Analysis of Long Non-Coding RNA (lncRNA) uc.38 and uc.63 Expression in Breast Carcinoma Patients
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Analysis of Expression of lncRNA uc.38 and uc.63 in Breast Cancer in Women
Isolation of RNA from Tissues Fixed in Paraffin
2.3. Spectrophotometric Analysis of Purity and RNA Concentration
2.4. Reverse Transcription Reaction
2.5. PCR Response with Real-Time Product Increment Analysis (Real Time PCR)
2.6. Statistical Analysis of Results
3. Results
- With regard to the T trait, there was a statistically significant decrease in the expression of uc.38 in preparations classified as T3 in relation to the group of preparations classified as T2 (p < 0.05);
- With respect to the TNM stage, there was a statistically significant decrease in the expression of uc.38 in stage IV for stages I, II and III, p values < 0.05 in all three cases;
- With regard to the expression of ER, PR and HER2 receptors, statistically significantly lower expression of uc.38 was demonstrated in the group of preparations expressing all three receptors, compared to the group of preparations not expressing ER, PR, and HER2 receptors (p = 0.018).
- With regard to the M trait, a statistically significant decrease in the expression of uc.63 in preparations classified as M0 was observed in relation to the group of preparations classified as M1 (p = 0.036);
- With regard to the expression of the HER2 receptor, there was a statistically significant increase in the expression of uc.63 in preparations characterized by the expression of this receptor in relation to preparations not expressing this receptor, p value = 0.035.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bellanger, M.; Zeinomar, N.; Tehranifar, P.; Terry, M.B. Are Global Breast Cancer Incidence and Mortality Patterns Related to Country-Specific Economic Development and Prevention Strategies? J. Glob. Oncol. 2018, 4, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Francies, F.Z.; Hull, R.; Khanyile, R.; Dlamini, Z. Breast cancer in low-middle income countries: Abnormality in splicing and lack of targeted treatment options. Am. J. Cancer Res. 2020, 10, 1568–1591. [Google Scholar] [PubMed]
- Kudela, E.; Samec, M.; Kubatka, P.; Nachajova, M.; Laucekova, Z.; Liskova, A.; Dokus, K.; Biringer, K.; Simova, D.; Gabonova, E.; et al. Breast Cancer in Young Women: Status Quo and Advanced Disease Management by a Predictive, Preventive, and Personalized Approach. Cancers 2019, 11, 1791. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Torre, L.A.; Islami, F.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global Cancer in Women: Burden and Trends. Cancer Epidemiol. Biomark. Prev. 2017, 26, 444–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghoncheh, M.; Pournamdar, Z.; Salehiniya, H. Incidence and Mortality and Epidemiology of Breast Cancer in the World. Asian Pac. J. Cancer Prev. 2016, 17, 43–46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DeSantis, C.E.; Bray, F.; Ferlay, J.; Lortet-Tieulent, J.; Anderson, B.O.; Jemal, A. International Variation in Female Breast Cancer Incidence and Mortality Rates. Cancer Epidemiol. Biomark. Prev. 2015, 24, 1495–1506. [Google Scholar] [CrossRef] [Green Version]
- Franceschi, S.; Wild, C.P. Meeting the global demands of epidemiologic transition—the indispensable role of cancer prevention. Mol. Oncol. 2013, 7, 1–13. [Google Scholar] [CrossRef]
- Brinton, L.A.; Schairer, C.; Hoover, R.N.; Fraumeni, J.F., Jr. Menstrual Factors and Risk of Breast Cancer. Cancer Investig. 1988, 6, 245–254. [Google Scholar] [CrossRef]
- Collaborative Group on Hormonal Factors in Breast Cancer. Menarche, menopause, and breast cancer risk: Individual participant meta-analysis, including 118,964 women with breast cancer from 117 epidemiological studies. Lancet Oncol. 2012, 13, 1141–1151. [Google Scholar] [CrossRef]
- Clavel-Chapelon, F.; Gerber, M. Reproductive Factors and Breast Cancer Risk. Do They Differ According to Age at Diagnosis? Breast Cancer Res. Treat 2002, 72, 107–115. [Google Scholar] [CrossRef] [Green Version]
- Bhaskaran, M.; Mohan, M. MicroRNAs: History, biogenesis, and their evolving role in animal development and disease. Vet. Pathol. 2014, 51, 759–774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loh, H.Y.; Norman, B.P.; Lai, K.S.; Rahman, N.; Alitheen, N.; Osman, M.A. The Regulatory Role of MicroRNAs in Breast Cancer. Int. J. Mol. Sci. 2019, 20, 4940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chi, Y.; Wang, D.; Wang, J.; Yu, W.; Yang, J. Long Non-Coding RNA in the Pathogenesis of Cancers. Cells 2019, 8, 1015. [Google Scholar] [CrossRef] [Green Version]
- Olivero, C.E.; Dimitrova, N. Identification and characterization of functional long noncoding RNAs in cancer. FASEB J. 2020, 34, 15630–15646. [Google Scholar] [CrossRef] [PubMed]
- Smolarz, B.; Zadrożna-Nowak, A.; Romanowicz, H. The Role of lncRNA in the Development of Tumors, including Breast Cancer. Int. J. Mol. Sci. 2021, 22, 8427. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Meng, H.; Bai, Y.; Wang, K. Regulation of lncRNA and Its Role in Cancer Metastasis. Oncol. Res. 2016, 23, 205–217. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Li, Z.; Chen, X.; Zhang, S. Long non-coding RNAs: From disease code to drug role. Acta Pharm. Sin. B 2021, 11, 340–354. [Google Scholar] [CrossRef]
- Mestdagh, P.; Fredlund, E.; Pattyn, F.; Rihani, A.; Van Maerken, T.; Vermeulen, J.; Kumps, C.; Menten, B.; De Preter, K.; Schramm, A.; et al. An integrative genomics screen uncovers ncRNA T-UCR functions in neuroblastoma tumours. Oncogene 2010, 29, 3583–3592. [Google Scholar] [CrossRef]
- Bradner, J.E.; Hnisz, D.; Young, R.A. Transcriptional Addiction in Cancer. Cell 2017, 168, 629–643. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Liu, Q.; Shyr, Y. Dysregulated transcription across diverse cancer types reveals the importance of RNA-binding protein in carcinogenesis. BMC Genom. 2015, 16, S5. [Google Scholar] [CrossRef] [Green Version]
- Laget, S.; Defossez, P.A. Master and servant: Epigenetic deregulations as a cause and a consequence of cancer. Med. Sci. 2008, 24, 725–730. [Google Scholar]
- Yang, R.; Frank, B.; Hemminki, K.; Bartram, C.R.; Wappenschmidt, B.; Sutter, C.; Kiechle, M.; Bugert, P.; Schmutzler, R.K.; Arnold, N.; et al. SNPs in ultraconserved elements and familial breast cancer risk. Carcinogenesis 2008, 29, 351–355. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Catucci, I.; Verderio, P.; Pizzamiglio, S.; Manoukian, S.; Peissel, B.; Barile, M.; Tizzoni, L.; Bernard, L.; Ravagnani, F.; Galastri, L.; et al. SNPs in ultraconserved elements and familial breast cancer risk. Carcinogenesis 2009, 30, 544–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, H.; Lu, C.; Jiang, Y.; Tang, J.; Chen, W.; Zhang, H.; Zhang, Q.; Wang, J.; Liang, J.; Hu, Z.; et al. Genetic variants in ultraconserved elements and risk of breast cancer in Chinese population. Breast Cancer Res. Treat. 2011, 128, 855–861. [Google Scholar] [CrossRef]
- Suvanto, M.; Beesley, J.; Blomqvist, C.; Chenevix-Trench, G.; Khan, S.; Nevanlinna, H. SNPs in lncRNA Regions and Breast Cancer Risk. Front. Genet. 2020, 11, 550. [Google Scholar] [CrossRef]
- Tian, T.; Wang, M.; Lin, S.; Guo, Y.; Dai, Z.; Liu, K.; Yang, P.; Dai, C.; Zhu, Y.; Zheng, Y.; et al. The Impact of lncRNA Dysregulation on Clinicopathology and Survival of Breast Cancer: A Systematic Review and Meta-analysis. Mol. Ther. Nucleic. Acids 2018, 12, 359–369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marini, A.; Lena, A.M.; Panatta, E.; Ivan, C.; Han, L.; Liang, H.; Annicchiarico-Petruzzelli, M.; Di Daniele, N.; Calin, G.A.; Candi, E.; et al. Ultraconserved long non-coding RNA uc.63 in breast cancer. Oncotarget 2017, 8, 35669–35680. [Google Scholar] [CrossRef]
- Zhang, L.X.; Xu, L.; Zhang, C.H.; Lu, Y.H.; Ji, T.H.; Ling, L.J. uc.38 induces breast cancer cell apoptosis via PBX1. Am. J. Cancer Res. 2017, 7, 2438–2451. [Google Scholar] [PubMed]
- Körbler, T.; Grsković, M.; Dominis, M.; Antica, M. A simple method for RNA isolation from formalin-fixed and paraffin-embedded lymphatic tissues. Exp. Mol. Pathol. 2003, 74, 336–340. [Google Scholar] [CrossRef]
- Huarte, M. The emerging role of lncRNAs in cancer. Nat. Med. 2015, 21, 1253–1261. [Google Scholar] [CrossRef]
- Sánchez, Y.; Segura, V.; Marín-Béjar, O.; Athie, A.; Marchese, F.P.; González, J.; Bujanda, L.; Guo, S.; Matheu, A.; Huarte, M. Genome-wide analysis of the human p53 transcriptional network unveils a lncRNA tumour suppressor signature. Nat. Commun. 2014, 5, 5812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Test Group n (%) | Control Group n (%) | pa | |
---|---|---|---|
Group size Age, number of years <50 years ≥50 years Menopausal status pre peri post no data available | n = 100 56.76 ± 12.01 27 (27.0) 73 (73.0) 24 (24.0) 3 (3.0) 66 (66.0) 7 (7.0) | n = 100 59 ± 13.17 36 (36.0) 64 (64.0) | 0.17 |
Variable | Test Group n (%) | |
---|---|---|
TNM grade | T1 | 23(23.0) |
T2 | 57 (57.0) | |
T3 | 17 (17.0) | |
T4 | 3 (3.0) | |
NX | 1 (1.0) | |
N0 | 55 (54.0) | |
N1 | 25 (25.0) | |
N2 | 13 (13.0) | |
N3 | 6 (6.0) | |
MX | 3 (3.0) | |
M0 | 92 (92.0) | |
M1 | 5 (5.0) | |
Stage | I | 19 |
II | 58 | |
III | 18 | |
IV | 5 |
Variable | Test Group n (%) | |
---|---|---|
gene expression profile/IHC | luminal A ER+ PR+, HER2– | 56 (56.0) |
luminal B ER+ PR+, HER2+ | 23 (23.0) | |
basal-like ER–, PR–, HER2– | 9 (9.0) | |
HER2-like ER–, PR–, HER2+ | 12 (12.0) |
Location | Sequence | |
---|---|---|
uc.38 | Chr 1:163939955-162206802 upstream CDCA1 downstream PBX1 | CCTTGAACCTGCTGGAAGAGTTAGTATGTAAATTTCAACCTATTTTTAAGGGTTATTTTCACTCAAGTGAAATCTATCAAGGAAGGAGGGTTATTTTTACAGCATACAGCAACTGCTGATCACCATGGCAACCGGCCTGGTGAAATGCAATAAAGCATCCCTCTGTTATCGTAAACACAAAAGGGAAACACTGAAATCTAAAAGAAAGGCAATTATTGTAG |
uc.63 | Chr 2:61752501-617552778 upstream USP34 downstream AK023367 | TGATTAATATCAGGTAGTGTTAACATCTTTAAAGAAAAAAAAATGATTGCATAAAAGCCAAATGTCATAGTGCATAAATTTAGCACCAAATCATTTGTAATTTATGTAAATTGAAGAATTCTTTACCTGTTGCTTTCTTTCTGTTCCTCTAATCATCTCATTTTTCACAAGACAAATTTGAGTTTTTAAAAATACTGTTGATAAATCAACTTAAACATTAGTAATGTCTGTCAGTATAAAAAGCAAAATTTACCAGGCAAGCAAACAGGCAAACACTG |
GAPDH | GAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTC |
uc. | Test Material | Median | Percentile 25 | Percentile 75 | pa |
---|---|---|---|---|---|
uc.38 | Carcinoma | 700.91 | 574.49 | 921.24 | <0.0001 |
Control | 1262.788 | 866.84 | 1786.67 | ||
uc.63 | Carcinoma | 226.85 | 186.47 | 310.51 | <0.0001 |
Control | 133.62 | 97.18 | 168.92 |
uc. | Menopausal Status | Median | Percentile 25 | Percentile 75 | p a |
---|---|---|---|---|---|
u.38 | Pre | 664.31 | 472.99 | 788.95 | >0.05 |
Peri | 1012.44 | 966.09 | 1036.32 | ||
Post | 700.90 | 575.71 | 908.68 | ||
uc.63 | Pre | 255.03 | 188.68 | 323.74 | >0.05 |
Peri | 228.68 | 197.74 | 318.97 | ||
Post | 217.51 | 185.19 | 274.58 |
Feature | Median | Percentile 25 | Percentile 75 | p | |
---|---|---|---|---|---|
T | T1 | 666.77 | 544.95 | 881.92 | >0.05 |
T2 | 694.29 | 605.97 | 972.90 | T1 vs. T2 >0.05 | |
T3 | 481.38 | 324.74 | 757.17 | T1 vs. T3 >0.05 | |
T4 | 719.82 | 718.39 | 721.24 | T1 vs. T4 >0.05 | |
T2 vs. T3 <0.05 | |||||
T2 vs. T4 >0.05 | |||||
T3 vs. T4 >0.05 | |||||
N | N0 | 685.58 | 573.74 | 884.88 | >0.05 |
N1 | 690.81 | 470.99 | 853.45 | ||
N2 | 974.28 | 698.12 | 1134.43 | ||
N3 | 700.93 | 558.62 | 747.12 | ||
M | M0 | 696.21 | 574.49 | 930.85 | >0.05 |
M1 | 716.97 | 572.65 | 816.56 | ||
stage | I | 666.78 | 574.11 | 903.44 | 0.0085 |
II | 690.81 | 573.03 | 877.57 | I vs. II >0.05 | |
III | 764.54 | 658.77 | 1038.85 | I vs. III >0.05 | |
IV | 216.97 | 216.56 | 478.08 | I vs. IV <0.05 | |
II vs. III >0.05 | |||||
II vs. IV <0.05 | |||||
III vs. IV <0.01 | |||||
ER | ER+ | 712.73 | 573.74 | 941.13 | >0.05 |
ER− | 690.81 | 599.64 | 831.36 | ||
PR | PR+ | 716.97 | 574.87 | 925.72 | >0.05 |
PR− | 686.80 | 583.94 | 876.78 | ||
HER2 | HER2+ | 642.83 | 511.31 | 806.42 | >0.05 |
HER2− | 684.62 | 574.49 | 848.23 | ||
all | all+ | 424.31 | 351.80 | 496.82 | 0.018 |
all− | 684.89 | 611.90 | 786.72 |
Feature | Median | Percentile 25 | Percentile 75 | pa | |
---|---|---|---|---|---|
T | T1 | 238.76 | 178.09 | 312.67 | >0.05 |
T2 | 224.47 | 187.10 | 297.39 | ||
T3 | 239.62 | 215.31 | 323.33 | ||
T4 | 217.86 | 207.29 | 228.43 | ||
N | N0 | 224.82 | 168.75 | 282.96 | >0.05 |
N1 | 252.35 | 200.50 | 365.00 | ||
N2 | 215.31 | 178.45 | 242.48 | ||
N3 | 220.67 | 201.51 | 250.95 | ||
M | M0 | 227.91 | 187.51 | 310.51 | 0.036 |
M1 | 778.45 | 769.12 | 846.26 | ||
Stage | I | 253.32 | 180.68 | 312.67 | >0.05 |
II | 690.81 | 573.03 | 877.57 | ||
III | 233.07 | 200.13 | 257.67 | ||
IV | 178.45 | 169.11 | 196.73 | ||
ER | ER+ | 227.10 | 185.33 | 307.42 | >0.05 |
ER− | 226.65 | 192.29 | 294.47 | ||
PR | PR+ | 227.15 | 187.65 | 323.33 | >0.05 |
PR− | 225.48 | 185.81 | 290.92 | ||
HER2 | HER2+ | 281.48 | 265.70 | 311.86 | 0.035 |
HER2− | 220.87 | 186.47 | 258.51 | ||
all | all+ | 261.25 | 256.80 | 265.70 | >0.05 |
all− | 219.16 | 187.10 | 253.80 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zadrożna-Nowak, A.; Romanowicz, H.; Zadrożny, M.; Bryś, M.; Forma, E.; Smolarz, B. Analysis of Long Non-Coding RNA (lncRNA) uc.38 and uc.63 Expression in Breast Carcinoma Patients. Genes 2022, 13, 608. https://doi.org/10.3390/genes13040608
Zadrożna-Nowak A, Romanowicz H, Zadrożny M, Bryś M, Forma E, Smolarz B. Analysis of Long Non-Coding RNA (lncRNA) uc.38 and uc.63 Expression in Breast Carcinoma Patients. Genes. 2022; 13(4):608. https://doi.org/10.3390/genes13040608
Chicago/Turabian StyleZadrożna-Nowak, Anna, Hanna Romanowicz, Marek Zadrożny, Magdalena Bryś, Ewa Forma, and Beata Smolarz. 2022. "Analysis of Long Non-Coding RNA (lncRNA) uc.38 and uc.63 Expression in Breast Carcinoma Patients" Genes 13, no. 4: 608. https://doi.org/10.3390/genes13040608