076.1 | 269 ** | WOXW01000076.1 | 623 ** |
Species | Sex | Biosample | M4 | M5 | M7 | |||
Accession | L (bp) | Accession | L (bp) | Accession | L (bp) | |||
C. concolor | Female | SAMN12253899 | VXAM01003074.1 | 503 | VXAM01003074.1 | 463 | − | − |
C. concolor | Female | SAMN12253900 | VXAM01001990.1 | 503 | VXAM01001990.1 | 463 | VXAM01001797.1 | 510 |
C. cristata | Male | SAMN12253763 | WBMX01003140.1 | 672 | WBMX01003140.1 | 632 | WBMX01031976.1(p) | 526 (p) |
T. erythrolophus | Male | SAMN02339893 | NW_010038079.1 | 504 | NW_010038079.1 | 464 | NW_010032872.1 | 923 |
T. erythrolophus | Female | SAMN12621036 | WOXW01000129.1 | 504 * | WOXW01000129.1 | 464 * | WOXW01000129.1 | 923 * |
T. erythrolophus | Female | SAMN12621036 | WOXW01000076.1 | 461 ** | WOXW01000076.1 | 421 ** | WOXW01000067.1 | 510 ** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kroczak, A.; Wierzbicki, H.; Urantówka, A.D. In Silico Analysis of Seven PCR Markers Developed from the CHD1, NIPBL and SPIN Genes Followed by Laboratory Testing Shows How to Reliably Determine the Sex of Musophagiformes Species. Genes 2022, 13, 932. https://doi.org/10.3390/genes13050932
Kroczak A, Wierzbicki H, Urantówka AD. In Silico Analysis of Seven PCR Markers Developed from the CHD1, NIPBL and SPIN Genes Followed by Laboratory Testing Shows How to Reliably Determine the Sex of Musophagiformes Species. Genes. 2022; 13(5):932. https://doi.org/10.3390/genes13050932
Chicago/Turabian StyleKroczak, Aleksandra, Heliodor Wierzbicki, and Adam Dawid Urantówka. 2022. "In Silico Analysis of Seven PCR Markers Developed from the CHD1, NIPBL and SPIN Genes Followed by Laboratory Testing Shows How to Reliably Determine the Sex of Musophagiformes Species" Genes 13, no. 5: 932. https://doi.org/10.3390/genes13050932
APA StyleKroczak, A., Wierzbicki, H., & Urantówka, A. D. (2022). In Silico Analysis of Seven PCR Markers Developed from the CHD1, NIPBL and SPIN Genes Followed by Laboratory Testing Shows How to Reliably Determine the Sex of Musophagiformes Species. Genes, 13(5), 932. https://doi.org/10.3390/genes13050932