Ssc-miR-141 Attenuates Hypoxia-Induced Alveolar Type II Epithelial Cell Injury in Tibetan Pigs by Targeting PDCD4
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Ssc-miR-141 Target Gene Prediction and Functional Enrichment Analysis
2.3. Screening of Target Genes Related to Hypoxia Resistance in ATII Cells
2.4. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.5. Construction of Recombinant Plasmid
2.6. Cell Culture and Transfection
2.7. Dual-Luciferase Reporter Gene Activity Assay
2.8. Statistical Analysis
3. Results
3.1. Ssc-miR-141 Target Gene Prediction
3.2. GO and KEGG Pathway Enrichment Analysis of Ssc-miR-141 Target Genes
3.3. RT-qPCR Analysis
3.4. Analysis of Ssc-miR-141–Binding Site in PDCD4 3′-UTR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gonpo, T.; Liang, Y. On the Recognition to the Ecolgical Safety Issues of Qinghai-Tibet Plateau; Tibetan Studies: Varanasi, India, 2012. [Google Scholar]
- Li, F.; Qiao, Z.; Duan, Q.; Nevo, E. Adaptation of mammals to hypoxia. Anim. Model. Exp. Med. 2021, 4, 311–318. [Google Scholar] [CrossRef] [PubMed]
- Moore, L.G. Measuring high-altitude adaptation. J. Appl. Physiol. 2017, 123, 1371–1385. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Han, X.; Huang, C.; Zhong, L.; Adeola, A.C.; Irwin, D.M.; Xie, H.; Zhang, Y. Population Genomics Analysis Revealed Origin and High-altitude Adaptation of Tibetan Pigs. Sci. Rep. 2019, 9, 11463. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Yuan, H.; Yang, T.; Li, Y.; Gao, C.; Jiao, T.; Cai, Y.; Zhao, S. The Expression Regulatory Network in the Lung Tissue of Tibetan Pigs Provides Insight Into Hypoxia-Sensitive Pathways in High-Altitude Hypoxia. Front. Genet. 2021, 12, 691592. [Google Scholar] [CrossRef] [PubMed]
- Qi, S.; Chen, J.; Guo, R.; Yu, B.; Chen, D. β-defensins gene expression in tissues of the crossbred and Tibetan pigs. Livest. Sci. 2009, 123, 161–168. [Google Scholar] [CrossRef]
- Yang, Y.; Gao, C.; Yang, T.; Sha, Y.; Cai, Y.; Wang, X.; Yang, Q.; Liu, C.; Wang, B.; Zhao, S. Characteristics of Tibetan pig lung tissue in response to a hypoxic environment on the Qinghai-Tibet Plateau. Arch. Anim. Breed. 2021, 64, 283–292. [Google Scholar] [CrossRef]
- Shang, P.; Li, W.; Tan, Z.; Zhang, J.; Dong, S.; Wang, K.; Chamba, Y. Population Genetic Analysis of Ten Geographically Isolated Tibetan Pig Populations. Animals 2020, 10, 1297. [Google Scholar] [CrossRef]
- Niethamer, T.K.; Stabler, C.T.; Leach, J.P.; Zepp, J.A.; Morley, M.P.; Babu, A.; Zhou, S.; Morrisey, E.E. Defining the role of pulmonary endothelial cell heterogeneity in the response to acute lung injury. Elife 2020, 9, e53072. [Google Scholar] [CrossRef]
- Sydykov, A.; Mamazhakypov, A.; Maripov, A.; Kosanovic, D.; Weissmann, N.; Ghofrani, H.A.; Sarybaev, A.S.; Schermuly, R.T. Pulmonary Hypertension in Acute and Chronic High Altitude Maladaptation Disorders. Int. J. Environ. Res. Public Health 2021, 18, 1692. [Google Scholar] [CrossRef]
- Delbrel, E.; Soumare, A.; Naguez, A.; Label, R.; Bernard, O.; Bruhat, A.; Fafournoux, P.; Tremblais, G.; Marchant, D.; Gille, T.; et al. HIF-1α triggers ER stress and CHOP-mediated apoptosis in alveolar epithelial cells, a key event in pulmonary fibrosis. Sci. Rep. 2018, 8, 17939. [Google Scholar] [CrossRef]
- Mckechnie, S.; Harrison, D.; Mcelroy, M. Hyperoxia inhibits alveolar epithelial repair by inhibiting the transdifferentiation of alveolar epithelial type II cells into type I cells. Crit. Care 2008, 12, 1. [Google Scholar] [CrossRef]
- Royce, S.G.; Patel, K.P.; Mao, W.; Zhu, D.; Lim, R.; Samuel, C.S. Serelaxin enhances the therapeutic effects of human amnion epi-thelial cell-derived exosomes in experimental models of lung disease. Br. J. Pharmacol. 2019, 176, 2195–2208. [Google Scholar] [PubMed]
- Li, Q.; Chen, X.; Li, J. Marrow-derived mesenchymal stem cells regulate the inflammatory response and repair alveolar type II epithelial cells in acute lung injury of rats. J. Int. Med. Res. 2020, 48, 0300060520909027. [Google Scholar] [CrossRef] [PubMed]
- Yazicioglu, T.; Mühlfeld, C.; Autilio, C.; Huang, C.K.; Bär, C.; Dittrich-Breiholz, O.; Thum, T.; Pérez-Gil, J.; Schmiedl, A.; Branden-berger, C. Aging impairs alveolar epithelial type II cell function in acute lung injury. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2020, 319, L755–L769. [Google Scholar] [CrossRef]
- Li, L.; Jiang, D. Hypoxia-responsive miRNA-21-5p inhibits Runx2 suppression by targeting SMAD7 in MC3T3-E1 cells. J. Cell. Biochem. 2019, 120, 16867–16875. [Google Scholar] [CrossRef]
- Ren, S.; Liu, J.; Feng, Y.; Li, Z.; He, L.; Li, L.; Cao, X.; Wang, Z.; Zhang, Y. Knockdown of circDENND4C inhibits glycolysis, migration and invasion by up-regulating miR-200b/c in breast cancer under hypoxia. J. Exp. Clin. Cancer Res. 2019, 38, 1–12. [Google Scholar] [CrossRef]
- Chen, J.; Chen, J.; Cheng, Y.; Fu, Y.; Zhao, H.; Tang, M.; Zhao, H.; Lin, N.; Shi, X.; Lei, Y.; et al. Mes-enchymal stem cell-derived exosomes protect beta cells against hypoxia-induced apoptosis via miR-21 by alleviating ER stress and inhibiting p38 MAPK phosphorylation. Stem Cell Res. Ther. 2020, 11, 1–13. [Google Scholar]
- Wu, L.; Xi, Y.; Kong, Q. Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1α. Artif. Cells Nanomed. Biotechnol. 2020, 48, 506–514. [Google Scholar] [CrossRef]
- Taguchi, A.; Yanagisawa, K.; Tanaka, M.; Cao, K.; Matsuyama, Y.; Goto, H.; Takahashi, T. Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster. Cancer Res. 2008, 68, 5540–5545. [Google Scholar] [CrossRef]
- Lei, Z.; Li, B.; Yang, Z.; Fang, H.; Zhang, G.M.; Feng, Z.H.; Huang, B. Regulation of HIF-1alpha and VEGF by miR-20b tunes tumor cells to adapt to the alteration of oxygen concentration. PLoS ONE 2009, 4, e7629. [Google Scholar] [CrossRef]
- Crosby, M.E.; Kulshreshtha, R.; Ivan, M.; Glazer, P.M. MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009, 69, 1221–1229. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Ding, L.; Bennewith, K.L.; Tong, R.T.; Welford, S.M.; Ang, K.K.; Story, M.; Le, Q.T.; Giaccia, A.J. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. Mol. Cell 2009, 35, 856–867. [Google Scholar] [CrossRef] [PubMed]
- Kulshreshtha, R.; Ferracin, M.; Wojcik, S.E.; Garzon, R.; Alder, H.; Agosto-Perez, F.J.; Davuluri, R.; Liu, C.; Croce, C.M.; Negrini, M.; et al. A microRNA signature of hypoxia. Mol. Cell Biol. 2007, 27, 1859–1867. [Google Scholar] [CrossRef] [PubMed]
- Yao, B.; Wan, X.; Zheng, X.; Zhong, T.; Hu, J.; Zhou, Y.; Qin, A.; Ma, Y.; Yin, D. Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis. Cell Biosci. 2020, 10, 1–10. [Google Scholar] [CrossRef]
- Qiu, W.; Kassem, M. miR-141-3p inhibits human stromal (mesenchymal) stem cell proliferation and differentiation. Biochim. Et Biophys. Acta (BBA)-Mol. Cell Res. 2014, 1843, 2114–2121. [Google Scholar] [CrossRef]
- Yang, M.; Ling, X.; Xiao, J. miR-141 exacerbates lung ischemia-reperfusion injury by targeting EGFR/β-catenin axis-mediated autophagy. Aging 2022, 14, 6507. [Google Scholar] [CrossRef]
- Afonja, O.; Juste, D.; Das, S.; Matsuhashi, S.; Samuels, H.H. Induction of PDCD4 tumor suppressor gene expression by RAR ag-onists, antiestrogen and HER-2/neu antagonist in breast cancer cells. Evidence for a role in apoptosis. Oncogene 2004, 23, 8135–8145. [Google Scholar]
- Hilliard, A.; Hilliard, B.; Zheng, S.J.; Sun, H.; Miwa, T.; Song, W.; Göke, R.; Chen, Y.H. Translational regulation of autoimmune inflammation and lymphoma genesis by programmed cell death 4. J. Immunol. 2006, 177, 8095–8102. [Google Scholar] [CrossRef]
- Sheedy, F.J.; Palsson-McDermott, E.; Hennessy, E.J.; Martin, C.; O’Leary, J.J.; Ruan, Q.; Johnson, D.S.; Chen, Y.; O’Neill, L.A. Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21. Nat. Immunol. 2010, 11, 141–147. [Google Scholar] [CrossRef]
- Wang, Q.; Dong, Z.; Liu, X.; Song, X.; Song, Q.; Shang, Q.; Jiang, Y.; Guo, C.; Zhang, L. Programmed cell death-4 deficiency prevents diet-induced obesity, adipose tissue inflammation, and insulin resistance. Diabetes 2013, 62, 4132–4143. [Google Scholar] [CrossRef]
- Ma, J.; Zhang, J.; Wang, Y.; Long, K.; Wang, X.; Jin, L.; Tang, Q.; Zhu, L.; Tang, G.; Li, X.; et al. MiR-532-5p alleviates hypoxia-induced cardiomyocyte apoptosis by targeting PDCD4. Gene 2018, 675, 36–43. [Google Scholar] [CrossRef]
- Zhou, X.H.; Chai, H.X.; Bai, M.; Zhang, Z. LncRNA-GAS5 regulates PDCD4 expression and mediates myocardial infarc-tion-induced cardiomyocytes apoptosis via targeting MiR-21. Cell Cycle 2020, 19, 1363–1377. [Google Scholar] [CrossRef]
- Xu, H.; Cao, H.; Zhu, G.; Liu, S.; Li, H. Overexpression of microRNA-145 protects against rat myocardial infarction through targeting PDCD4. Am. J. Transl. Res. 2017, 9, 5003. [Google Scholar]
- Yang, Y.; Yuan, H.; Liu, X.; Wang, Z.; Li, Y.; Ren, Y.; Gao, C.; Jiao, T.; Cai, Y.; Zhao, S. Transcriptome and Metabolome Integration Provides New Insights Into the Regulatory Networks of Tibetan Pig Alveolar Type II Epithelial Cells in Response to Hypoxia. Front Genet. 2022, 13, 812411. [Google Scholar] [CrossRef]
- Liu, X.; Wang, Y.; Liu, Z.; Kang, Y.; Ma, F.; Luo, Z.; Wang, J.; Huang, J. miR-434 and miR-242 have a potential role in heat stress response in rainbow trout (Oncorhynchus mykiss). J. Fish Biol. 2021, 99, 1798–1803. [Google Scholar] [CrossRef]
- Ni, Z.; Shen, Y.; Wang, W.; Cheng, X.; Fu, Y. miR-141-5p Affects the Cell Proliferation and Apoptosis by Targeting BTG1 in Cer-vical Cancer. Cancer Biother. Radiopharm. 2021. [Google Scholar] [CrossRef]
- Li, M.; Huang, H.; Cheng, F.; Hu, X.; Liu, J. miR-141-3p promotes proliferation and metastasis of nasopharyngeal carcinoma by targeting NME1. Adv. Med. Sci. 2020, 65, 252–258. [Google Scholar] [CrossRef]
- Ling, Z.; Chen, M.; Li, T.; Qian, Y.; Li, C. MiR-141-3p downregulation promotes tube formation, migration, invasion and inhibits apoptosis in hypoxia-induced human umbilical vein endothelial cells by targeting Notch2. Reprod. Biol. 2021, 21, 100483. [Google Scholar] [CrossRef]
- Zhou, B.; Liu, H.Y.; Zhu, B.L.; Yue, A.X. MicroRNA-141 protects PC12 cells against hypoxia/reoxygenation-induced injury via regulating Keap1-Nrf2 signaling pathway. J. Bioenerg. Biomembr. 2019, 51, 291–300. [Google Scholar] [CrossRef]
- Zou, H.; Liu, G. Inhibition of endoplasmic reticulum stress through activation of MAPK/ERK signaling pathway attenuates hypoxia-mediated cardiomyocyte damage. J. Recept. Signal Transduct. Res. 2021, 41, 532–537. [Google Scholar] [CrossRef]
- Fu, Q.; Mo, T.R.; Hu, X.Y.; Fu, Y.; Li, J. miR-19a mitigates hypoxia/reoxygenation-induced injury by depressing CCL20 and inac-tivating MAPK pathway in human embryonic cardiomyocytes. Biotechnol. Lett. 2021, 43, 393–405. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Zhang, Y. Protective effect of miR-20a against hypoxia/reoxygenation treatment on cardiomyocytes cell viability and cell apoptosis by targeting TLR4 and inhibiting p38 MAPK/JNK signaling. In Vitro Cell Dev Biol Anim. 2019, 55, 793–800. [Google Scholar] [CrossRef]
- Maxeiner, S.; Grolleman, J.; Schmid, T.; Kammenga, J.; Hajnal, A. The hypoxia-response pathway modulates RAS/MAPK-mediated cell fate decisions in Caenorhabditis elegans. Life Sci. Alliance 2019, 2, e201800255. [Google Scholar] [CrossRef]
- De Meyer, G.R.; Grootaert, M.O.; Michiels, C.F.; Kurdi, A.; Schrijvers, D.M.; Martinet, W. Autophagy in vascular disease. Circ. Res. 2015, 116, 468–479. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, J.; Namba, T.; Takabatake, Y.; Kimura, T.; Takahashi, A.; Yamamoto, T.; Minami, S.; Sakai, S.; Fujimura, R.; Kaimori, J.Y.; et al. Antioxidant role of autophagy in maintaining the integrity of glomerular capillaries. Autophagy 2018, 14, 53–65. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Bosch-Marce, M.; Shimoda, L.A.; Tan, Y.S.; Baek, J.H.; Wesley, J.B.; Gonzalez, F.J.; Semenza, G.L. Mitochondrial autophagy is an HIF-1-dependent adaptive metabolic response to hypoxia. J. Biol. Chem. 2008, 283, 10892–10903. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′–3′) |
---|---|
ssc-miR-141 | Forward: GTAACACTGTCTGGTAAAGATG Reverse: mR Q 3′Primer(Universal downstream primers) |
PDCD4 | Forward: TCATCCCGTGACTCTGGC Reverse: GGTAGTCCCCTTCCTTTCC |
β-actin | Forward: ATATTGCTGCGCTCGTGGT Reverse: TAGGAGTCCTTCTGGCCCAT |
U6 | Forward: GGAACGATACAGAGAAGATTAGC Reverse: TGGAACGCTTCACGAATTTGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, L.; Yuan, H.; Wang, Z.; Zhao, S.; Yang, Y. Ssc-miR-141 Attenuates Hypoxia-Induced Alveolar Type II Epithelial Cell Injury in Tibetan Pigs by Targeting PDCD4. Genes 2022, 13, 2398. https://doi.org/10.3390/genes13122398
Xu L, Yuan H, Wang Z, Zhao S, Yang Y. Ssc-miR-141 Attenuates Hypoxia-Induced Alveolar Type II Epithelial Cell Injury in Tibetan Pigs by Targeting PDCD4. Genes. 2022; 13(12):2398. https://doi.org/10.3390/genes13122398
Chicago/Turabian StyleXu, Linna, Haonan Yuan, Zongli Wang, Shengguo Zhao, and Yanan Yang. 2022. "Ssc-miR-141 Attenuates Hypoxia-Induced Alveolar Type II Epithelial Cell Injury in Tibetan Pigs by Targeting PDCD4" Genes 13, no. 12: 2398. https://doi.org/10.3390/genes13122398
APA StyleXu, L., Yuan, H., Wang, Z., Zhao, S., & Yang, Y. (2022). Ssc-miR-141 Attenuates Hypoxia-Induced Alveolar Type II Epithelial Cell Injury in Tibetan Pigs by Targeting PDCD4. Genes, 13(12), 2398. https://doi.org/10.3390/genes13122398