Effect of the PmARF6 Gene from Masson Pine (Pinus massoniana) on the Development of Arabidopsis
Abstract
:1. Introduction
2. Materials and Methods
2.1. P. massoniana Plant Material
2.2. Total RNA Extraction and Coding DNA Sequence (CDS)
2.3. Bioinformatic Analyses
2.4. Protoplast Transfection in Masson Pine
2.5. Expression Analysis of the PmARF6 Gene by Real-Time PCR
2.6. Transformation of Arabidopsis
3. Results
3.1. Cloning and Analysis of PmARF6 in Masson Pine
3.2. Subcellular Localization and Expression Levels of PmARF6 in Masson Pine
3.3. Effects of PmARF6 Overexpression in Arabidopsis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yang, Z.; Xia, H.; Tan, J.; Feng, Y.; Huang, Y. Selection of superior families of Pinus massoniana in southern China for large-diameter construction timber. J. For. Res. 2018, 31, 475–484. [Google Scholar] [CrossRef]
- Bai, Y.; Zha, X.; Chen, S. Effects of the vegetation restoration years on soil microbial community composition and biomass in degraded lands in Changting County, China. J. For. Res. 2019, 31, 1295–1308. [Google Scholar] [CrossRef]
- Li, C.; Cheng, P.; Li, Z.; Xu, Y.; Sun, Y.; Qin, D.; Yu, G. Transcriptomic and Metabolomic Analyses Provide Insights into the Enhancement of Torulene and Torularhodin Production in Rhodotorula glutinis ZHK under Moderate Salt Conditions. J. Agric. Food Chem. 2021, 69, 11523–11533. [Google Scholar] [CrossRef] [PubMed]
- Yao, S.; Wu, F.; Hao, Q.; Ji, K. Transcriptome-Wide Identification of WRKY Transcription Factors and Their Expression Profiles under Different Types of Biological and Abiotic Stress in Pinus massoniana Lamb. Genes 2020, 11, 1386. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Yin, S.; Yu, Z.; Feng, Y.; Wei, K.; Ma, W.; Ge, L.; Yan, Z.; Zhu, R. Preliminary Characterization, Antioxidant and Hepatoprotective Activities of Polysaccharides from Taishan Pinus massoniana Pollen. Molecules 2018, 23, 281. [Google Scholar] [CrossRef] [Green Version]
- Chapman, E.J.; Estelle, M. Mechanism of auxin-regulated gene expression in plants. Annu. Rev. Genet. 2009, 43, 265–285. [Google Scholar] [CrossRef] [Green Version]
- Guilfoyle, T.J.; Hagen, G. Auxin Response Factors. J. Plant Growth. Regul. 2001, 20, 281–291. [Google Scholar] [CrossRef]
- Hagen, G.; Guilfoyle, T. Auxin-responsive gene expression: Genes, promoters and regulatory factors. Plant Mol. Biol. 2002, 49, 373–385. [Google Scholar] [CrossRef]
- Ellis, C.M.; Nagpal, P.; Young, J.C.; Hagen, G.; Guilfoyle, T.J.; Reed, J.W. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 2005, 132, 4563–4574. [Google Scholar] [CrossRef] [Green Version]
- Kelley, D.R.; Arreola, A.; Gallagher, T.L.; Gasser, C. ETTIN (ARF3) physically interacts with KANADI proteins to form a functional complex essential for integument development and polarity determination in Arabidopsis. Development 2012, 139, 1105–1109. [Google Scholar] [CrossRef] [Green Version]
- Hardtke, C.S.; Berleth, T. The Arabidopsis gene MONOPTEROS encodes a transcription factor mediating embryo axis formation and vascular development. EMBO J. 1998, 17, 1405–1411. [Google Scholar] [CrossRef] [PubMed]
- Nagpal, P.; Ellis, C.M.; Weber, H.; Ploense, S.E.; Barkawi, L.S.; Guilfoyle, T.J.; Hagen, G.; Alonso, J.M.; Cohen, J.D.; Farmer, E.E. Auxin response factors ARF6 and ARF8 promote jasmonic acid production and flower maturation. Development 2005, 132, 4107–4118. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, M.F.; Tian, Q.; Reed, J.W. Arabidopsis microRNA167 controls patterns of ARF6 and ARF8 expression, and regulates both female and male reproduction. Development 2006, 133, 4211–4218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilmoth, J.C.; Wang, S.; Tiwari, S.B.; Joshi, A.D.; Hagen, G.; Guilfoyle, T.J.; Alonso, J.M.; Ecker, J.R.; Reed, J.W. NPH4/ARF7 and ARF19 promote leaf expansion and auxin-induced lateral root formation. Plant J. 2005, 43, 118–130. [Google Scholar] [CrossRef]
- Hu, W.; Zuo, J.; Hou, X.; Yan, Y.; Wei, Y.; Liu, J.; Li, M.; Xu, B.; Jin, Z. The auxin response factor gene family in banana: Genome-wide identification and expression analyses during development, ripening, and abiotic stress. Front. Plant Sci. 2015, 6, 742–758. [Google Scholar] [CrossRef] [Green Version]
- Su, Z.; Wang, L.; Li, W.; Zhao, L.; Huang, X.; Azam, S.M.; Qin, Y. Genome-Wide Identification of Auxin Response Factor (ARF) Genes Family and its Tissue-Specific Prominent Expression in Pineapple (Ananas comosus). Trop. Plant Biol. 2017, 10, 86–96. [Google Scholar] [CrossRef]
- Yang, Z.; Geng, X.; He, C.; Zhang, F.; Wang, R.; Horst, W.J.; Ding, Z. TAA1-regulated local auxin biosynthesis in the root-apex transition zone mediates the aluminum-induced inhibition of root growth in Arabidopsis. Plant Cell 2014, 26, 2889–2904. [Google Scholar] [CrossRef] [Green Version]
- Qiao, L.; Zhang, W.; Li, X.; Zhang, L.; Zhang, X.; Li, X.; Guo, H.; Ren, Y.; Zheng, J.; Chang, Z. Characterization and Expression Patterns of Auxin Response Factors in Wheat. Front. Plant Sci. 2018, 9, 1395. [Google Scholar] [CrossRef]
- Ye, Y.; Wang, J.; Ni, Z.; Meng, X.; Feng, Y.; Yang, Z.; Xu, L. Small RNA and degradome sequencing reveal roles of miRNAs in strobilus development in masson pine (Pinus massoniana). Ind. Crops Prod. 2020, 154, 423. [Google Scholar] [CrossRef]
- Yang, C.; Xu, M.; Xuan, L.; Jiang, X.; Huang, M. Identification and expression analysis of twenty ARF genes in Populus. Genes 2014, 544, 134–144. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, T.; Xin, Y.; Wang, G.; Xu, L.A. Overexpression of the GbF3′H1 Gene Enhanced the Epigallocatechin, Gallocatechin, and Catechin Contents in Transgenic Populus. J. Agric. Food Chem. 2020, 68, 998–1006. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Xie, W.; Huang, M. Two WUSCHEL-related HOMEOBOX genes, PeWOX11a and PeWOX11b, are involved in adventitious root formation of poplar. Physiol. Plant. 2015, 155, 446–456. [Google Scholar] [CrossRef] [PubMed]
- Huang, B.; Rong, H.; Ye, Y.; Ni, Z.; Xu, M.; Zhang, W.; Xu, L.A. Transcriptomic analysis of flower color variation in the ornamental crabapple (Malus spp.) half-sib family through Illumina and PacBio Sequel sequencing. Plant Physiol. Biochem. 2020, 149, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Holsters, M.; Waele, D.; Depicker, A.; Messens, E.; Schell, J. Transfection and transformation of Agrobacterium tumefaciens. Molec. gen. Genet. 1978, 163, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Pei, K.; Fu, Y.; Sun, Z.; Li, S.; Liu, H.; Tang, K.; Han, B.; Tao, Y. Genome-wide analysis of the auxin response factors (ARF) gene family in rice (Oryza sativa). Genes 2007, 394, 13–24. [Google Scholar] [CrossRef]
- Ulmasov, T.; Murfett, J.; Hagen, G. Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 1997, 9, 1963–1971. [Google Scholar]
- Altenhoff, A.M.; Dessimoz, C. Phylogenetic and functional assessment of orthologs inference projects and methods. PLoS Comput. Biol. 2009, 5, e1000262. [Google Scholar] [CrossRef] [Green Version]
- Ulmasov, T.; Hagen, G.; Guilfoyle, T.J. Dimerization and DNA binding of auxin response factors. Plant J. 1999, 19, 309–319. [Google Scholar] [CrossRef]
- Kalluri, U.C.; Difazio, S.P.; Brunner, A.M.; Tuskan, G.A. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa. BMC Plant Biol. 2007, 7, 59. [Google Scholar] [CrossRef] [Green Version]
- D’Souza-Schorey, C.; Li, G.; Colombo, M.I.; Stahl, P. A regulatory role for ARF6 in receptor-mediated endocytosis. Science 1995, 267, 1175–1178. [Google Scholar] [CrossRef]
- Liu, K.; Yuan, C.; Li, H.; Lin, W.; Yang, Y.; Shen, C.; Zheng, X. Genome-wide identification and characterization of Auxin Response Factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.). BMC Genom. 2015, 16, 901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reed, J.W. Roles and activities of Aux/IAA proteins in Arabidopsis. Trends Plant Sci. 2001, 6, 420–425. [Google Scholar] [CrossRef]
- Liscum, E.; Reed, J.W. Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol. Biol. 2002, 49, 387–400. [Google Scholar] [CrossRef]
- Kim, J.; Harter, K.; Theologis, A. Protein-protein interactions among the Aux/IAA proteins. Proc. Natl. Acad. Sci. USA 1997, 94, 11786–11791. [Google Scholar] [CrossRef] [Green Version]
- Yu, H.; Soler, M.; Mila, I.; San Clemente, H.; Savelli, B.; Dunand, C.; Paiva, J.A.; Myburg, A.A.; Bouzayen, M.; Grima-Pettenati, J. Genome-wide characterization and expression profiling of the Auxin Response Factor (ARF) gene family in Eucalyptus grandis. PLoS ONE 2014, 9, e108906. [Google Scholar] [CrossRef] [Green Version]
- Vernoux, T.; Brunoud, G.; Farcot, E.; Morin, V.; Van den Daele, H.; Legrand, J.; Oliva, M.; Das, P.; Larrieu, A.; Wells, D. The auxin signalling network translates dynamic input into robust patterning at the shoot apex. Mol. Syst. Biol. 2011, 7, 508. [Google Scholar] [CrossRef]
- Finet, C.; Jaillais, Y. Auxology: When auxin meets plant evo-devo. Dev. Biol. 2012, 369, 19–31. [Google Scholar] [CrossRef] [Green Version]
Primer Name | Primer Sequence |
---|---|
5′ outer PmARF6 | GAGATTGGGATGATGAGAGCTG |
5′ inner PmARF6 | GAATTCATAGAGAACCCAGA |
3′ outer PmARF6 | CGCCGTGCTGCTGAGAAAGTGT |
3′ inner PmARF6 | ATGACATTACAGCCGTTAAA |
ORF-F | ATGACATTACAGCCGTTAAA |
ORF-R | GAATTCATAGAGAACCCAGA |
PmARF6-qF | GCGCTTCCGGATGCTGTTTG |
PmARF6-qR | CTCGTGGCTGCCTCTCACC |
UXS-qF | CGCCGGATTTCGCCCTCTTT |
UXS-qR | CGTATCGGATCGGCCAAGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, Y.; Han, X.; Rong, H.; Qian, R.; Zheng, J.; Ni, Z.; Xu, L. Effect of the PmARF6 Gene from Masson Pine (Pinus massoniana) on the Development of Arabidopsis. Genes 2022, 13, 469. https://doi.org/10.3390/genes13030469
Ye Y, Han X, Rong H, Qian R, Zheng J, Ni Z, Xu L. Effect of the PmARF6 Gene from Masson Pine (Pinus massoniana) on the Development of Arabidopsis. Genes. 2022; 13(3):469. https://doi.org/10.3390/genes13030469
Chicago/Turabian StyleYe, Youju, Xin Han, Hao Rong, Renjuan Qian, Jian Zheng, Zhouxian Ni, and Li’an Xu. 2022. "Effect of the PmARF6 Gene from Masson Pine (Pinus massoniana) on the Development of Arabidopsis" Genes 13, no. 3: 469. https://doi.org/10.3390/genes13030469