RNA Interference Analysis of the Functions of Cyclin B in Male Reproductive Development of the Oriental River Prawn (Macrobrachium nipponense)
Abstract
:1. Introduction
2. Methods and Materials
2.1. Ethics Statement
2.2. Rapid Amplification of cDNA Ends (RACE)
2.3. Quantitative PCR (qPCR) Analysis
2.4. RNAi Analysis
2.5. Hematoxylin and Eosin (HE) Staining
2.6. Statistical Analysis
3. Results
3.1. Mn-CycB cDNA Sequence Analysis
3.2. Phylo-Genetic Tree Analysis
3.3. Mn-CycB Expression Analysis
3.4. RNAi Analysis
3.5. Histological Observations
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fu, H.T.; Jiang, S.F.; Xiong, Y.W. Current status and prospects of farming the giant river prawn (Macrobrachium rosenbergii) and the oriental river prawn (Macrobrachium nipponense) in china. Aquac. Res. 2012, 43, 993–998. [Google Scholar]
- Zhang, X.L.; Cui, L.F.; Li, S.M.; Liu, X.Z.; Han, X.; Jiang, K.Y. Bureau of Fisheries, Ministry of Agriculture, P.R.C. Fisheries economic statistics. In China Fishery Yearbook; Beijing China Agricultural Press: Beijing, China, 2020; p. 24. [Google Scholar]
- Jin, S.B.; Zhang, Y.; Guang, H.H.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Histological observation of gonadal development during post-larva in oriental river prawn, Macrobrachium nipponense. Chin. J. Fish. 2016, 29, 11–16. [Google Scholar]
- Jin, S.B.; Fu, Y.; Hu, Y.N.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Identification of candidate genes of male sexual development from androgenic gland in Macrobrachium nipponense through performing long-reads and next generation transcriptome sequencing after eyestalk ablation. Sci. Rep. 2021, 11, 19855. [Google Scholar] [CrossRef]
- Jin, S.; Fu, Y.; Hu, Y.; Fu, H.; Jiang, S.; Xiong, Y.; Qiao, H.; Zhang, W.; Gong, Y.; Wu, Y. Transcriptome Profiling Analysis of the Testis After Eyestalk Ablation for Selection of the Candidate Genes Involved in the Male Sexual Development in Macrobrachium nipponense. Front. Genet. 2021, 12, 675928. [Google Scholar] [CrossRef]
- Hopkins, P.M. The eyes have it: A brief history of crustacean neuroendocrinology. Gen. Comp. Endocrinol. 2012, 175, 357–366. [Google Scholar] [CrossRef]
- Revathi, P.; Iyapparaj, P.; Vasanthi, L.A.; Jeyanthi, S.; Krishnan, M. Impact of eyestalk ablation on the androgenic gland activity in the freshwater prawn Macrobrachium rosenbergii (De Man). World 2013, 5, 373–381. [Google Scholar]
- Treerattrakool, S.; Panyim, S.; Udomkit, A. Induction of ovarian maturation and spawning in Penaeus monodon broodstock by double-stranded RNA. Mar. Biotechnol. 2011, 13, 163–169. [Google Scholar] [CrossRef]
- Treerattrakool, S.; Chartthai, C.; Phromma-in, N.; Panyim, S.; Udomkit, A. Silencing of gonad-inhibiting hormone gene expression in Penaeus monodon by feeding with GIH dsRNA-enriched Artemia. Aquaculture 2013, 404, 116–121. [Google Scholar] [CrossRef]
- Pamuru, R.R.; Rosen, O.; Manor, R.; Chung, J.S.; Zmora, N.; Glazer, L.; Aflalo, E.D.; Weil, S.; Tamone, S.L.; Sagi, A. Stimulation of molt by RNA interference of the molt inhibiting hormone in the crayfish Cherax quadricarinatus. Gen. Comp. Endocrinol. 2012, 178, 227–236. [Google Scholar] [CrossRef]
- Salma, U.; Uddowla, M.H.; Kim, M.; Kim, J.M.; Bo, K.K.; Baek, H.J.; Park, H.; Mykles, D.L.; Kim, H.W. Five hepatopancreatic and one epidermal chitinases froma pandalid shrimp (Pandalopsis japonica): Cloning and effects of eyestalk ablation on gene expression. Comp. Biochem. Phys. B 2012, 161, 197–207. [Google Scholar] [CrossRef]
- Shen, H.; Zhou, X.; Bai, A.; Ren, X.; Zhang, Y. Ecdysone receptor gene from the freshwater prawn Macrobrachium nipponense: Identification of different splice variants and sexually dimorphic expression, fluctuation of expression in the molt cycle and effect of eyestalk ablation. Gen. Comp. Endocrinol. 2013, 193, 86–94. [Google Scholar] [CrossRef]
- Almeida, E.A.; Petersen, R.L.; Andreatta, E.R.; Bainy, A.C. Effects of captivity and eyestalk ablation on antioxidant status of shrimps (Farfantepenaeus paulensis). Aquaculture 2004, 238, 523–528. [Google Scholar] [CrossRef]
- Santos, E.A.; Eduardo, L.; Nery, M.; Goncalves, A.A.; Keller, R. Evidence for the involvement of the crustacean hyperglycemic hormone in the regulation of lipid metabolism. Physiol. Biochem. Zool. 1997, 70, 415–420. [Google Scholar] [CrossRef]
- Diarte-Plata, G.; Sainz-Hernández, J.C.; Aguiñaga-Cruz, J.A.; Fierro-Coronado, J.A.; Polanco-Torres, A.; Puente-Palazuelos, C. Eyestalk ablation procedures tominimize pain in the freshwater prawn Macrobrachium Americanum. Appl. Anim. Behav. Sci. 2012, 140, 172–178. [Google Scholar] [CrossRef]
- Sainz-Hernandez, J.C.; Racotta, I.S.; Dumas, S.; Hernandez-Lopez, J. Effect of unilateral and bilateral eyestalk ablation in Litopenaeus vannamei male and female on several metabolic and immunologic variables. Aquaculture 2008, 283, 188–193. [Google Scholar] [CrossRef][Green Version]
- Tiu, S.H.K.; Chan, S.M. The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis. FEBS J. 2007, 274, 4385–4395. [Google Scholar] [CrossRef]
- Qiao, H.; Xiong, Y.W.; Zhang, W.Y.; Fu, H.T.; Jiang, S.F.; Sun, S.M.; Bai, H.K.; Jin, S.B.; Gong, Y.S. Characterization, expression, and function analysis of gonad-inhibiting hormone in Oriental River prawn, Macrobrachium nipponense and its induced expression by temperature. Comp. Biochem. Phys. A 2015, 185, 1–8. [Google Scholar] [CrossRef]
- Kang, X.; Mi, Y.; Liu, B.; Long, L.; Wang, S. Studies on testis development and its variation of amino acid content in Eriochier sinensis by eyestalk ablation. J. Oceanogr. Taiwan Str. 2000, 19, 360–363. [Google Scholar]
- Khalaila, I.; Manor, R.; Weil, S.; Granot, Y.; Keller, R.; Sagi, A. The eyestalk-androgenic gland-testis endocrine axis in the crayfish Cherax quadricarinatus. Gen. Comp. Endocrinol. 2002, 127, 147–156. [Google Scholar] [CrossRef]
- Song, C.W.; Liu, L.; Hui, M.; Liu, Y.; Liu, H.R.; Cui, Z.X. Primary molecular basis of androgenic gland endocrine sex regulation revealed by transcriptome analysis in Eriocheir sinensis. J. Oceanol. Limnol. 2019, 37, 223–234. [Google Scholar] [CrossRef]
- Kamb, A.A. Cell cycle regulator potentially involved in genesis of many tumour types. Trend Genet. 1994, 10, 228. [Google Scholar] [CrossRef]
- Spellman, P.T.; Sherlock, G.; Zhang, M.Q.; Iyer, V.R.; Anders, K.; Eisen, M.B.; Brown, P.O.; Botstein, D.; Futcher, B.; Fink, G.R. Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 1998, 9, 3273–3297. [Google Scholar] [CrossRef]
- Banerjee, S.K.; Weston, A.P.; Zoubine, M.N.; Campbell, D.R.; Cherian, R. Expression of cdc2 and cyclin B1 in Helicobacter pylori-associated gastric MALT and MALT lymphoma: Relationship to cell death, proliferation, and transformation. Am. J. Pathol. 2000, 156, 217–225. [Google Scholar] [CrossRef]
- Murray, A.; Hunt, T. The Cell Cycle: An Introduction; Oxford University Press: Oxford, UK, 1993. [Google Scholar]
- Bolsover, S.R.; Hyams, J.S.; Shephard, E.A.; White, H.A.; Wiedemann, C.G. Cell Biology: A Short Course, 2nd ed.; John Wiley and Sons Inc.: Hoboken, NJ, USA, 2004; pp. 408–415. [Google Scholar]
- Nurse, P. Universal control mechanism regulating onset of M-phase. Nature 1990, 344, 503–508. [Google Scholar] [CrossRef]
- Pines, J. Four-dimensional control of the cell cycle. Nat. Cell Biol. 1999, 1, E73–E79. [Google Scholar] [CrossRef] [PubMed]
- Murray, A.W.; Kirschner, M.W. Cyclin synthesis drives the early embryonic cell cycle. Nature 1989, 339, 275–280. [Google Scholar] [CrossRef]
- Fang, J.J.; Qiu, G.F. Molecular cloning of cyclin B transcript with an unusually long 30 untranslation region and its expression analysis during oogenesis in the Chinese mitten crab, Eriocheir sinensis. Mol. Biol. Rep. 2009, 36, 1521–1529. [Google Scholar] [CrossRef]
- Qiu, L.; Jiang, S.; Zhou, F.; Huang, J.; Guo, Y. Molecular cloning and characterization of a cyclin B gene on the ovarian maturation stage of black tiger shrimp (Penaeus monodon). Mol. Biol. Rep. 2007. [Google Scholar] [CrossRef]
- Visudtiphole, V.; Klinbunga, S.; Kirtikara, K. Molecular characterization and expression profiles of cyclin A and cyclin B during ovarian development of the giant tiger shrimp Penaeus monodon. Comp. Biochem. Physiol. A 2009, 152, 535–543. [Google Scholar] [CrossRef]
- Qiu, G.F.; Yamano, K. Three forms of cyclin B transcripts in the ovary of the kuruma prawn Marsupenaeus japonicus: Their molecular characterizations and expression profiles during oogenesis. Comp. Biochem. Physiol. B 2005, 141, 186–195. [Google Scholar] [CrossRef]
- Han, K.H.; Dai, Y.B.; Zou, Z.H.; Fu, M.J.; Wang, Y.L.; Zhang, Z.P. Molecular characterization and expression profiles of cdc2 and cyclin B during oogenesis and spermatogenesis in green mud crab (Scylla paramamosain). Comp. Biochem. Phys. B 2012, 163, 292–302. [Google Scholar] [CrossRef] [PubMed]
- Li, W.X.; Huang, H.Y.; Huang, J.R.; Yu, J.J.; Ma, J.; Ye, H.H. Molecular cloning, expression profiles and subcellular localization of cyclin B in ovary of the mud crab, Scylla paramamosain. Genes Genom. 2013, 35, 185–195. [Google Scholar] [CrossRef]
- Yang, Y.; Huang, H.; Huang, X.; Ye, H.; Li, S. Molecular cloning and prokaryotic expression of cyclin B from shrimp Metapenaeus affinis. J. Fish. China 2013, 37, 184. [Google Scholar] [CrossRef]
- Jin, S.B.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Sun, S.M.; Zhang, W.Y.; Gong, Y.S.; Fu, H.T. Molecular cloning of two tropomyosin family genes and expression analysis during development in oriental river prawn, Macrobrachium nipponense. Gene 2014, 546, 390–397. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.B.; Fu, H.T.; Jiang, S.F.; Xiong, Y.W.; Sun, S.M.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Molecular Cloning, Expression, and In Situ Hybridization Analysis of Forkhead Box Protein L2 during Development in Macrobrachium nipponense. J. World Aquacul. Soc. 2018, 49, 429–440. [Google Scholar] [CrossRef]
- Hu, Y.N.; Fu, H.T.; Qiao, H.; Sun, S.M.; Zhang, W.Y.; Jin, S.B.; Jiang, S.F.; Gong, Y.S.; Xiong, Y.W.; Wu, Y. Validation and evaluation of reference genes for Quantitative real-time PCR in Macrobrachium nipponense. Int. J. Mol. Sci. 2018, 19, 2258. [Google Scholar] [CrossRef][Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, S.B.; Jiang, P.; Wang, Z.Q.; Long, S.R.; Liu, R.D.; Zhang, X.; Yang, W.; Ren, H.J.; Cui, J. Dsrna-Mediated Silencing of Nudix Hydrolase in Trichinella Spiralis Inhibits the Larval Invasion and Survival in Mice. Exp. Parasitol. 2016, 162, 35–42. [Google Scholar] [CrossRef]
- Jiang, F.W.; Fu, H.T.; Qiao, H.; Zhang, W.Y.; Jiang, S.F.; Xiong, Y.W.; Sun, S.M.; Gong, Y.S.; Jin, S.B. The RNA Interference Regularity of Transformer-2 Gene of Oriental River Prawn Macrobrachium nipponense. Chin. Agric. Sci. Bul. 2014, 30, 32–37. [Google Scholar]
- Li, F.; Qiao, H.; Fu, H.T.; Sun, S.M.; Zhang, W.Y.; Jin, S.B.; Jiang, S.F.; Gong, Y.S.; Xiong, Y.W.; Wu, Y.; et al. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Comp. Biochem. Phys. B 2018, 218, 1–12. [Google Scholar] [CrossRef]
- Ma, X.K.; Liu, X.Z.; Wen, H.S.; Xu, Y.J.; Zhang, L.J. Histological observation on gonadal sex differentiation in Cynoglossus semilaevis Günther. Mar. Fish. Res. 2006, 27, 55–61. [Google Scholar]
- Shangguan, B.M.; Liu, Z.Z.; Li, S.Q. Histological Studies on Ovarian Development in Scylla serrata. J. Fish. Sci. China 1991, 15, 96–103. [Google Scholar]
- Liu, L.H.; Li, B.; Shen, W.D. Cloning, Structural Characterization and Expression Analysis of Cyclin Family Genes in Silkworm, Bombyx mori. Acta Sericologicr Sinicr 2010, 36, 754–758. [Google Scholar]
- Lamers, A.E.; Ram, J.L.; Heiney, J.P. Cloning and sequence analysis of two cDNAs encoding cyclin A and cyclin B in the zebra mussel Dreissena polymorpha. Biochim. Biophys. Acta 1999, 1448, 519–524. [Google Scholar] [CrossRef][Green Version]
- Jin, S.B.; Hu, Y.N.; Fu, H.T.; Sun, S.M.; Jiang, S.F.; Xiong, Y.W.; Qiao, H.; Zhang, W.Y.; Gong, Y.S.; Wu, Y. Analysis of testis metabolome and transcriptome from the oriental river prawn (Macrobrachium nipponense) in response to different temperatures and illumination times. Comp. Biochem. Phys. D. 2020, 34, 100662. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.; Zhang, W.; Xiong, Y.; Jiang, S.F.; Qiao, H.; Gong, Y.S.; Wu, Y.; Fu, H.T. Genetic regulation of male sexual development in the oriental river prawn Macrobrachium nipponense during reproductive vs. non-reproductive season. Aquacult. Int. 2022, 30, 2059–2079. [Google Scholar] [CrossRef]
- Lozano, J.C.; Schatt, P.; Marquès, F.; Peaucellier, G.; Fort, P.; Féral, J.P.; Genevière, A.M.; Picard, A. A presumptive developmental role for a sea urchin cyclin B splice variant. J. Cell Biol. 1998, 140, 283–293. [Google Scholar] [CrossRef][Green Version]
- Sagi, A.; Cohen, D.; Milner, Y. Effect of androgenic gland ablation on morphotypic differentiation and sexual characteristics of male freshwater prawns, Macrobrachium rosenbergii. Gen. Comp. Endocr. 1990, 77, 15–22. [Google Scholar] [CrossRef]
- Atsuro, O.; Yuriko, H.; Makoto, N.; Tsuyoshi, O.; Rinkei, K.; Masaaki, K.; Shogo, M.; Hiromichi, N. Preparation of an active recombinant peptide of crustacean androgenic gland hormone. Peptides 2002, 3, 567–572. [Google Scholar]
- Morakot, S.; Charoonroj, C.; Michael, J.S.; Nantawan, S.; Napamanee, K.; Ittipon, P.; Peter, J.H.; Prasert, S. Bilateral eyestalk ablation of the blue swimmer crab, Portunus pelagicus, produces hypertrophy of the androgenic gland and an increase of cells producing insulin-like androgenic gland hormone. Tissue Cell 2010, 5, 293–300. [Google Scholar]
- Sagi, A.; Cohen, D. Growth, maturation and progeny of sex-reversed Macrobrachium rosenbetgii males. World Aquacult. 1990, 21, 87–90. [Google Scholar]
- Sagi, A.; Ra’anan, Z.; Cohen, D.; Wax, Y. Production of Macrobrachium rosenbetgii in momosex population: Yield characteristes under intensive monoculture conditions in cages. Aquaculture 1986, 51, 265–275. [Google Scholar] [CrossRef]
- Ventura, T.; Manor, R.; Aflalo, E.D.; Weil, S.; Rosen, O.; Sagi, A. Timing sexual differentiation: Full functional sex reversal achieved through silencing of a single insulin-like gene in the prawn, Macrobrachium rosenbergii. Biol. Reprod. 2012, 86, 90. [Google Scholar] [CrossRef] [PubMed]
- Li, S.H.; Li, F.H.; Sun, Z.; Xiang, J.H. Two spliced variants of insulin-like androgenic gland hormone gene in the Chinese shrimp, Fenneropenaeus chinensis. Gen. Comp. Endocrinol. 2012, 177, 246–255. [Google Scholar] [CrossRef]
- Huang, X.S.; Ye, H.H.; Huang, H.Y.; Yang, Y.N.; Gong, J. An insulin-like androgenic gland hormone gene in the mud crab, Scylla paramamosain, extensively expressed and involved in the processes of growth and female reproduction. Gen. Comp. Endocrinol. 2014, 204, 229–238. [Google Scholar] [CrossRef]
- Liu, F.; Shi, W.; Ye, H.; Liu, A.; Zhu, Z. RNAi Reveals Role of Insulin-Like Androgenic Gland Hormone 2 (IAG2) in Sexual Differentiation and Growth in Hermaphrodite Shrimp. Front. Mar. Sci. 2021, 8, 666763. [Google Scholar] [CrossRef]
- Zhou, T.T.; Wang, W.; Wang, C.G.; Sun, C.B.; Shi, L.L.; Chan, S.F. Insulin-like Androgenic Gland Hormone from the Shrimp Fenneropenaeus merguiensis: Expression, Gene organization and Transcript variants. Gene 2021, 782, 145529. [Google Scholar] [CrossRef]
- Ma, K.Y.; Li, J.L.; Qiu, G.F. Identification of putative regulatory region of insulin-like androgenic gland hormone gene (IAG) in the prawn Macrobrachium nipponense and proteins that interact with IAG by using yeast two-hybrid system. Gen. Comp. Endocr. 2016, 229, 112–118. [Google Scholar] [CrossRef]
Primer Name | Nucleotide Sequence (5′→3′) |
---|---|
CycB-3GSP1 | GTGTTTGTTAGAATACTCAATG |
CycB-3GSP2 | TGTCCTCTGTAGTTGTTAAGAG |
CycB-5GSP1 | TTCTTGCACATCCATGTCCTCAA |
CycB-5GSP2 | CCACATCTCCCAAAGCAGCTCT |
3′RACE OUT | TACCGTCGTTCCACTAGTGATTT |
3′RACE IN | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
5′RACE OUT | CATGGCTACATGCTGACAGCCTA |
5′RACE IN | CGCGGATCCACAGCCTACTGATGATCAGTCGATG |
CycB-RTF | TGGTAATCCTCAGTTGGTCTCTG |
CycB-RTR | CAAGGTACCCACTTTTGACCTGA |
IAG-RTF | CGCCTCCGTCTGCCTGAGATAC |
IAG-RTR | CCTCCTCCTCCACCTTCAATGC |
EIF-F | CATGGATGTACCTGTGGTGAAAC |
EIF-R | CTGTCAGCAGAAGGTCCTCATTA |
CycB RNAi-F | TAATACGACTCACTATAGGGGATCAACTGGCCCTCTGAAA |
CycB RNAi-R | TAATACGACTCACTATAGGGCACGGTCCTGTGAATCAATG |
Species | Accession Number |
---|---|
Macrobrachium nipponense | ADB44902.1 |
Macrobrachium rosenbergii | ADP95148.1 |
Palaemon modestus | QDE09442.1 |
Palaemon carinicauda | AKA66439.1 |
Metapenaeus ensis | ADI86225.1 |
Metapenaeus affinis | ADI86226.1 |
Penaeus monodon | ACH72072.1 |
Penaeus japonicus | AAV37462.1 |
Procambarus clarkii | ALD48736.1 |
Penaeus vannamei | XP_027209834.1 |
Penaeus chinensis | XP_047471868.1 |
Scylla paramamosain | ACN54752.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, W.; Wang, P.; Xiong, Y.; Chen, T.; Jiang, S.; Qiao, H.; Gong, Y.; Wu, Y.; Jin, S.; Fu, H. RNA Interference Analysis of the Functions of Cyclin B in Male Reproductive Development of the Oriental River Prawn (Macrobrachium nipponense). Genes 2022, 13, 2079. https://doi.org/10.3390/genes13112079
Zhang W, Wang P, Xiong Y, Chen T, Jiang S, Qiao H, Gong Y, Wu Y, Jin S, Fu H. RNA Interference Analysis of the Functions of Cyclin B in Male Reproductive Development of the Oriental River Prawn (Macrobrachium nipponense). Genes. 2022; 13(11):2079. https://doi.org/10.3390/genes13112079
Chicago/Turabian StyleZhang, Wenyi, Pengchao Wang, Yiwei Xiong, Tianyong Chen, Sufei Jiang, Hui Qiao, Yongsheng Gong, Yan Wu, Shubo Jin, and Hongtuo Fu. 2022. "RNA Interference Analysis of the Functions of Cyclin B in Male Reproductive Development of the Oriental River Prawn (Macrobrachium nipponense)" Genes 13, no. 11: 2079. https://doi.org/10.3390/genes13112079