Alternative RNA Conformations: Companion or Combatant
Abstract
:1. Introduction
2. Dynamic Ensemble of RNA
2.1. Factors Affecting the Dynamic Ensembles of RNA
2.1.1. Molecular Crowding
2.1.2. Metal Ions
2.1.3. Co-Transcriptional Folding
2.1.4. Post-Transcriptional Modifications
2.1.5. Liquid–Liquid Phase Separations
2.1.6. Single-Nucleotide Polymorphisms (SNPs)
2.1.7. Competition between Alternative RNA Conformers
3. RNA Alternate Conformers and Their Role in Diseases
3.1. RNA Conformers in Cancer
3.2. RNA Conformers in Neurodegenerative Diseases
3.3. RNA Conformers in Viruses
3.4. RNA Conformers in Bacteria
4. Targeting RNA Alternate Conformers Using Small Molecules for Therapeutics Applications
4.1. Cancer
4.2. Neurodegenerative Diseases
4.3. Viruses
4.4. Bacteria
5. Discussion
6. Conclusions and Future Perspective
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
Keyword | Definition |
G-Quadruplex | G-quadruplex structures are formed by the guanine-rich regions via Hoogsteen base pairing. |
Pseudoknot | A pseudoknot is an RNA structure that consists mostly of two helical segments joined by loops or single-stranded sections. |
Riboswitch | Riboswitches are elements present in the 5′-untranslated region (UTR) of mRNAs that mediate cis-regulation over the transcript via specific binding with ligands. |
RNA hairpin | A double-stranded RNA (dsRNA) stem and a terminal loop make up an RNA hairpin. |
TAR RNA | TAR (transactivation response) RNA can be found in the 5′ end of all HIV-1 mRNAs that interact with cellular proteins to create ribonucleoprotein complexes. |
Frontotemporal dementia | The term “frontotemporal dementia” (FTD) refers to a number of dementia types that involve the gradual degradation of the frontal and temporal lobes. |
Amyotrophic lateral sclerosis | Upper and lower motor neurons degenerate in amyotrophic lateral sclerosis (ALS), which can cause muscle weakness and eventually paralysis. |
Fragile X syndrome | A hereditary condition known as fragile X syndrome (FXS) is characterized by mild-to-moderate intellectual impairment. |
hnRNP H | The heterogeneous nuclear ribonucleoprotein (hnRNP) H controls the maturation and post-transcriptional processing of pre-mRNA. |
RAN translation | The translation of proteins that occurs without a start codon is known as repeat-associated non-AUG (RAN) translation. |
References
- Alejska, M.; Kurzynska-Kokorniak, A.; Broda, M.; Kierzek, R.; Figlerowicz, M. How RNA viruses exchange their genetic material. Acta Biochim. Pol. 2001, 48, 391–407. [Google Scholar] [CrossRef]
- Cross, S.T.; Michalski, D.; Miller, M.R.; Wilusz, J. RNA regulatory processes in RNA virus biology. Wiley Interdiscip Rev. RNA 2019, 10, e1536. [Google Scholar] [CrossRef] [Green Version]
- Masse, E.; Majdalani, N.; Gottesman, S. Regulatory roles for small RNAs in bacteria. Curr. Opin. Microbiol. 2003, 6, 120–124. [Google Scholar] [CrossRef] [Green Version]
- Romby, P.; Charpentier, E. An overview of RNAs with regulatory functions in gram-positive bacteria. Cell. Mol. Life Sci. 2010, 67, 217–237. [Google Scholar] [CrossRef] [PubMed]
- Stepanov, G.A.; Filippova, J.A.; Komissarov, A.B.; Kuligina, E.V.; Richter, V.A.; Semenov, D.V. Regulatory role of small nucleolar RNAs in human diseases. Biomed Res. Int. 2015, 2015, 206849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klambt, D. A model for messenger RNA sequences maximizing secondary structure due to code degeneracy. J. Theor. Biol. 1975, 52, 57–65. [Google Scholar] [CrossRef]
- Varani, G.; McClain, W.H. The G x U wobble base pair. A fundamental building block of RNA structure crucial to RNA function in diverse biological systems. EMBO Rep. 2000, 1, 18–23. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, R.; Barta, A.; Semrad, K. Strategies for RNA folding and assembly. Nat. Rev. Mol. Cell Biol. 2004, 5, 908–919. [Google Scholar] [CrossRef]
- Appasamy, S.D.; Ramlan, E.I.; Firdaus-Raih, M. Comparative sequence and structure analysis reveals the conservation and diversity of nucleotide positions and their associated tertiary interactions in the riboswitches. PLoS ONE 2013, 8, e73984. [Google Scholar] [CrossRef] [PubMed]
- Garst, A.D.; Batey, R.T. A switch in time: Detailing the life of a riboswitch. Biochim. Biophys. Acta 2009, 1789, 584–591. [Google Scholar] [CrossRef]
- Shi, H.; Rangadurai, A.; Abou Assi, H.; Roy, R.; Case, D.A.; Herschlag, D.; Yesselman, J.D.; Al-Hashimi, H.M. Rapid and accurate determination of atomistic RNA dynamic ensemble models using NMR and structure prediction. Nat. Commun. 2020, 11, 5531. [Google Scholar] [CrossRef] [PubMed]
- Al-Hashimi, H.M.; Gosser, Y.; Gorin, A.; Hu, W.; Majumdar, A.; Patel, D.J. Concerted motions in HIV-1 TAR RNA may allow access to bound state conformations: RNA dynamics from NMR residual dipolar couplings. J. Mol. Biol. 2002, 315, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Frank, A.T.; Stelzer, A.C.; Al-Hashimi, H.M.; Andricioaei, I. Constructing RNA dynamical ensembles by combining MD and motionally decoupled NMR RDCs: New insights into RNA dynamics and adaptive ligand recognition. Nucleic Acids Res. 2009, 37, 3670–3679. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.; Giles, K.E.; Felsenfeld, G. DNA.RNA triple helix formation can function as a cis-acting regulatory mechanism at the human beta-globin locus. Proc. Natl. Acad. Sci. USA 2019, 116, 6130–6139. [Google Scholar] [CrossRef] [Green Version]
- Mondal, T.; Subhash, S.; Vaid, R.; Enroth, S.; Uday, S.; Reinius, B.; Mitra, S.; Mohammed, A.; James, A.R.; Hoberg, E.; et al. Author Correction: MEG3 long noncoding RNA regulates the TGF-beta pathway genes through formation of RNA-DNA triplex structures. Nat. Commun. 2019, 10, 5290. [Google Scholar] [CrossRef] [Green Version]
- Van Treeck, B.; Parker, R. Emerging Roles for Intermolecular RNA-RNA Interactions in RNP Assemblies. Cell 2018, 174, 791–802. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Rahman, S.A.; Nikolaitchik, O.A.; Grunwald, D.; Sardo, L.; Burdick, R.C.; Plisov, S.; Liang, E.; Tai, S.; Pathak, V.K.; et al. HIV-1 RNA genome dimerizes on the plasma membrane in the presence of Gag protein. Proc. Natl. Acad. Sci. USA 2016, 113, E201–E208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Furukawa, K.; Ramesh, A.; Zhou, Z.; Weinberg, Z.; Vallery, T.; Winkler, W.C.; Breaker, R.R. Bacterial riboswitches cooperatively bind Ni(2+) or Co(2+) ions and control expression of heavy metal transporters. Mol. Cell 2015, 57, 1088–1098. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denesyuk, N.A.; Thirumalai, D. How do metal ions direct ribozyme folding? Nat. Chem. 2015, 7, 793–801. [Google Scholar] [CrossRef]
- Harale, B.; Kidwai, S.; Ojha, D.; Singh, M.; Chouhan, D.K.; Singh, R.; Khedkar, V.; Rode, A.B. Synthesis and evaluation of antimycobacterial activity of riboflavin derivatives. Bioorg. Med. Chem. Lett. 2021, 48, 128236. [Google Scholar] [CrossRef]
- Norseen, J.; Johnson, F.B.; Lieberman, P.M. Role for G-quadruplex RNA binding by Epstein-Barr virus nuclear antigen 1 in DNA replication and metaphase chromosome attachment. J. Virol. 2009, 83, 10336–10346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choksupmanee, O.; Tangkijthavorn, W.; Hodge, K.; Trisakulwattana, K.; Phornsiricharoenphant, W.; Narkthong, V.; Tulakarnwong, S.; Ngamphiw, C.; Tongsima, S.; Chimnaronk, S. Specific Interaction of DDX6 with an RNA Hairpin in the 3′ UTR of the Dengue Virus Genome Mediates G1 Phase Arrest. J. Virol. 2021, 95, e0051021. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Su, Z.; Lehmann, J.; Stamatopoulou, V.; Giarimoglou, N.; Henderson, F.E.; Fan, L.; Pintilie, G.D.; Zhang, K.; Chen, M.; et al. Structural basis of amino acid surveillance by higher-order tRNA-mRNA interactions. Nat. Struct. Mol. Biol. 2019, 26, 1094–1105. [Google Scholar] [CrossRef] [PubMed]
- Hutvágner, G.; McLachlan, J.; Pasquinelli, A.E.; Bálint, E.; Tuschl, T.; Zamore, P.D. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 2001, 293, 834–838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mirihana Arachchilage, G.; Dassanayake, A.C.; Basu, S. A potassium ion-dependent RNA structural switch regulates human pre-miRNA 92b maturation. Chem. Biol. 2015, 22, 262–272. [Google Scholar] [CrossRef] [Green Version]
- Winkler, W.C.; Cohen-Chalamish, S.; Breaker, R.R. An mRNA structure that controls gene expression by binding FMN. Proc. Natl. Acad. Sci. USA 2002, 99, 15908–15913. [Google Scholar] [CrossRef] [Green Version]
- Gupta, P.; Ojha, D.; Nadimetla, D.N.; Bhosale, S.V.; Rode, A.B. Tetraphenylethene Derivatives Modulate the RNA Hairpin-G-Quadruplex Conformational Equilibria in Proto-oncogenes. Chembiochem 2022, 23, e202200131. [Google Scholar] [CrossRef]
- Dethoff, E.A.; Petzold, K.; Chugh, J.; Casiano-Negroni, A.; Al-Hashimi, H.M. Visualizing transient low-populated structures of RNA. Nature 2012, 491, 724–728. [Google Scholar] [CrossRef] [Green Version]
- Lu, J.; Kadakkuzha, B.M.; Zhao, L.; Fan, M.; Qi, X.; Xia, T. Dynamic ensemble view of the conformational landscape of HIV-1 TAR RNA and allosteric recognition. Biochemistry 2011, 50, 5042–5057. [Google Scholar] [CrossRef]
- Merriman, D.K.; Xue, Y.; Yang, S.; Kimsey, I.J.; Shakya, A.; Clay, M.; Al-Hashimi, H.M. Shortening the HIV-1 TAR RNA Bulge by a Single Nucleotide Preserves Motional Modes over a Broad Range of Time Scales. Biochemistry 2016, 55, 4445–4456. [Google Scholar] [CrossRef]
- Nakano, S.; Miyoshi, D.; Sugimoto, N. Effects of molecular crowding on the structures, interactions, and functions of nucleic acids. Chem. Rev. 2014, 114, 2733–2758. [Google Scholar] [CrossRef] [PubMed]
- Leamy, K.A.; Assmann, S.M.; Mathews, D.H.; Bevilacqua, P.C. Bridging the gap between in vitro and in vivo RNA folding. Q. Rev. Biophys. 2016, 49, e10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trajkovski, M.; Endoh, T.; Tateishi-Karimata, H.; Ohyama, T.; Tanaka, S.; Plavec, J.; Sugimoto, N. Pursuing origins of (poly)ethylene glycol-induced G-quadruplex structural modulations. Nucleic Acids Res. 2018, 46, 4301–4315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kilburn, D.; Roh, J.H.; Guo, L.; Briber, R.M.; Woodson, S.A. Molecular crowding stabilizes folded RNA structure by the excluded volume effect. J. Am. Chem. Soc. 2010, 132, 8690–8696. [Google Scholar] [CrossRef] [Green Version]
- Strulson, C.A.; Yennawar, N.H.; Rambo, R.P.; Bevilacqua, P.C. Molecular crowding favors reactivity of a human ribozyme under physiological ionic conditions. Biochemistry 2013, 52, 8187–8197. [Google Scholar] [CrossRef] [Green Version]
- Nakano, S.; Karimata, H.T.; Kitagawa, Y.; Sugimoto, N. Facilitation of RNA enzyme activity in the molecular crowding media of cosolutes. J. Am. Chem. Soc. 2009, 131, 16881–16888. [Google Scholar] [CrossRef]
- Desai, R.; Kilburn, D.; Lee, H.T.; Woodson, S.A. Increased ribozyme activity in crowded solutions. J. Biol. Chem. 2014, 289, 2972–2977. [Google Scholar] [CrossRef] [Green Version]
- Rode, A.B.; Endoh, T.; Sugimoto, N. Crowding Shifts the FMN Recognition Mechanism of Riboswitch Aptamer from Conformational Selection to Induced Fit. Angew. Chem. Int. Ed. Engl. 2018, 57, 6868–6872. [Google Scholar] [CrossRef]
- Allred, B.E.; Gebala, M.; Herschlag, D. Determination of Ion Atmosphere Effects on the Nucleic Acid Electrostatic Potential and Ligand Association Using AH(+).C Wobble Formation in Double-Stranded DNA. J. Am. Chem. Soc. 2017, 139, 7540–7548. [Google Scholar] [CrossRef] [Green Version]
- Gebala, M.; Giambasu, G.M.; Lipfert, J.; Bisaria, N.; Bonilla, S.; Li, G.; York, D.M.; Herschlag, D. Cation-Anion Interactions within the Nucleic Acid Ion Atmosphere Revealed by Ion Counting. J. Am. Chem. Soc. 2015, 137, 14705–14715. [Google Scholar] [CrossRef]
- Lipfert, J.; Doniach, S.; Das, R.; Herschlag, D. Understanding nucleic acid-ion interactions. Annu. Rev. Biochem. 2014, 83, 813–841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Woodson, S.A. Compact intermediates in RNA folding. Annu. Rev. Biophys. 2010, 39, 61–77. [Google Scholar] [CrossRef] [PubMed]
- Chu, V.B.; Bai, Y.; Lipfert, J.; Herschlag, D.; Doniach, S. A repulsive field: Advances in the electrostatics of the ion atmosphere. Curr. Opin. Chem. Biol. 2008, 12, 619–625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Draper, D.E. A guide to ions and RNA structure. RNA 2004, 10, 335–343. [Google Scholar] [CrossRef] [Green Version]
- Roy, S.; Lammert, H.; Hayes, R.L.; Chen, B.; LeBlanc, R.; Dayie, T.K.; Onuchic, J.N.; Sanbonmatsu, K.Y. A magnesium-induced triplex pre-organizes the SAM-II riboswitch. PLoS Comput. Biol. 2017, 13, e1005406. [Google Scholar] [CrossRef] [Green Version]
- Roy, S.; Onuchic, J.N.; Sanbonmatsu, K.Y. Cooperation between Magnesium and Metabolite Controls Collapse of the SAM-I Riboswitch. Biophys. J. 2017, 113, 348–359. [Google Scholar] [CrossRef] [Green Version]
- Butcher, S.E.; Burke, J.M. Structure-mapping of the hairpin ribozyme. Magnesium-dependent folding and evidence for tertiary interactions within the ribozyme-substrate complex. J. Mol. Biol. 1994, 244, 52–63. [Google Scholar] [CrossRef]
- Pandey, S.; Agarwala, P.; Maiti, S. Effect of loops and G-quartets on the stability of RNA G-quadruplexes. J. Phys. Chem. B 2013, 117, 6896–6905. [Google Scholar] [CrossRef]
- Wickiser, J.K.; Winkler, W.C.; Breaker, R.R.; Crothers, D.M. The speed of RNA transcription and metabolite binding kinetics operate an FMN riboswitch. Mol. Cell 2005, 18, 49–60. [Google Scholar] [CrossRef]
- Landick, R. The regulatory roles and mechanism of transcriptional pausing. Biochem. Soc. Trans. 2006, 34, 1062–1066. [Google Scholar] [CrossRef]
- Endoh, T.; Sugimoto, N. Conformational Dynamics of the RNA G-Quadruplex and its Effect on Translation Efficiency. Molecules 2019, 24, 1613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mironov, A.S.; Gusarov, I.; Rafikov, R.; Lopez, L.E.; Shatalin, K.; Kreneva, R.A.; Perumov, D.A.; Nudler, E. Sensing small molecules by nascent RNA: A mechanism to control transcription in bacteria. Cell 2002, 111, 747–756. [Google Scholar] [CrossRef] [Green Version]
- Helmling, C.; Wacker, A.; Wolfinger, M.T.; Hofacker, I.L.; Hengesbach, M.; Furtig, B.; Schwalbe, H. NMR Structural Profiling of Transcriptional Intermediates Reveals Riboswitch Regulation by Metastable RNA Conformations. J. Am. Chem. Soc. 2017, 139, 2647–2656. [Google Scholar] [CrossRef]
- Harcourt, E.M.; Kietrys, A.M.; Kool, E.T. Chemical and structural effects of base modifications in messenger RNA. Nature 2017, 541, 339–346. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, N.; Dai, Q.; Zheng, G.; He, C.; Parisien, M.; Pan, T. N(6)-methyladenosine-dependent RNA structural switches regulate RNA-protein interactions. Nature 2015, 518, 560–564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaidyanathan, P.P.; AlSadhan, I.; Merriman, D.K.; Al-Hashimi, H.M.; Herschlag, D. Pseudouridine and N(6)-methyladenosine modifications weaken PUF protein/RNA interactions. RNA 2017, 23, 611–618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meyer, K.D.; Jaffrey, S.R. Rethinking m(6)A Readers, Writers, and Erasers. Annu. Rev. Cell Dev. Biol. 2017, 33, 319–342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, J.; Ieong, K.W.; Demirci, H.; Chen, J.; Petrov, A.; Prabhakar, A.; O’Leary, S.E.; Dominissini, D.; Rechavi, G.; Soltis, S.M.; et al. N(6)-methyladenosine in mRNA disrupts tRNA selection and translation-elongation dynamics. Nat. Struct. Mol. Biol. 2016, 23, 110–115. [Google Scholar] [CrossRef] [Green Version]
- Roost, C.; Lynch, S.R.; Batista, P.J.; Qu, K.; Chang, H.Y.; Kool, E.T. Structure and thermodynamics of N6-methyladenosine in RNA: A spring-loaded base modification. J. Am. Chem. Soc. 2015, 137, 2107–2115. [Google Scholar] [CrossRef] [Green Version]
- Spitale, R.C.; Flynn, R.A.; Zhang, Q.C.; Crisalli, P.; Lee, B.; Jung, J.W.; Kuchelmeister, H.Y.; Batista, P.J.; Torre, E.A.; Kool, E.T.; et al. Structural imprints in vivo decode RNA regulatory mechanisms. Nature 2015, 519, 486–490. [Google Scholar] [CrossRef]
- Zhou, H.; Kimsey, I.J.; Nikolova, E.N.; Sathyamoorthy, B.; Grazioli, G.; McSally, J.; Bai, T.; Wunderlich, C.H.; Kreutz, C.; Andricioaei, I.; et al. m(1)A and m(1)G disrupt A-RNA structure through the intrinsic instability of Hoogsteen base pairs. Nat. Struct. Mol. Biol. 2016, 23, 803–810. [Google Scholar] [CrossRef] [Green Version]
- Yarian, C.S.; Basti, M.M.; Cain, R.J.; Ansari, G.; Guenther, R.H.; Sochacka, E.; Czerwinska, G.; Malkiewicz, A.; Agris, P.F. Structural and functional roles of the N1- and N3-protons of psi at tRNA’s position 39. Nucleic Acids Res. 1999, 27, 3543–3549. [Google Scholar] [CrossRef] [PubMed]
- Durant, P.C.; Davis, D.R. Stabilization of the anticodon stem-loop of tRNALys,3 by an A+-C base-pair and by pseudouridine. J. Mol. Biol. 1999, 285, 115–131. [Google Scholar] [CrossRef]
- Charette, M.; Gray, M.W. Pseudouridine in RNA: What, where, how, and why. IUBMB Life 2000, 49, 341–351. [Google Scholar] [CrossRef] [PubMed]
- Banani, S.F.; Lee, H.O.; Hyman, A.A.; Rosen, M.K. Biomolecular condensates: Organizers of cellular biochemistry. Nat. Rev. Mol. Cell Biol. 2017, 18, 285–298. [Google Scholar] [CrossRef] [PubMed]
- Hyman, A.A.; Weber, C.A.; Julicher, F. Liquid-liquid phase separation in biology. Annu. Rev. Cell Dev. Biol. 2014, 30, 39–58. [Google Scholar] [CrossRef] [Green Version]
- Nielsen, F.C.; Hansen, H.T.; Christiansen, J. RNA assemblages orchestrate complex cellular processes. Bioessays 2016, 38, 674–681. [Google Scholar] [CrossRef] [Green Version]
- Anderson, P.; Kedersha, N. RNA granules: Post-transcriptional and epigenetic modulators of gene expression. Nat. Rev. Mol. Cell Biol. 2009, 10, 430–436. [Google Scholar] [CrossRef]
- Spector, D.L. SnapShot: Cellular bodies. Cell 2006, 127, 1071. [Google Scholar] [CrossRef] [Green Version]
- Langdon, E.M.; Qiu, Y.; Ghanbari Niaki, A.; McLaughlin, G.A.; Weidmann, C.A.; Gerbich, T.M.; Smith, J.A.; Crutchley, J.M.; Termini, C.M.; Weeks, K.M.; et al. mRNA structure determines specificity of a polyQ-driven phase separation. Science 2018, 360, 922–927. [Google Scholar] [CrossRef]
- Maharana, S.; Wang, J.; Papadopoulos, D.K.; Richter, D.; Pozniakovsky, A.; Poser, I.; Bickle, M.; Rizk, S.; Guillen-Boixet, J.; Franzmann, T.M.; et al. RNA buffers the phase separation behavior of prion-like RNA binding proteins. Science 2018, 360, 918–921. [Google Scholar] [CrossRef] [Green Version]
- Strulson, C.A.; Molden, R.C.; Keating, C.D.; Bevilacqua, P.C. RNA catalysis through compartmentalization. Nat. Chem. 2012, 4, 941–946. [Google Scholar] [CrossRef] [PubMed]
- Jain, A.; Vale, R.D. RNA phase transitions in repeat expansion disorders. Nature 2017, 546, 243–247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brookes, A.J. The essence of SNPs. Gene 1999, 234, 177–186. [Google Scholar] [CrossRef]
- Halvorsen, M.; Martin, J.S.; Broadaway, S.; Laederach, A. Disease-associated mutations that alter the RNA structural ensemble. PLoS Genet. 2010, 6, e1001074. [Google Scholar] [CrossRef] [Green Version]
- Salari, R.; Kimchi-Sarfaty, C.; Gottesman, M.M.; Przytycka, T.M. Sensitive measurement of single-nucleotide polymorphism-induced changes of RNA conformation: Application to disease studies. Nucleic Acids Res. 2013, 41, 44–53. [Google Scholar] [CrossRef] [PubMed]
- Dallaire, P.; Tan, H.; Szulwach, K.; Ma, C.; Jin, P.; Major, F. Structural dynamics control the MicroRNA maturation pathway. Nucleic Acids Res. 2016, 44, 9956–9964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bugaut, A.; Murat, P.; Balasubramanian, S. An RNA hairpin to G-quadruplex conformational transition. J. Am. Chem. Soc. 2012, 134, 19953–19956. [Google Scholar] [CrossRef] [PubMed]
- Kalinina, M.; Skvortsov, D.; Kalmykova, S.; Ivanov, T.; Dontsova, O.; Pervouchine, D.D. Multiple competing RNA structures dynamically control alternative splicing in the human ATE1 gene. Nucleic Acids Res. 2021, 49, 479–490. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Goodrich, K.J.; Conlon, E.G.; Gao, J.; Erbse, A.H.; Manley, J.L.; Cech, T.R. C9orf72 and triplet repeat disorder RNAs: G-quadruplex formation, binding to PRC2 and implications for disease mechanisms. RNA 2019, 25, 935–947. [Google Scholar] [CrossRef]
- Imperatore, J.A.; Then, M.L.; McDougal, K.B.; Mihailescu, M.R. Characterization of a G-Quadruplex Structure in Pre-miRNA-1229 and in Its Alzheimer’s Disease-Associated Variant rs2291418: Implications for miRNA-1229 Maturation. Int. J. Mol. Sci. 2020, 21, 767. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santos, T.; Miranda, A.; Imbert, L.; Monchaud, D.; Salgado, G.F.; Cabrita, E.J.; Cruz, C. Targeting a G-quadruplex from let-7e pre-miRNA with small molecules and nucleolin. J. Pharm. Biomed. Anal. 2022, 215, 114757. [Google Scholar] [CrossRef]
- Pandey, S.; Agarwala, P.; Jayaraj, G.G.; Gargallo, R.; Maiti, S. The RNA Stem-Loop to G-Quadruplex Equilibrium Controls Mature MicroRNA Production inside the Cell. Biochemistry 2015, 54, 7067–7078. [Google Scholar] [CrossRef] [Green Version]
- Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global Cancer Incidence and Mortality Rates and Trends--An Update. Cancer Epidemiol Biomarkers Prev. 2016, 1, 16–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin. 2011, 61, 69–90. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rode, A.B.; Endoh, T.; Sugimoto, N. tRNA Shifts the G-quadruplex-Hairpin Conformational Equilibrium in RNA towards the Hairpin Conformer. Angew. Chem. Int. Ed. Engl. 2016, 55, 14315–14319. [Google Scholar] [CrossRef]
- Birney, E.; Andrews, T.D.; Bevan, P.; Caccamo, M.; Chen, Y.; Clarke, L.; Coates, G.; Cuff, J.; Curwen, V.; Cutts, T.; et al. An overview of Ensembl. Genome Res. 2004, 14, 925–928. [Google Scholar] [CrossRef] [Green Version]
- Kikin, O.; D’Antonio, L.; Bagga, P.S. QGRS Mapper: A web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. 2006, 34, W676–W682. [Google Scholar] [CrossRef]
- Hofacker, I.L. Vienna RNA secondary structure server. Nucleic Acids Res. 2003, 31, 3429–3431. [Google Scholar] [CrossRef] [Green Version]
- Theimer, C.A.; Blois, C.A.; Feigon, J. Structure of the human telomerase RNA pseudoknot reveals conserved tertiary interactions essential for function. Mol. Cell 2005, 17, 671–682. [Google Scholar] [CrossRef]
- Wang, S.; Ke, H.; Zhang, H.; Ma, Y.; Ao, L.; Zou, L.; Yang, Q.; Zhu, H.; Nie, J.; Wu, C.; et al. LncRNA MIR100HG promotes cell proliferation in triple-negative breast cancer through triplex formation with p27 loci. Cell Death Dis. 2018, 9, 805. [Google Scholar] [CrossRef] [Green Version]
- Lukong, K.E.; Chang, K.W.; Khandjian, E.W.; Richard, S. RNA-binding proteins in human genetic disease. Trends Genet. 2008, 24, 416–425. [Google Scholar] [CrossRef] [PubMed]
- Conlon, E.G.; Lu, L.; Sharma, A.; Yamazaki, T.; Tang, T.; Shneider, N.A.; Manley, J.L. The C9ORF72 GGGGCC expansion forms RNA G-quadruplex inclusions and sequesters hnRNP H to disrupt splicing in ALS brains. Elife 2016, 5, e17820. [Google Scholar] [CrossRef] [PubMed]
- Turcotte, M.A.; Garant, J.M.; Cossette-Roberge, H.; Perreault, J.P. Guanine Nucleotide-Binding Protein-Like 1 (GNL1) binds RNA G-quadruplex structures in genes associated with Parkinson’s disease. RNA Biol. 2021, 18, 1339–1353. [Google Scholar] [CrossRef]
- Lago, S.; Tosoni, E.; Nadai, M.; Palumbo, M.; Richter, S.N. The cellular protein nucleolin preferentially binds long-looped G-quadruplex nucleic acids. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1371–1381. [Google Scholar] [CrossRef]
- Haeusler, A.R.; Donnelly, C.J.; Periz, G.; Simko, E.A.; Shaw, P.G.; Kim, M.S.; Maragakis, N.J.; Troncoso, J.C.; Pandey, A.; Sattler, R.; et al. C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature 2014, 507, 195–200. [Google Scholar] [CrossRef] [Green Version]
- Zhang, K.; Zheludev, I.N.; Hagey, R.J.; Haslecker, R.; Hou, Y.J.; Kretsch, R.; Pintilie, G.D.; Rangan, R.; Kladwang, W.; Li, S.; et al. Cryo-EM and antisense targeting of the 28-kDa frameshift stimulation element from the SARS-CoV-2 RNA genome. Nat. Struct. Mol. Biol. 2021, 28, 747–754. [Google Scholar] [CrossRef]
- Lan, T.C.T.; Allan, M.F.; Malsick, L.E.; Woo, J.Z.; Zhu, C.; Zhang, F.; Khandwala, S.; Nyeo, S.S.Y.; Sun, Y.; Guo, J.U.; et al. Secondary structural ensembles of the SARS-CoV-2 RNA genome in infected cells. Nat. Commun. 2022, 13, 1128. [Google Scholar] [CrossRef] [PubMed]
- Kelly, J.A.; Olson, A.N.; Neupane, K.; Munshi, S.; San Emeterio, J.; Pollack, L.; Woodside, M.T.; Dinman, J.D. Structural and functional conservation of the programmed-1 ribosomal frameshift signal of SARS coronavirus 2 (SARS-CoV-2). J. Biol. Chem. 2020, 295, 10741–10748. [Google Scholar] [CrossRef]
- Sun, Y.; Abriola, L.; Niederer, R.O.; Pedersen, S.F.; Alfajaro, M.M.; Silva Monteiro, V.; Wilen, C.B.; Ho, Y.C.; Gilbert, W.V.; Surovtseva, Y.V.; et al. Restriction of SARS-CoV-2 replication by targeting programmed -1 ribosomal frameshifting. Proc. Natl. Acad. Sci. USA 2021, 118, e2023051118. [Google Scholar] [CrossRef]
- Stammler, S.N.; Cao, S.; Chen, S.J.; Giedroc, D.P. A conserved RNA pseudoknot in a putative molecular switch domain of the 3’-untranslated region of coronaviruses is only marginally stable. RNA 2011, 17, 1747–1759. [Google Scholar] [CrossRef] [Green Version]
- Gultyaev, A.P.; Heus, H.A.; Olsthoorn, R.C. An RNA conformational shift in recent H5N1 influenza A viruses. Bioinformatics 2007, 23, 272–276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akiyama, B.M.; Laurence, H.M.; Massey, A.R.; Costantino, D.A.; Xie, X.; Yang, Y.; Shi, P.Y.; Nix, J.C.; Beckham, J.D.; Kieft, J.S. Zika virus produces noncoding RNAs using a multi-pseudoknot structure that confounds a cellular exonuclease. Science 2016, 354, 1148–1152. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piekna-Przybylska, D.; Sullivan, M.A.; Sharma, G.; Bambara, R.A. U3 region in the HIV-1 genome adopts a G-quadruplex structure in its RNA and DNA sequence. Biochemistry 2014, 53, 2581–2593. [Google Scholar] [CrossRef] [PubMed]
- Majee, P.; Kumar Mishra, S.; Pandya, N.; Shankar, U.; Pasadi, S.; Muniyappa, K.; Nayak, D.; Kumar, A. Identification and characterization of two conserved G-quadruplex forming motifs in the Nipah virus genome and their interaction with G-quadruplex specific ligands. Sci. Rep. 2020, 10, 1477. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.; Du, W.; Sang, X.; Tong, Q.; Wang, Y.; Chen, G.; Yuan, Y.; Jiang, L.; Cheng, W.; Liu, D.; et al. RNA G-quadruplex in TMPRSS2 reduces SARS-CoV-2 infection. Nat. Commun. 2022, 13, 1444. [Google Scholar] [CrossRef]
- Zhao, C.; Qin, G.; Niu, J.; Wang, Z.; Wang, C.; Ren, J.; Qu, X. Targeting RNA G-Quadruplex in SARS-CoV-2: A Promising Therapeutic Target for COVID-19? Angew. Chem. Int. Ed. Engl. 2021, 60, 432–438. [Google Scholar] [CrossRef]
- Leahy, M.B.; Dobbyn, H.C.; Brownlee, G.G. Hairpin loop structure in the 3’ arm of the influenza A virus virion RNA promoter is required for endonuclease activity. J. Virol. 2001, 75, 7042–7049. [Google Scholar] [CrossRef] [Green Version]
- Shamoo, Y.; Tam, A.; Konigsberg, W.H.; Williams, K.R. Translational repression by the bacteriophage T4 gene 32 protein involves specific recognition of an RNA pseudoknot structure. J. Mol. Biol. 1993, 232, 89–104. [Google Scholar] [CrossRef]
- Winkler, W.C.; Breaker, R.R. Genetic control by metabolite-binding riboswitches. Chembiochem 2003, 4, 1024–1032. [Google Scholar] [CrossRef] [PubMed]
- Grundy, F.J.; Henkin, T.M. Regulation of gene expression by effectors that bind to RNA. Curr. Opin. Microbiol. 2004, 7, 126–131. [Google Scholar] [CrossRef] [PubMed]
- Montange, R.K.; Batey, R.T. Structure of the S-adenosylmethionine riboswitch regulatory mRNA element. Nature 2006, 441, 1172–1175. [Google Scholar] [CrossRef] [PubMed]
- Miranda-Rios, J.; Navarro, M.; Soberon, M. A conserved RNA structure (thi box) is involved in regulation of thiamin biosynthetic gene expression in bacteria. Proc. Natl. Acad. Sci. USA 2001, 98, 9736–9741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedrolli, D.; Langer, S.; Hobl, B.; Schwarz, J.; Hashimoto, M.; Mack, M. The ribB FMN riboswitch from Escherichia coli operates at the transcriptional and translational level and regulates riboflavin biosynthesis. FEBS J. 2015, 282, 3230–3242. [Google Scholar] [CrossRef] [PubMed]
- Batey, R.T.; Gilbert, S.D.; Montange, R.K. Structure of a natural guanine-responsive riboswitch complexed with the metabolite hypoxanthine. Nature 2004, 432, 411–415. [Google Scholar] [CrossRef] [PubMed]
- Serganov, A.; Yuan, Y.R.; Pikovskaya, O.; Polonskaia, A.; Malinina, L.; Phan, A.T.; Hobartner, C.; Micura, R.; Breaker, R.R.; Patel, D.J. Structural basis for discriminative regulation of gene expression by adenine- and guanine-sensing mRNAs. Chem. Biol. 2004, 11, 1729–1741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sudarsan, N.; Wickiser, J.K.; Nakamura, S.; Ebert, M.S.; Breaker, R.R. An mRNA structure in bacteria that controls gene expression by binding lysine. Genes Dev. 2003, 17, 2688–2697. [Google Scholar] [CrossRef] [Green Version]
- Dann, C.E., 3rd; Wakeman, C.A.; Sieling, C.L.; Baker, S.C.; Irnov, I.; Winkler, W.C. Structure and mechanism of a metal-sensing regulatory RNA. Cell 2007, 130, 878–892. [Google Scholar] [CrossRef] [Green Version]
- Tang, D.J.; Du, X.; Shi, Q.; Zhang, J.L.; He, Y.P.; Chen, Y.M.; Ming, Z.; Wang, D.; Zhong, W.Y.; Liang, Y.W.; et al. A SAM-I riboswitch with the ability to sense and respond to uncharged initiator tRNA. Nat. Commun. 2020, 11, 2794. [Google Scholar] [CrossRef]
- Zhou, L.B.; Zeng, A.P. Exploring lysine riboswitch for metabolic flux control and improvement of L-lysine synthesis in Corynebacterium glutamicum. ACS Synth. Biol. 2015, 4, 729–734. [Google Scholar] [CrossRef]
- Roy, S.; Hennelly, S.P.; Lammert, H.; Onuchic, J.N.; Sanbonmatsu, K.Y. Magnesium controls aptamer-expression platform switching in the SAM-I riboswitch. Nucleic Acids Res. 2019, 47, 3158–3170. [Google Scholar] [CrossRef] [PubMed]
- Shao, X.; Zhang, W.; Umar, M.I.; Wong, H.Y.; Seng, Z.; Xie, Y.; Zhang, Y.; Yang, L.; Kwok, C.K.; Deng, X. RNA G-Quadruplex Structures Mediate Gene Regulation in Bacteria. mBio 2020, 11, e02926-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emory, S.A.; Bouvet, P.; Belasco, J.G. A 5’-terminal stem-loop structure can stabilize mRNA in Escherichia coli. Genes Dev. 1992, 6, 135–148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henkin, T.M. Transcription termination control in bacteria. Curr. Opin. Microbiol. 2000, 3, 149–153. [Google Scholar] [CrossRef]
- Gomez, D.; Lemarteleur, T.; Lacroix, L.; Mailliet, P.; Mergny, J.L.; Riou, J.F. Telomerase downregulation induced by the G-quadruplex ligand 12459 in A549 cells is mediated by hTERT RNA alternative splicing. Nucleic Acids Res. 2004, 32, 371–379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bugaut, A.; Rodriguez, R.; Kumari, S.; Hsu, S.T.; Balasubramanian, S. Small molecule-mediated inhibition of translation by targeting a native RNA G-quadruplex. Org. Biomol. Chem. 2010, 8, 2771–2776. [Google Scholar] [CrossRef] [PubMed]
- Katsuda, Y.; Sato, S.; Asano, L.; Morimura, Y.; Furuta, T.; Sugiyama, H.; Hagihara, M.; Uesugi, M. A Small Molecule That Represses Translation of G-Quadruplex-Containing mRNA. J. Am. Chem. Soc. 2016, 138, 9037–9040. [Google Scholar] [CrossRef]
- Faudale, M.; Cogoi, S.; Xodo, L.E. Photoactivated cationic alkyl-substituted porphyrin binding to g4-RNA in the 5′-UTR of KRAS oncogene represses translation. Chem. Commun. (Camb.) 2012, 48, 874–876. [Google Scholar] [CrossRef]
- Miglietta, G.; Cogoi, S.; Marinello, J.; Capranico, G.; Tikhomirov, A.S.; Shchekotikhin, A.; Xodo, L.E. RNA G-Quadruplexes in Kirsten Ras (KRAS) Oncogene as Targets for Small Molecules Inhibiting Translation. J. Med. Chem. 2017, 60, 9448–9461. [Google Scholar] [CrossRef]
- Simone, R.; Fratta, P.; Neidle, S.; Parkinson, G.N.; Isaacs, A.M. G-quadruplexes: Emerging roles in neurodegenerative diseases and the non-coding transcriptome. FEBS Lett. 2015, 589, 1653–1668. [Google Scholar] [CrossRef]
- Su, Z.; Zhang, Y.; Gendron, T.F.; Bauer, P.O.; Chew, J.; Yang, W.Y.; Fostvedt, E.; Jansen-West, K.; Belzil, V.V.; Desaro, P.; et al. Discovery of a biomarker and lead small molecules to target r(GGGGCC)-associated defects in c9FTD/ALS. Neuron 2014, 83, 1043–1050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simone, R.; Balendra, R.; Moens, T.G.; Preza, E.; Wilson, K.M.; Heslegrave, A.; Woodling, N.S.; Niccoli, T.; Gilbert-Jaramillo, J.; Abdelkarim, S.; et al. G-quadruplex-binding small molecules ameliorate C9orf72 FTD/ALS pathology in vitro and in vivo. EMBO Mol. Med. 2018, 10, 22–31. [Google Scholar] [CrossRef]
- Zamiri, B.; Reddy, K.; Macgregor, R.B., Jr.; Pearson, C.E. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins. J. Biol. Chem. 2014, 289, 4653–4659. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Schultz, P.G.; Johnson, K.A. Mechanistic studies of a small-molecule modulator of SMN2 splicing. Proc. Natl. Acad. Sci. USA 2018, 115, E4604–E4612. [Google Scholar] [CrossRef] [Green Version]
- Disney, M.D.; Liu, B.; Yang, W.Y.; Sellier, C.; Tran, T.; Charlet-Berguerand, N.; Childs-Disney, J.L. A small molecule that targets r(CGG)(exp) and improves defects in fragile X-associated tremor ataxia syndrome. ACS Chem. Biol. 2012, 7, 1711–1718. [Google Scholar] [CrossRef] [Green Version]
- Park, S.J.; Kim, Y.G.; Park, H.J. Identification of RNA pseudoknot-binding ligand that inhibits the -1 ribosomal frameshifting of SARS-coronavirus by structure-based virtual screening. J. Am. Chem. Soc. 2011, 133, 10094–10100. [Google Scholar] [CrossRef] [PubMed]
- Le Grice, S.F. Targeting the HIV RNA genome: High-hanging fruit only needs a longer ladder. Curr. Top. Microbiol. Immunol. 2015, 389, 147–169. [Google Scholar] [CrossRef] [PubMed]
- Stelzer, A.C.; Frank, A.T.; Kratz, J.D.; Swanson, M.D.; Gonzalez-Hernandez, M.J.; Lee, J.; Andricioaei, I.; Markovitz, D.M.; Al-Hashimi, H.M. Discovery of selective bioactive small molecules by targeting an RNA dynamic ensemble. Nat. Chem. Biol. 2011, 7, 553–559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parsons, J.; Castaldi, M.P.; Dutta, S.; Dibrov, S.M.; Wyles, D.L.; Hermann, T. Conformational inhibition of the hepatitis C virus internal ribosome entry site RNA. Nat. Chem. Biol. 2009, 5, 823–825. [Google Scholar] [CrossRef] [PubMed]
- Dibrov, S.M.; Johnston-Cox, H.; Weng, Y.H.; Hermann, T. Functional architecture of HCV IRES domain II stabilized by divalent metal ions in the crystal and in solution. Angew. Chem. Int. Ed. Engl. 2007, 46, 226–229. [Google Scholar] [CrossRef]
- Lukavsky, P.J.; Kim, I.; Otto, G.A.; Puglisi, J.D. Structure of HCV IRES domain II determined by NMR. Nat. Struct. Biol. 2003, 10, 1033–1038. [Google Scholar] [CrossRef]
- Artusi, S.; Ruggiero, E.; Nadai, M.; Tosoni, B.; Perrone, R.; Ferino, A.; Zanin, I.; Xodo, L.; Flamand, L.; Richter, S.N. Antiviral Activity of the G-Quadruplex Ligand TMPyP4 against Herpes Simplex Virus-1. Viruses 2021, 13, 196. [Google Scholar] [CrossRef]
- Howe, J.A.; Wang, H.; Fischmann, T.O.; Balibar, C.J.; Xiao, L.; Galgoci, A.M.; Malinverni, J.C.; Mayhood, T.; Villafania, A.; Nahvi, A.; et al. Selective small-molecule inhibition of an RNA structural element. Nature 2015, 526, 672–677. [Google Scholar] [CrossRef] [PubMed]
- Sudarsan, N.; Cohen-Chalamish, S.; Nakamura, S.; Emilsson, G.M.; Breaker, R.R. Thiamine pyrophosphate riboswitches are targets for the antimicrobial compound pyrithiamine. Chem Biol. 2005, 12, 1325–1335. [Google Scholar] [CrossRef] [Green Version]
- World Health Organization. WHO Publishes List of Bacteria for Which New Antibiotics Are Urgently Needed. 2017. Available online: https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 13 September 2022).
- Centers for Disease Control and Prevention. 2019 AR Threats Report. 2019. Available online: https://www.cdc.gov/drugresistance/biggest-threats.html (accessed on 13 September 2022).
- Griffiths-Jones, S.; Bateman, A.; Marshall, M.; Khanna, A.; Eddy, S.R. Rfam: An RNA family database. Nucleic Acids Res. 2003, 31, 439–441. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumari, S.; Bugaut, A.; Huppert, J.L.; Balasubramanian, S. An RNA G-quadruplex in the 5’ UTR of the NRAS proto-oncogene modulates translation. Nat. Chem. Biol. 2007, 3, 218–221. [Google Scholar] [CrossRef] [Green Version]
- Tomaszewska, M.; Szabat, M.; Zielinska, K.; Kierzek, R. Identification and Structural Aspects of G-Quadruplex-Forming Sequences from the Influenza A Virus Genome. Int. J. Mol. Sci. 2021, 22, 6031. [Google Scholar] [CrossRef] [PubMed]
- Rijnbrand, R.; van der Straaten, T.; van Rijn, P.A.; Spaan, W.J.; Bredenbeek, P.J. Internal entry of ribosomes is directed by the 5’ noncoding region of classical swine fever virus and is dependent on the presence of an RNA pseudoknot upstream of the initiation codon. J. Virol. 1997, 71, 451–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Cheema, J.; Zhang, Y.; Deng, H.; Duncan, S.; Umar, M.I.; Zhao, J.; Liu, Q.; Cao, X.; Kwok, C.K.; et al. RNA G-quadruplex structures exist and function in vivo in plants. Genome Biol. 2020, 21, 226. [Google Scholar] [CrossRef] [PubMed]
- Wachter, A.; Tunc-Ozdemir, M.; Grove, B.C.; Green, P.J.; Shintani, D.K.; Breaker, R.R. Riboswitch control of gene expression in plants by splicing and alternative 3’ end processing of mRNAs. Plant Cell 2007, 19, 3437–3450. [Google Scholar] [CrossRef] [PubMed]
- Olsthoorn, R.C.L.; Owen, C.A.; Livieratos, I.C. Role of an RNA pseudoknot involving the polyA tail in replication of Pepino mosaic potexvirus and related plant viruses. Sci. Rep. 2022, 12, 11532. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Chu, Z.; Yang, X. A Key Molecular Regulator, RNA G-Quadruplex and Its Function in Plants. Front Plant Sci. 2022, 13, 926953. [Google Scholar] [CrossRef]
- Griffin, B.D.; Bass, H.W. Review: Plant G-quadruplex (G4) motifs in DNA and RNA; abundant, intriguing sequences of unknown function. Plant Sci. 2018, 269, 143–147. [Google Scholar] [CrossRef] [PubMed]
- Yadav, V.; Kim, N.; Tuteja, N.; Yadav, P.G.; Yadav, V. Quadruplex in Plants: A Ubiquitous Regulatory Element and Its Biological Relevance. Front. Plant Sci. 2017, 8, 1163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- El Mouali, Y.; Balsalobre, C. 3′untranslated regions: Regulation at the end of the road. Curr. Genet. 2019, 65, 127–131. [Google Scholar] [CrossRef]
- Dar, D.; Prasse, D.; Schmitz, R.A.; Sorek, R. Widespread formation of alternative 3′ UTR isoforms via transcription termination in archaea. Nat. Microbiol. 2016, 1, 16143. [Google Scholar] [CrossRef]
- Rouleau, S.; Glouzon, J.S.; Brumwell, A.; Bisaillon, M.; Perreault, J.P. 3′ UTR G-quadruplexes regulate miRNA binding. RNA 2017, 23, 1172–1179. [Google Scholar] [CrossRef] [Green Version]
- Bugaut, A.; Balasubramanian, S. 5’-UTR RNA G-quadruplexes: Translation regulation and targeting. Nucleic Acids Res. 2012, 40, 4727–4741. [Google Scholar] [CrossRef] [Green Version]
- Leppek, K.; Das, R.; Barna, M. Functional 5’ UTR mRNA structures in eukaryotic translation regulation and how to find them. Nat. Rev. Mol. Cell Biol. 2018, 19, 158–174. [Google Scholar] [CrossRef] [Green Version]
- Warf, M.B.; Berglund, J.A. Role of RNA structure in regulating pre-mRNA splicing. Trends Biochem. Sci. 2010, 35, 169–178. [Google Scholar] [CrossRef]
- Jacquenet, S.; Ropers, D.; Bilodeau, P.S.; Damier, L.; Mougin, A.; Stoltzfus, C.M.; Branlant, C. Conserved stem-loop structures in the HIV-1 RNA region containing the A3 3’ splice site and its cis-regulatory element: Possible involvement in RNA splicing. Nucleic Acids Res. 2001, 29, 464–478. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dethoff, E.A.; Chugh, J.; Mustoe, A.M.; Al-Hashimi, H.M. Functional complexity and regulation through RNA dynamics. Nature 2012, 482, 322–330. [Google Scholar] [CrossRef] [Green Version]
- Hollands, K.; Proshkin, S.; Sklyarova, S.; Epshtein, V.; Mironov, A.; Nudler, E.; Groisman, E.A. Riboswitch control of Rho-dependent transcription termination. Proc. Natl. Acad. Sci. USA 2012, 109, 5376–5381. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Narberhaus, F.; Waldminghaus, T.; Chowdhury, S. RNA thermometers. FEMS Microbiol. Rev. 2006, 30, 3–16. [Google Scholar] [CrossRef] [Green Version]
- Caron, M.P.; Bastet, L.; Lussier, A.; Simoneau-Roy, M.; Masse, E.; Lafontaine, D.A. Dual-acting riboswitch control of translation initiation and mRNA decay. Proc. Natl. Acad. Sci. USA 2012, 109, E3444–E3453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boeras, I.; Seufzer, B.; Brady, S.; Rendahl, A.; Heng, X.; Boris-Lawrie, K. The basal translation rate of authentic HIV-1 RNA is regulated by 5’UTR nt-pairings at junction of R and U5. Sci. Rep. 2017, 7, 6902. [Google Scholar] [CrossRef] [PubMed]
- Varshney, D.; Cuesta, S.M.; Herdy, B.; Abdullah, U.B.; Tannahill, D.; Balasubramanian, S. RNA G-quadruplex structures control ribosomal protein production. Sci Rep. 2021, 11, 22735. [Google Scholar] [CrossRef]
- Pfleger, B.F.; Pitera, D.J.; Smolke, C.D.; Keasling, J.D. Combinatorial engineering of intergenic regions in operons tunes expression of multiple genes. Nat. Biotechnol. 2006, 24, 1027–1032. [Google Scholar] [CrossRef] [PubMed]
- Na, D.; Yoo, S.M.; Chung, H.; Park, H.; Park, J.H.; Lee, S.Y. Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs. Nat. Biotechnol. 2013, 31, 170–174. [Google Scholar] [CrossRef]
- Zhou, L.B.; Zeng, A.P. Engineering a Lysine-ON Riboswitch for Metabolic Control of Lysine Production in Corynebacterium glutamicum. ACS Synth. Biol. 2015, 4, 1335–1340. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Jensen, M.K.; Keasling, J.D. Development of biosensors and their application in metabolic engineering. Curr. Opin. Chem. Biol. 2015, 28, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, C.M.; Smolke, C.D. RNA Switches for Synthetic Biology. Cold Spring Harb. Perspect. Biol. 2019, 11, a032532. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, Z.; Zhang, C.; Zhang, J.; Jin, P.; Zhang, J.; Du, G.; Chen, J. Small RNA regulators in bacteria: Powerful tools for metabolic engineering and synthetic biology. Appl. Microbiol. Biotechnol. 2014, 98, 3413–3424. [Google Scholar] [CrossRef] [PubMed]
- Keasling, J.D. Synthetic biology and the development of tools for metabolic engineering. Metab. Eng. 2012, 14, 189–195. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′–3′) | G-Score * | Hairpin Stability ** −ΔG° (Kcal/mol) |
---|---|---|---|
ABL2 | CCACTCAGGGCCAGGGCCTGGGCTGGG | 41 | 12.40 |
MN1 | GGGCGGGGGGAGGGACCGCTC | 41 | 8.80 |
RALB | GCCGCGGCTTGGGCAGGGTCAGGGCTGGG | 41 | 9.90 |
MYBL1 | CGGAGCCGGGCTGGGGCCAGGGCAGGG | 41 | 9.20 |
SKI | CGGCGGCGGGGGCCGGGGGGGCCCGGG | 40 | 11.90 |
HRAS | GGGTGGGGCCGGGCGGGGCCCGCG | 42 | 14.40 |
ETS1 | GGGAGCGGGCGAGGGCCGGGCAGGAGGAGC | 41 | 7.30 |
Pathogenic Bacteria | Riboswitches | ||||||||
---|---|---|---|---|---|---|---|---|---|
TPP | FMN | Cobalamin | Glycine | Lysine | Purine | Pre Q1 * | Mo Co-factor ** | Mg 2+ | |
Mycobacterium tuberculosis | + | + | + | + | − | − | − | − | − |
Acinetobacter baumannii | + | + | + | + | − | − | − | − | − |
P. aeruginosa | + | + | + | − | − | − | − | − | − |
Staphylococcus aureus | + | + | − | + | + | + | − | − | − |
Neisseria gonorrhoeae | + | − | − | + | − | − | + | − | − |
Salmonella | + | + | + | + | + | − | − | + | + |
Enterococcus faecium | + | + | − | − | + | + | + | − | − |
Streptococcus pneumoniae | + | + | − | + | − | + | + | − | − |
Haemophilus influenzae | + | − | − | + | + | − | + | + | − |
Shigella | + | + | + | − | + | − | − | + | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gupta, P.; Khadake, R.M.; Panja, S.; Shinde, K.; Rode, A.B. Alternative RNA Conformations: Companion or Combatant. Genes 2022, 13, 1930. https://doi.org/10.3390/genes13111930
Gupta P, Khadake RM, Panja S, Shinde K, Rode AB. Alternative RNA Conformations: Companion or Combatant. Genes. 2022; 13(11):1930. https://doi.org/10.3390/genes13111930
Chicago/Turabian StyleGupta, Payal, Rushikesh M. Khadake, Shounok Panja, Krushna Shinde, and Ambadas B. Rode. 2022. "Alternative RNA Conformations: Companion or Combatant" Genes 13, no. 11: 1930. https://doi.org/10.3390/genes13111930
APA StyleGupta, P., Khadake, R. M., Panja, S., Shinde, K., & Rode, A. B. (2022). Alternative RNA Conformations: Companion or Combatant. Genes, 13(11), 1930. https://doi.org/10.3390/genes13111930