Genomic Variant in NK-Lysin Gene Is Associated with T Lymphocyte Subpopulations in Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Population and Sample Collection
2.2. Measurement of T Lymphocyte Subpopulation Levels in Peripheral Blood
2.3. DNA Extraction and cDNA Preparation
2.4. Quantitative Real-Time PCR Analysis
2.5. SNP Identification and Genotyping
2.6. Association Analysis
3. Results
3.1. The Relative Expression Level of NKL Gene in 7 Various Tissues
3.2. Polymorphism Detection and Association Analysis of Porcine NKL Gene
4. Discussion
4.1. T Lymphocytes Traits
4.2. Association Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jenssen, H.; Hamill, P.; Hancock, R.E.W. Peptide antimicrobial agents. Clin. Microbiol. Rev. 2006, 19, 491–511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andersson, M.; Gunne, H.; Agerberth, B.; Boman, A.; Bergman, T.; Sillard, R.; Jörnvall, H.; Mutt, V.; Olsson, B.; Wigzell, H. NK-lysin, a novel effector peptide of cytotoxic T and NK cells. Structure and cDNA cloning of the porcine form, induction by interleukin 2, antibacterial and antitumour activity. EMBO J. 1995, 14, 1615–1625. [Google Scholar] [CrossRef] [PubMed]
- Andersson, M.; Holmgren, A.; Spyrou, G. NK-lysin, a disulfide-containing effector peptide of T-lymphocytes, is reduced and inactivated by human thioredoxin reductase. Implication for a protective mechanism against NK-lysin cytotoxicity. J. Biol. Chem. 1996, 271, 10116–10120. [Google Scholar] [CrossRef] [Green Version]
- Endsley, J.J.; Furrer, J.L.; Endsley, M.A.; McIntosh, M.A.; Maue, A.C.; Waters, W.R.; Lee, D.R.; Estes, D.M. Characterization of bovine homologues of granulysin and NK-lysin. J. Immunol. 2004, 173, 2607–2614. [Google Scholar] [CrossRef] [Green Version]
- Hong, Y.H.; Lillehoj, H.S.; Dalloul, R.A.; Min, W.; Miska, K.B.; Tuo, W.; Lee, S.H.; Han, J.Y.; Lillehoj, E.P. Molecular cloning and characterization of chicken NK-lysin. Vet. Immunol. Immunopathol. 2006, 110, 339–347. [Google Scholar] [CrossRef] [PubMed]
- Ishige, T.; Hara, H.; Hirano, T.; Kono, T.; Hanzawa, K. Basic characterization of avian NK-lysin (NKL) from the Japanese quail, Coturnix japonica. Anim. Sci. J. 2014, 85, 90–95. [Google Scholar] [CrossRef] [PubMed]
- Dassanayake, R.P.; Wherry, T.L.T.; Falkenberg, S.M.; Reinhardt, T.A.; Casas, E.; Stabel, J.R. Bovine NK-lysin-derived peptides have bactericidal effects against Mycobacterium avium subspecies paratuberculosis. Vet. Res. 2021, 52, 11. [Google Scholar] [CrossRef]
- Chen, J.; Huddleston, J.; Buckley, R.M.; Malig, M.; Lawhon, S.D.; Skow, L.C.; Lee, M.O.; Eichler, E.E.; Andersson, L.; Womack, J.E. Bovine NK-lysin: Copy number variation and functional diversification. Proc. Natl. Acad. Sci. USA 2015, 112, E7223–E7229. [Google Scholar] [CrossRef] [Green Version]
- Schröder-Borm, H.; Bakalova, R.; Andrä, J. The NK-lysin derived peptide NK-2 preferentially kills cancer cells with increased surface levels of negatively charged phosphatidylserine. FEBS Lett. 2005, 579, 6128–6134. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.O.; Kim, E.-H.; Jang, H.-J.; Park, M.N.; Woo, H.-J.; Han, J.Y.; Womack, J.E. Effects of a single nucleotide polymorphism in the chicken NK-lysin gene on antimicrobial activity and cytotoxicity of cancer cells. Proc. Natl. Acad. Sci. USA 2012, 109, 12087–12092. [Google Scholar] [CrossRef]
- Lin, Q.; Fu, Q.; Chen, D.; Yu, B.; Luo, Y.; Huang, Z.; Zheng, P.; Mao, X.; Yu, J.; Luo, J.; et al. Functional characterization of porcine NK-lysin: A novel immunomodulator that regulates intestinal inflammatory response. Molecules 2021, 26, 4242. [Google Scholar] [CrossRef] [PubMed]
- Ishige, T.; Hara, H.; Hirano, T.; Kono, T.; Hanzawa, K. Effect of a single polymorphism in the Japanese quail NK-lysin gene on antimicrobial activity. Anim. Sci. J. 2016, 87, 143–146. [Google Scholar] [CrossRef] [PubMed]
- van Oirschot, J.T. Vaccinology of classical swine fever: From lab to field. Vet. Microbiol. 2003, 96, 367–384. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.L.; Wang, M.C.; Liu, Y.L.; Zhang, Q.; Li, C.F.; Liu, P.T.; Li, E.Z.; Nie, P.; Xie, H.X. Identification, expression analysis, and antibacterial activity of NK-lysin from common carp Cyprinus carpio. Fish Shellfish. Immunol. 2018, 73, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Lu, X.; Luo, Y.R.; Zhou, J.P.; Liu, X.Y.; Liu, J.F.; Ding, X.D.; Zhang, Q. Molecular characterization and association analysis of porcine interferon regulatory factor 1 gene. Mol. Biol. Rep. 2011, 38, 1901–1907. [Google Scholar] [CrossRef] [PubMed]
- Husmann, L.A.; Bevan, M.J. Cooperation between helper T cells and cytotoxic T lymphocyte precursors. Ann. N. Y. Acad. Sci. 1988, 532, 158–169. [Google Scholar] [CrossRef]
- Flavell, R.A. The molecular basis of T cell differentiation. Immunol. Res. 1999, 19, 159–168. [Google Scholar] [CrossRef]
- Larosa, D.F.; Orange, J.S. 1. Lymphocytes. J. Allergy Clin. Immunol. 2008, 121, S364–S369. [Google Scholar] [CrossRef] [PubMed]
- Saalmüller, A.; Hirt, W.; Reddehase, M.J. Phenotypic discrimination between thymic and extrathymic CD4-CD8- and CD4+CD8+ porcine T lymphocytes. Eur. J. Immunol. 1989, 19, 2011–2016. [Google Scholar] [CrossRef]
- Summerfield, A.; Rziha, H.J.; Saalmüller, A. Functional characterization of porcine CD4+CD8+ extrathymic T lymphocytes. Cell. Immunol. 1996, 168, 291–296. [Google Scholar] [CrossRef]
- Bohórquez, J.A.; Wang, M.; Pérez-Simó, M.; Vidal, E.; Rosell, R.; Ganges, L. Low CD4/CD8 ratio in classical swine fever postnatal persistent infection generated at 3 weeks after birth. Transbound. Emerg. Dis. 2019, 66, 752–762. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.X.; Basilion, J.P.; Stanton, V.P. Single-nucleotide polymorphisms can cause different structural folds of mRNA. Proc. Natl. Acad. Sci. USA 1999, 96, 7871–7876. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, J.; Antezana, M.A. Mammalian mutation pressure, synonymous codon choice, and mRNA degradation. J. Mol. Evol. 2003, 57, 694–701. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Danenberg, K.D.; Horikoshi, T.; Lenz, H.J.; Danenberg, P.V. Effect of 5-fluoro- and 5-bromouracil substitution on the translation of human thymidylate synthase mRNA. J. Biol. Chem. 1994, 269, 16269–16275. [Google Scholar] [CrossRef]
- Cheng, Y.; Liu, S.; Wang, G.; Wei, W.; Huang, S.; Yang, R.; Geng, H.; Li, H.; Song, J.; Sun, L.; et al. Porcine IGF1 synonymous mutation alter gene expression and protein binding affinity with IGF1R. Int. J. Biol. Macromol. 2018, 116, 23–30. [Google Scholar] [CrossRef]
- Gotea, V.; Gartner, J.J.; Qutob, N.; Elnitski, L.; Samuels, Y. The functional relevance of somatic synonymous mutations in melanoma and other cancers. Pigment Cell Melanoma Res. 2015, 28, 673–684. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Yang, Q.; Zhao, F. Synonymous but not silent: The codon usage code for gene expression and protein folding. Annu. Rev. Biochem. 2021, 90, 375–401. [Google Scholar] [CrossRef]
- Yu, C.-H.; Dang, Y.; Zhou, Z.; Wu, C.; Zhao, F.; Sachs, M.S.; Liu, Y. Codon usage influences the local rate of translation elongation to regulate co-translational protein folding. Mol. Cell 2015, 59, 744–754. [Google Scholar] [CrossRef] [Green Version]
- Zhao, F.; Yu, C.-H.; Liu, Y. Codon usage regulates protein structure and function by affecting translation elongation speed in Drosophila cells. Nucleic Acids Res. 2017, 45, 8484–8492. [Google Scholar] [CrossRef] [Green Version]
- Kudla, G.; Murray, A.W.; Tollervey, D.; Plotkin, J.B. Coding-sequence determinants of gene expression in Escherichia coli. Science 2009, 324, 255–258. [Google Scholar] [CrossRef]
Primers | Sequences 5′–3′ | Anneal Temperature | Product Size |
---|---|---|---|
F1 | AGACAAGGAGGGCAGAGGAG | 59.0 °C | 530 bp |
R1 | CTTCCCACCAGCTGTCTCTC | ||
F2 | CTCCATCTGCTCCATCTGCT | 60.0 °C | 360 bp |
R2 | AGAGATCTCCAGCCCTCACC | ||
F3 | CAGCTAGCCTGGTTCAGGTC | 60.1 °C | 420 bp |
R3 | TGAAGTCCATCTGCTGACCA | ||
F4 | TCCTTGTCCCCAACACTTTC | 59.5 °C | 480 bp |
R4 | CCCACTTTTCAGGTTGCTGT | ||
F5 | ATCCTTCACCCACTGACCAA | 60.0 °C | 420 bp |
R5 | AGGGTGCTGGAGTTTCTGTG |
Breed | Number | Genotype Frequencies | Allele Frequencies | χ2 (P) | |||
---|---|---|---|---|---|---|---|
GG | GA | AA | G | A | |||
Landrace | 68 | 0.485 (33) | 0.441 (30) | 0.074 (5) | 0.706 | 0.294 | 2.254 (0.324) |
Large White | 158 | 0.639 (101) | 0.285 (45) | 0.076 (12) | 0.781 | 0.219 | 5.107 (0.078) |
Songliao Black | 74 | 0.460 (34) | 0.351 (26) | 0.189 (14) | 0.636 | 0.364 | 1.014 (0.602) |
Traits | Genotypes (Means ± Standard Error of Means) | ||
---|---|---|---|
GG (n = 168) | GA (n = 101) | AA (n = 31) | |
CD4−CD8− | 36.541 ± 7.391 a | 35.058 ± 5.386 a | 33.365 ± 4.965 b |
CD4+CD8− | 14.997 ± 3.365 | 13.819 ± 3.014 | 14.007 ± 3.275 |
CD4−CD8+ | 39.917 ± 8.307 a | 38.382 ± 7.124 a | 36.324 ± 6.813 b |
CD4+CD8+ | 36.676 ± 6.804 a | 35.758 ± 7.563 a | 34.542 ± 6.565 b |
CD4+ | 26.912 ± 4.971 | 27.079 ± 4.413 | 26.740 ± 4.597 |
CD8+ | 51.117 ± 9.472 A | 48.087 ± 8.454 A | 46.598 ± 7.541 B |
CD4+/CD8+ | 0.53 ± 0.042 a | 0.56 ± 0.056 b | 0.56 ± 0.053 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, S.; Shi, N.; Zheng, K.; Yin, Z.; Zhang, X.; Liu, Y. Genomic Variant in NK-Lysin Gene Is Associated with T Lymphocyte Subpopulations in Pigs. Genes 2022, 13, 1985. https://doi.org/10.3390/genes13111985
Tong S, Shi N, Zheng K, Yin Z, Zhang X, Liu Y. Genomic Variant in NK-Lysin Gene Is Associated with T Lymphocyte Subpopulations in Pigs. Genes. 2022; 13(11):1985. https://doi.org/10.3390/genes13111985
Chicago/Turabian StyleTong, Shifeng, Ningkun Shi, Kaichen Zheng, Zongjun Yin, Xiaodong Zhang, and Yang Liu. 2022. "Genomic Variant in NK-Lysin Gene Is Associated with T Lymphocyte Subpopulations in Pigs" Genes 13, no. 11: 1985. https://doi.org/10.3390/genes13111985
APA StyleTong, S., Shi, N., Zheng, K., Yin, Z., Zhang, X., & Liu, Y. (2022). Genomic Variant in NK-Lysin Gene Is Associated with T Lymphocyte Subpopulations in Pigs. Genes, 13(11), 1985. https://doi.org/10.3390/genes13111985