Next Article in Journal
Genome-Wide Investigation and Characterization of SWEET Gene Family with Focus on Their Evolution and Expression during Hormone and Abiotic Stress Response in Maize
Previous Article in Journal
Characterization of CRH-Binding Protein (CRHBP) in Chickens: Molecular Cloning, Tissue Distribution and Investigation of Its Role as a Negative Feedback Regulator within the Hypothalamus–Pituitary–Adrenal Axis
Previous Article in Special Issue
Genome-Wide Analysis of the Type-B Authentic Response Regulator Gene Family in Brassica napus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 13
Issue 10
10.3390/genes13101681
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus

by
Jianghua Shi
*,
Xiyuan Ni
,
Jixiang Huang
,
Ying Fu
,
Tanliu Wang
,
Huasheng Yu
and
Yaofeng Zhang
Key Laboratory of Digital Upland Crops of Zhejiang Province, Institute of Crop and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
*
Author to whom correspondence should be addressed.
Genes 2022, 13(10), 1681; https://doi.org/10.3390/genes13101681
Submission received: 16 August 2022 / Revised: 16 September 2022 / Accepted: 19 September 2022 / Published: 20 September 2022
(This article belongs to the Special Issue Discovery and Exploration of Functional Genes in Oil Crops)
Browse Figures
Review Reports Versions Notes

Abstract

:
Fatty acid (FA) composition determines the quality of oil from oilseed crops, and thus is a major target for genetic improvement. FAD2 (Fatty acid dehydrogenase 2) and FAE1 (fatty acid elongase 1) are critical FA synthetic genes, and have been the focus of genetic manipulation to alter fatty acid composition in oilseed plants. In this study, to improve the nutritional quality of rapeseed cultivar CY2 (about 50% oil content; of which 40% erucic acid), we generated novel knockout plants by CRISPR/Cas9 mediated genome editing of BnFAD2 and BnFAE1 genes. Two guide RNAs were designed to target one copy of the BnFAD2 gene and two copies of the BnFAE1 gene, respectively. A number of lines with mutations at three target sites of BnFAD2 and BnFAE1 genes were identified by sequence analysis. Three of these lines showed mutations in all three target sites of the BnFAD2 and BnFAE1 genes. Fatty acid composition analysis of seeds revealed that mutations at all three sites resulted in significantly increased oleic acid (70–80%) content compared with that of CY2 (20%), greatly reduced erucic acid levels and slightly decreased polyunsaturated fatty acids content. Our results confirmed that the CRISPR/Cas9 system is an effective tool for improving this important trait.

Graphical Abstract

1. Introduction

Rapeseed (B. napus) is one of the most important oil-producing crops. The global production of rapeseed oil was 27.98 million tons during 2019 to 2020, making it the third largest source of vegetable oil (https://www.ers.usda.gov/data-products/oil-crops-yearbook/oil-crops-yearbook/ (accessed on 25 March 2022). Rapeseed oil is an important edible oil with high nutritional value [1], as well as a source for biodiesel fuels and raw materials in industry [2,3]. As an important breeding goal, the nutritional quality of oilseed oil is mainly determined by its fatty acid balance [4].
In rapeseed oil, the fatty acid profile contains palmitic (C16:0), stearic (C18:0), oleic (C18:1), linoleic (C18:2), linolenic (C18:3), eicosenoic (C20:1) and erucic (C22:1) acids [5]. In the seeds of the current “double low” (low erucic acid and low glucosinolate) rapeseed cultivar, the relative content of oleic acid is about 60%, and oil content ranges from 38–50%. Higher erucic acid content in rapeseed oil can cause myocardial damage and muscle lesions in the heart [6,7]. The higher oleic acid rapeseed oil not only increases oil stability at high temperature, prolonging shelf time [6,7], but also reduces cholesterol levels in rapeseed oil consumers, preventing the risk of arteriosclerosis and inflammatory diseases [8,9]. Therefore, genetic improvement should be carried out to promote oil quality, especially to further increase the oleic acid contents in rapeseed.
FAD2, encoding fatty acid desaturase 2, catalyzes the first committed step of the biosynthesis of polyunsaturated fatty acids from oleic acid to linoleic acid. B. napus (AACC, 2n = 38) is an allotetraploid species, containing four FAD2 alleles, including BnFAD2.A5, BnFAD2.A1 (a nonfunctional enzyme), BnFAD2.C5 and BnFAD2.C1. [10]. Loss of function (4-bp insertion or single-nucleotide mutations in the coding regions) of BnFAD2 genes [10,11,12], or mutations in BnFAD2 genes generated by ethyl methanesulfonate treatment [13,14], resulted in increased oleic acid levels. The expression of BnFAD2 can be depressed to increase the proportion of oleic acid in rapeseed using RNAi knockdown [15,16]. FAE1, encoding fatty acid elongase1, catalyzes the initial condensation step in the elongation pathway of very long chain fatty acid biosynthesis, and is thus a key gene in erucic acid bioxynthesis. There are two functional alleles of FAE1 on the A8 and C3 chromosomes in B. napus. Expression of BnFAE1 genes also closely relates to oleic acid content in rapeseed. Previous studies have reported that knockout of FAE1 and knockdown of FAE1 expression results in decreased erucic acid levels and increased oleic acid content [15,16,17,18]. Altogether, the studies discussed here show that FAD2 and FAE1 are suitable target genes for genetic manipulation to increase oleic acid content in rapeseed.
The CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas9 system is an innovative targeted genome editing system [19,20,21], widely used in basic science and crop genetic improvement due to its simplicity, high efficiency, precision and low cost [22]. Unlike RNA interference, CRISPR/Cas9 technology does not necessitate the persistence of T-DNA, which, in most plant species, can be easily removed from the edited plants in successive generations by self-pollinating or backcrossing with receptor materials [23,24]. Because of these benefits, CRISPR/Cas9 technology has strong application prospects in crop breeding. There are a number of reports of successful genetic improvement and gene editing mediated by CRISPR/Cas9 in B. napus. For example, herbicide-resistant oilseeds rape has been created by editing of BnALS1 gene [25], and rapeseed with multilocular siliques were obtained by editing of BnCLV [26]. Recently, novel mutants with high oleic acid content have been developed from double low (low erucic acid and low glucosinolate) rapeseed by editing of BnFAD2 genes [27,28]. Double high (high oil and high erucic acid) rapeseed is also an important germplasm resource, but has not been extensively utilized to create new high oleic acid germplasm using CRISPR/Cas9 mediated gene editing.
In this study, we used the CRISPR/Cas9 system to create novel high oleic acid germplasms from the CY2 cultivar (which has almost 50% oil content of which approximately 40% is erucic acid). A CRISPR/Cas9 vector with two sgRNA expression cassettes was constructed to target BnFAD2 and BnFAE1 genes and agrobacterium-mediated genetic transformation was used to generate transgenic plants. The targeted mutations at BnFAD2 and BnFAE1 genes significantly increased oleic acid contents in the edited lines as compared with CY2. Our results showed that the CRISPR/Cas9 system is an effective targeted genome editing tool for genetic improvement, which can create desired novel germplasms used for rapeseed breeding.

2. Materials and Methods

2.1. Plant Materials and Growth Conditions

A semi-winter B. napus cultivar CY2 was used for Agrobacterium-mediated transformation [16]. Plants of CY2 and all related transgenic plants were grown under field conditions. In Haining, Zhejiang province, seeds were usually sown in late September or early October, and harvested in late May. The field experiment followed a randomized complete block with three replications. Each line was planted in one row with 10–12 plants, with a distance of 20 cm between plants within each row and 35 cm between rows. The field management was performed in line with standard breeding practice.

2.2. Plasmid Construction

We used the binary vector system pCAMBIA-1300 with a hygromycin selection marker to target the BnFAD2 and BnFAE1 genes. The target sequences used to generate sgRNA expression cassettes were designed using CRISPR-GE (http://skl.scau.edu.cn/targetdesign/ (accessed on 3 March 2020)) [29]. One sgRNA was able to specifically target BnFAD2 (BnaC05g40970D), and another sgRNA could target two copies of BnFAE1 (BnaA08g11130D and BnaC03g65980D) (Figure 1). The primers used to construct sgRNA in this study are listed in Supplemental Table S1.
The construction of CRISPR/Cas9 vectors including Cas9 and multiple sgRNA expression cassettes was performed according to the procedure described previously [19]. Briefly, sgRNA sequences were introduced into the sgRNA expression cassettes by overlapping PCR. Then the purified PCR products were integrated into pLYCRISPR/Cas9P35S-H via a Golden Gate construct.
To evaluate off-target potential in this study, the putative off-target sites were predicted using the CRISPR-P version 2.0 program [29].

2.3. Genetic Transformation of B. napus

The CRISPR/Cas9 vector was transformed into Agrobacterium tumefaciens strain GV3101 through the freezing and thawing method. Then the editing vector was transformed into CY2 plants by hypocotyl segment transformation as described previously [30,31].

2.4. Mutation Analysis

Genomic DNA was extracted from selected plants using the hexadecyl trimethyl ammonium bromide (CTAB) method [32]. T0 plants were obtained by hygromycin (50 mg/L), and the presence of T-DNA elements was investigated by PCR with Cas9 specific primers [27]. The transgenic plants were grown in an isolated nursery at 25 °C under long-day conditions (16 h light/8 h night). The primers used to amplify the target regions were designed in the flanking region of the Cas9/sgRNA targets. The targeted mutagenesis was analyzed in the edited lines (T0 to T4 generation) by PCR amplification and Sanger sequencing. PCR conditions were as follows: For BnFAD2, 95 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 53 °C for 30 s, 72 °C for 1 min and a 7 min final extention at 72 °C; For BnFAE1 (BnaA08g11130D), 95 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 54 °C for 30 s, 72 °C for 1 min and a 7 min final extension at 72 °C. For BnFAE1 (BnaC03g65980D), 95 °C for 2 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and a 7 min final extension at 72 °C. The primers used for PCR amplification are listed in Supplemental Table S1.

2.5. Analysis of Lipids

For analyzing lipid levels, seeds were collected from plants (CY2 and the edited plants) grown under the same conditions and then stored in a freezer until they were analyzed. Analysis of the fatty acid levels was performed by GC–MS as described in [17]. Relative fatty acid compositions were calculated as the percent of each fatty acid relative to total measured fatty acids. The seed oil content was analyzed by the Soxhlet extraction method as described previously [33].

3. Results

3.1. CRISPR/Cas9-Mediated Editing of BnFAD2 and BnFAE1

To create high oleic acid oilseed rape, targeted mutations were generated to the BnFAD2 and BnFAE1 genes in CY2 cultivar. Using CRISP-GE (http://skl.scau.edu.cn/home/ (accessed on 1 May 2020)) [34], one single-guide RNA (sgRNA) was designed to target BnFAD2 (BnaC05g40970D), and the other was designed to simultaneously target two copies of BnFAE1 (BnaA08g11130D and BnaC03g65980D) (Figure 1a). A single editing vector (Figure 1b) that targeted BnFAD2 and BnFAE1 with two sgRNA expression cassettes was constructed using a CRISPR/Cas9 basic vector as described previously [19]. The CRISPR/Cas9 vector used in this study contains a hygromycin phosphotransferase (HPT) selection marker, sgRNA transcriptions and a Cas9 nickase. sgRNAs were driven by the Arabidopsis U3d and U3b promoter, respectively.
The editing vector was transformed into B. napus ‘CY2′ using the Agrobacterium tumefaciens-mediated hypocotyl method, generating 30 independent T0 plants. All independent T0 plants were positive transformants harboring T-DNA insertions from PCR analysis using Cas9-specific primers [27]. The target regions of BnFAD2 and BnFAE1 were amplified by PCR using gene specific primers and were subjected to Sanger sequencing. Based on the sequencing results, twelve, six and five out of 30 T0 plants exhibited editing events in the target sites of BnaC05g40970D (BnFAD2), BnaA08g11130D (BnFAE1) and BnaC03g65980D (BnFAE1), respectively (Table 1). Three lines (Line 6, Line11 and Line 14) showed mutations in all three target sites of BnaC05g40970D, BnaA08g11130D and BnaC03g65980D (Table 1).
To evaluate off-target potential in this study, the putative off-target sites were predicted using the CRISPR-P version 2.0 program [35]. Then 15 putative off-target sites for both BnFAD2 and BnFAE1 were identified by the program with default settings. Of these, seven putative off-target sites located at the CDS coding sequences were chosen for further analysis. The sequencing results for 16 edited plants did not show any editing events (Table 2).

3.2. Mutations at BnFAD2 and BnFAE1 Altered Fatty Acid Profiles in the Edited Plants

In the edited plants listed in Table 1, three lines (Line 6, Line 11 and Line 14) exhibited editing events in three target sites of BnaC05g40970D, BnaA08g11130D and BnaC03g65980D. The three lines were followed for the next four generations. Homozygous three-target mutation lines (Line 6-9-7-3-1, Line 14-7-12-4-9 and Line 11-9-18-7-4) were identified (Figure 2). The mutation sites remained the same at the target sites of BnaC05g40970D, BnaA08g11130D and BnaC03g65980D through generations (Figure 2).
To characterize the effect of editing events of BnFAE1 and BnFAD2 on seed fatty acid levels, mature seeds from the edited plants (Line 6-9-7-3-1, Line 14-7-12-4-9 and Line 11-9-18-7-4) were subjected to fatty acid analysis (Table 3). The level of oleic acid of CY2 seeds was about 21.4% under field conditions. The oleic acid contents of the three edited plants were significantly increased in their seeds, ranging from 73.3% to 76.47% (Table 3). The level of erucic acid in the edited plants was greatly decreased compared with that in CY2 (Table 3). Levels of linoleic acid, linolenic acid and eicosenoic acid were decreased to some extent in the edited plants (Table 3).

3.3. Oil Content in Seeds of the Edited Plants

To examine the effects of gene editing of BnFAE1 and BnFAD2 on seeds’ oil content, we measured the seed oil content in the edited plants. The oil content from CY2 seeds was about 50.28% dry weight (Figure 3 ). The oil contents in the seeds of the edited plants were between 43.56 and 47.77%, decreased by 5–13.4% relative to CY2 seeds (Figure 3).

4. Discussion

The CRISPR/Cas9 system is a convenient and highly efficient multiplex genome editing system, which has been utilized in a variety of species including B. napus [19,24,36]. In this study, we designed two sgRNA to target BnFAD2 and BnFAE1 genes in the CY2 cultivar (Figure 1). The results of gene editing showed that induced mutations contained insertions, deletions and substitutions at the target region in BnFAD2 and BnFAE1 genes (Table 1). Moreover, mutations in BnFAD2 and BnFAE1 genes significantly altered fatty acid profiles in the edited lines, resulting in increased oleic acid levels and decreased erucic acid content (Table 3). Taken together, our results show that induced mutations by CRISPR/Cas9 mediated gene editing in BnFAD2 and BnFAE1 genes greatly improve the nutritional quality of the oil from CY2 cultivar.
Concerning the CRISPR/Cas9 technique, editing efficiency is an important evaluation index, which is affected by plant codon optimization of Cas9, the expression levels of Cas9 and sgRNA, the sequence composition (such as GC content) of targets and the secondary structure of the target-sgRNA [19]. In this study, two sgRNAs were designed to target the BnFAD2 and BnFAE1 genes. The editing efficiency at the targets of the BnFAD2 gene and two copies of BnFAE1 gene ranged from 16.7–40% (Table 1). A previous study, examining the mutation efficiency of 12 genes by the CRISPR/Cas9 method, showed that the mutation efficiency at each target site for sgRNA-mediated mutagenesis ranged from 5.3% to 96.6% [37]. Considering the major influence of Cas9 and sgRNA on the editing efficiency [38,39], optimizing plant promoters for Cas9 and effective targets for sgRNA (such as higher GC contents and fewer secondary structures) may significantly increase the frequency of mutagenesis.
A number of studies have been performed to increase oleic acid levels in rapeseed oil using different techniques. RNAi knockdown of BnFAD2 and BnFAE1 resulted in increased oleic acid (80%) and decreased polyunsaturated fatty acids (PUFA; 9%) in B. napus [15]. Knockout of the FAD2-1A and FAD2-1B genes by TALEN technique resulted in increased oleic acid and decreased PUFA in soybean [40]. Recently, CRISPR/Cas9 mediated gene editing of BnFAD2 alleles also altered the fatty acid profile in B. napus, resulting in increased oleic acid [27,28]. Although novel mutants with higher oleic acid content have been created by different techniques, a few unfavorable agronomic traits were found in them. When the FAD2 gene in Arabidopsis was knocked out, the plants could not grow well at low temperature (6–12 °C) [41]. Double mutants of fad2fae1 in Arabidopsis showed a stunted bushy phenotype and reduced seed production [42]. In Camelina sativa, a triple mutant of the FAD2 gene showed a stunted bushy phenotype and very low seed yield [43], suggesting that complete inactivation of the FAD2 genes might affect plant development. In B. napus, mutants with more than 80% oleate in the seed oil had significantly lower seedling establishment and vigor, delayed flowering and reduced plant height at maturity under field conditions [13]. Furthermore, these mutants showed 7–11% reductions in seed oil content. In this present study, we generated mutants with increased oleic acid (70–80%) and decreased PUFA (13–16%) by editing one copy of BnFAD2 gene and two copies of BnFAE1 gene, which displayed normal phenotype in the field. All these studies indicate that genetic improvement to further increase oleic acid content should maintain suitable PUFA content in fatty acid profiles, and more research should be done to examine the minimal content of the PUFA required for plant growth and development in most plant species.
High oil content and high oleic acid levels are both significant agronomic traits, being the important goals of rapeseed breeding. In the present study, levels of oleic acid were greatly increased due to CRISPR/Cas9 mediated editing of BnFAD2 and BnFAE1 genes; however, the oil content was decreased to some degree in the edited plants (Figure 3). The phenomenon that gradually increased oleic acid content is associated with the decrease of the oil content to some degree in one specific genetic material have been reported in previous studies [13,16]. To develop the “double high” (the high oil and high oleic acid) rapeseed cultivar, novel genetic factors should be identified and integrated into conventional cultivars by crossing or genetic manipulation.

5. Conclusions

In summary, our results demonstrated that induced mutations by CRISPR/Cas9 mediated editing of BnFAD2 and BnFAE1 genes could generate novel high oleic acid germplasm from CY2 cultivar (high oil and high erucic acid), and that the CRISPR/Cas9 system is an effective tool for basic research and crop genetic improvement in B. napus.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes13101681/s1, Table S1. List of primers used in this study.

Author Contributions

Conceptualization, J.S.; methodology, X.N. and J.H.; formal analysis, J.S. and Y.F.; investigation, T.W.; writing—original draft preparation, J.S.; writing— review and editing, J.S. and Y.Z.; project administration, H.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (grant no. 31972875) and Key Laboratory of Digital Upland Crops of Zhejiang Province (grant no. 2022E10012).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.

Acknowledgments

We thank Yaoguang Liu (South China Agricultural University) for his gift of vectors of CRISPR/Cas9. We are grateful to Rebecca Horn at scientificproofreading.co.uk (accessed on 18 September 2022) for her assistance in editing this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dupont, J.; White, P.J.; Johnston, K.M.; Heggtveit, H.A.; McDonald, B.E.; Grundy, S.M.; Bonanome, A. Food safety and health effects of canola oil. J. Am. Coll. Nutr. 1989, 8, 360–375. [Google Scholar] [CrossRef] [PubMed]
  2. Ohlrogge, J.B. Design of New Plant Products: Engineering of Fatty Acid Metabolism. Plant Physiol. 1994, 104, 821–826. [Google Scholar] [CrossRef] [PubMed]
  3. Thelen, J.J.; Ohlrogge, J.B. Metabolic engineering of fatty acid biosynthesis in plants. Metab. Eng. 2002, 4, 12–21. [Google Scholar] [CrossRef] [PubMed]
  4. Nesi, N.; Delourme, R.; Bregeon, M.; Falentin, C.; Renard, M. Genetic and molecular approaches to improve nutritional value of Brassica napus L. seed. Comptes Rendus Biol. 2008, 331, 763–771. [Google Scholar] [CrossRef]
  5. Knutzon, D.S.; Thompson, G.A.; Radke, S.E.; Johnson, W.B.; Knauf, V.C.; Kridl, J.C. Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proc. Natl. Acad. Sci. USA 1992, 89, 2624–2628. [Google Scholar] [CrossRef]
  6. Topfer, R.; Martini, N.; Schell, J. Modification of plant lipid synthesis. Science 1995, 268, 681–686. [Google Scholar] [CrossRef]
  7. Hardin-Fanning, F. The effects of a Mediterranean-style dietary pattern on cardiovascular disease risk. Nurs. Clin. N. Am. 2008, 43, 105–115. [Google Scholar] [CrossRef]
  8. O’Byrne, D.J.; Knauft, D.A.; Shireman, R.B. Low fat-monounsaturated rich diets containing high-oleic peanuts improve serum lipoprotein profiles. Lipids 1997, 32, 687–695. [Google Scholar] [CrossRef]
  9. Chang, N.W.; Huang, P.C. Effects of the ratio of polyunsaturated and monounsaturated fatty acid to saturated fatty acid on rat plasma and liver lipid concentrations. Lipids 1998, 33, 481–487. [Google Scholar] [CrossRef]
  10. Yang, Q.; Fan, C.; Guo, Z.; Qin, J.; Wu, J.; Li, Q.; Fu, T.; Zhou, Y. Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic and low linolenic acid contents. Theor. Appl. Genet. 2012, 125, 715–729. [Google Scholar] [CrossRef]
  11. Hu, X.; Sullivan-Gilbert, M.; Gupta, M.; Thompson, S.A. Mapping of the loci controlling oleic and linolenic acid contents and development of fad2 and fad3 allele-specific markers in canola (Brassica napus L.). Theor. Appl. Genet. 2006, 113, 497–507. [Google Scholar] [CrossRef]
  12. Fu, Y.; Mason, A.S.; Zhang, Y.; Yu, H. Identification and Development of KASP Markers for Novel Mutant BnFAD2 Alleles Associated With Elevated Oleic Acid in Brassica napus. Front. Plant Sci. 2021, 12, 715633. [Google Scholar] [CrossRef]
  13. Bai, S.; Engelen, S.; Denolf, P.; Wallis, J.G.; Lynch, K.; Bengtsson, J.D.; Van Thournout, M.; Haesendonckx, B.; Browse, J. Identification, characterization and field testing of Brassica napus mutants producing high-oleic oils. Plant J. 2019, 98, 33–41. [Google Scholar] [CrossRef]
  14. Wells, R.; Trick, M.; Soumpourou, E.; Clissold, L.; Morgan, C.; Werner, P.; Gibbard, C.; Clarke, M.; Jennaway, R.; Bancroft, I. The control of seed oil polyunsaturate content in the polyploid crop species Brassica napus. Mol. Breed. 2014, 33, 349–362. [Google Scholar] [CrossRef]
  15. Peng, Q.; Hu, Y.; Wei, R.; Zhang, Y.; Guan, C.; Ruan, Y.; Liu, C. Simultaneous silencing of FAD2 and FAE1 genes affects both oleic acid and erucic acid contents in Brassica napus seeds. Plant Cell Rep. 2010, 29, 317–325. [Google Scholar] [CrossRef]
  16. Shi, J.; Lang, C.; Wang, F.; Wu, X.; Liu, R.; Zheng, T.; Zhang, D.; Chen, J.; Wu, G. Depressed expression of FAE1 and FAD2 genes modifies fatty acid profiles and storage compounds accumulation in Brassica napus seeds. Plant Sci. 2017, 263, 177–182. [Google Scholar] [CrossRef]
  17. Shi, J.; Lang, C.; Wu, X.; Liu, R.; Zheng, T.; Zhang, D.; Chen, J.; Wu, G. RNAi knockdown of fatty acid elongase1 alters fatty acid composition in Brassica napus. Biochem. Biophys. Res. Commun. 2015, 466, 518–522. [Google Scholar] [CrossRef]
  18. James, D.W.; Lim, E., Jr.; Keller, J.; Plooy, I.; Ralston, E.; Dooner, H.K. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator. Plant Cell 1995, 7, 309–319. [Google Scholar]
  19. Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef]
  20. Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef]
  21. Nayak, T.; Szewczyk, E.; Oakley, C.E.; Osmani, A.; Ukil, L.; Murray, S.L.; Hynes, M.J.; Osmani, S.A.; Oakley, B.R. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 2006, 172, 1557–1566. [Google Scholar] [CrossRef] [Green Version]
  22. Scheben, A.; Wolter, F.; Batley, J.; Puchta, H.; Edwards, D. Towards CRISPR/Cas crops–bringing together genomics and genome editing. New Phytol. 2017, 216, 682–698. [Google Scholar] [CrossRef]
  23. Bortesi, L.; Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol. Adv. 2015, 33, 41–52. [Google Scholar] [CrossRef]
  24. Belhaj, K.; Chaparro-Garcia, A.; Kamoun, S.; Patron, N.J.; Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Curr. Opin. Biotechnol. 2015, 32, 76–84. [Google Scholar] [CrossRef]
  25. Wu, J.; Chen, C.; Xian, G.; Liu, D.; Lin, L.; Yin, S.; Sun, Q.; Fang, Y.; Zhang, H.; Wang, Y. Engineering herbicide-resistant oilseed rape by CRISPR/Cas9-mediated cytosine base-editing. Plant Biotechnol. J. 2020, 18, 1857–1859. [Google Scholar] [CrossRef]
  26. Yang, Y.; Zhu, K.; Li, H.; Han, S.; Meng, Q.; Khan, S.U.; Fan, C.; Xie, K.; Zhou, Y. Precise editing of CLAVATA genes in Brassica napus L. regulates multilocular silique development. Plant Biotechnol. J. 2018, 16, 1322–1335. [Google Scholar] [CrossRef]
  27. Okuzaki, A.; Ogawa, T.; Koizuka, C.; Kaneko, K.; Inaba, M.; Imamura, J.; Koizuka, N. CRISPR/Cas9-mediated genome editing of the fatty acid desaturase 2 gene in Brassica napus. Plant Physiol. Biochem. 2018, 131, 63–69. [Google Scholar] [CrossRef]
  28. Huang, H.; Cui, T.; Zhang, L.; Yang, Q.; Yang, Y.; Xie, K.; Fan, C.; Zhou, Y. Modifications of fatty acid profile through targeted mutation at BnaFAD2 gene with CRISPR/Cas9-mediated gene editing in Brassica napus. Theor. Appl. Genet. 2020, 133, 2401–2411. [Google Scholar] [CrossRef] [PubMed]
  29. Xie, X.; Ma, X.; Zhu, Q.; Zeng, D.; Li, G.; Liu, Y.G. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 2017, 10, 1246–1249. [Google Scholar] [CrossRef] [PubMed]
  30. De Block, M.; De Brouwer, D.; Tenning, P. Transformation of Brassica napus and Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants. Plant Physiol. 1989, 91, 694–701. [Google Scholar] [CrossRef] [PubMed]
  31. Bhalla, P.L.; Singh, M.B. Agrobacterium-mediated transformation of Brassica napus and Brassica oleracea. Nat. Protoc. 2008, 3, 181–189. [Google Scholar] [CrossRef]
  32. Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef]
  33. Tan, H.; Yang, X.; Zhang, F.; Zheng, X.; Qu, C.; Mu, J.; Fu, F.; Li, J.; Guan, R.; Zhang, H.; et al. Enhanced seed oil production in canola by conditional expression of Brassica napus LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds. Plant Physiol. 2011, 156, 1577–1588. [Google Scholar] [CrossRef]
  34. Liu, W.; Xie, X.; Ma, X.; Li, J.; Chen, J.; Liu, Y.G. DSDecode: A Web-Based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations. Mol. Plant 2015, 8, 1431–1433. [Google Scholar] [CrossRef]
  35. Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L.L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef]
  36. Braatz, J.; Harloff, H.J.; Mascher, M.; Stein, N.; Himmelbach, A.; Jung, C. CRISPR-Cas9 Targeted Mutagenesis Leads to Simultaneous Modification of Different Homoeologous Gene Copies in Polyploid Oilseed Rape (Brassica napus). Plant Physiol. 2017, 174, 935–942. [Google Scholar] [CrossRef]
  37. Yang, H.; Wu, J.J.; Tang, T.; Liu, K.D.; Dai, C. CRISPR/Cas9-mediated genome editing efficiently creates specific mutations at multiple loci using one sgRNA in Brassica napus. Sci. Rep. 2017, 7, 7489. [Google Scholar] [CrossRef]
  38. Bortesi, L.; Zhu, C.; Zischewski, J.; Perez, L.; Bassie, L.; Nadi, R.; Forni, G.; Lade, S.B.; Soto, E.; Jin, X.; et al. Patterns of CRISPR/Cas9 activity in plants, animals and microbes. Plant Biotechnol. J. 2016, 14, 2203–2216. [Google Scholar] [CrossRef]
  39. Doench, J.G.; Hartenian, E.; Graham, D.B.; Tothova, Z.; Hegde, M.; Smith, I.; Sullender, M.; Ebert, B.L.; Xavier, R.J.; Root, D.E. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat. Biotechnol. 2014, 32, 1262–1267. [Google Scholar] [CrossRef]
  40. Haun, W.; Coffman, A.; Clasen, B.M.; Demorest, Z.L.; Lowy, A.; Ray, E.; Retterath, A.; Stoddard, T.; Juillerat, A.; Cedrone, F.; et al. Improved soybean oil quality by targeted mutagenesis of the fatty acid desaturase 2 gene family. Plant Biotechnol. J. 2014, 12, 934–940. [Google Scholar] [CrossRef]
  41. Miquel, M.; James, D., Jr.; Dooner, H.; Browse, J. Arabidopsis requires polyunsaturated lipids for low-temperature survival. Proc. Natl. Acad. Sci. USA 1993, 90, 6208–6212. [Google Scholar] [CrossRef] [Green Version]
  42. James, D.W.; Dooner, H.K., Jr. Novel seed lipid phenotypes in combinations of mutants altered in fatty acid biosynthesis inArabidopsis. Theor. Appl. Genet. 1991, 82, 409–412. [Google Scholar] [CrossRef]
  43. Lee, K.R.; Jeon, I.; Yu, H.; Kim, S.G.; Kim, H.S.; Ahn, S.J.; Lee, J.; Lee, S.K.; Kim, H.U. Increasing Monounsaturated Fatty Acid Contents in Hexaploid Camelina sativa Seed Oil by FAD2 Gene Knockout Using CRISPR-Cas9. Front. Plant Sci. 2021, 12, 702930. [Google Scholar] [CrossRef]
Genes 13 01681 g001 550
Figure 1. Target sequences of BnFAD2 and BnFAE1 genes and vector construction. (a) Sequences of the target sites in BnFAD2 and BnFAE1 genes are shown. PAM sequences (NGG) are indicated in bold font. (b) Schematic of the genome editing vector. The vector contains a hygromycin phosphotransferase (HPT) gene as a selection marker and the 35S promoter (p35S) to drive CAS9.
Figure 1. Target sequences of BnFAD2 and BnFAE1 genes and vector construction. (a) Sequences of the target sites in BnFAD2 and BnFAE1 genes are shown. PAM sequences (NGG) are indicated in bold font. (b) Schematic of the genome editing vector. The vector contains a hygromycin phosphotransferase (HPT) gene as a selection marker and the 35S promoter (p35S) to drive CAS9.
Genes 13 01681 g001
Genes 13 01681 g002 550
Figure 2. Mutations in the target region of BnFAD2 and BnFAE1 in homozygous mutants. Substitutions, insertions and deletions are indicated in red fonts, “+” and “−”, respectively. S1 indicates a nucleotide substitution. PAM was highlighted in bold fonts.
Figure 2. Mutations in the target region of BnFAD2 and BnFAE1 in homozygous mutants. Substitutions, insertions and deletions are indicated in red fonts, “+” and “−”, respectively. S1 indicates a nucleotide substitution. PAM was highlighted in bold fonts.
Genes 13 01681 g002
Genes 13 01681 g003 550
Figure 3. Oil content in seeds of the T4 generation edited lines. Mature seeds were used for analysis of the oil content by the Soxhlet method. Values are means ± SE (n = 3). Asterisks indicate statistically significant differences compared with the control (Student’s t test: ** p < 0.01).
Figure 3. Oil content in seeds of the T4 generation edited lines. Mature seeds were used for analysis of the oil content by the Soxhlet method. Values are means ± SE (n = 3). Asterisks indicate statistically significant differences compared with the control (Student’s t test: ** p < 0.01).
Genes 13 01681 g003
Table
Table 1. Genotype of BnFAD2 and BnFAE1 genes in T0 edited plants.
Table 1. Genotype of BnFAD2 and BnFAE1 genes in T0 edited plants.
Line IDBnFAD2BnFAE1
BnaC05g40970DBnaA08g11130DBnaC03g65980D
Line 1+1 bpWTWT
Line 5WT−1 bpWT
Line 6−3 bp, S1−1 bp−1 bp
Line 7+1 bpWTWT
Line 8−2 bpWTWT
Line 11−1 bp−1 bp−1 bp
Line 12S1WTWT
Line 14S1, +1bp−5 bp−5 bp
Line 15−2 bpWTWT
Line 17WTWT−1 bp
Line 19−1 bpWTWT
Line 22WT−2 bpWT
Line 24WTWT−1 bp
Line 25−1bpWTWT
Line 27−1 bp+1 bpWT
Line 29+1 bpWTWT
“+’ and “−” represent the insertion and deletion of the stated number of nucleotides, respectively. S1 indicates a nucleotide substitution.
Table
Table 2. Detection of putative off-target potential at each sgRNA target in T0 edited plants.
Table 2. Detection of putative off-target potential at each sgRNA target in T0 edited plants.
Gene (Locus)SequencePutative Off-Target LocationNo. of Plants SequencedOff-Target Editing
on-target
FAD2 (BnaC05g40970D)TGTCACTCAATCGTCTCCCA CGG
off-target
1TGTCACTCAATCGTCTCACA CGGBnaA05g26900D16no
2TGTCGCTTCCTCGTCTCCCA CGGBnaC09g54430D16no
3TGTCACCCAATGGTCTCCCT CGCBnaC04g05410D16no
4TTTAACTCAATCTCCTCCCA CGABnaA05g28940D16no
on-target
FAE1
(BnaA08g11130D)		GTAAAGGAGCTTTACGTTAA CGG
off-target
1TTCAACGAGCTTGACGTTAA CGGBnaA07g33300D16no
on-target
FAE1
(BnaC03g65980D)		GTAAAGGAGCTTTACGTTAA TGG
off-target
1GTGAAGGATCTTTACGTAAC TGGBnaCnng35470D16no
2GTAAAGGAAGTTGAAGTTAA TGGBnaA04g10800D16no
The red base in the off-target sequence represents mismatch to on-target, and PAM sequences are indicated in bold font. The green base in the off-target sequence represents match to PAM.
Table
Table 3. Relative FA content in seeds of the edited lines.
Table 3. Relative FA content in seeds of the edited lines.
LinesGenerationRelative FA Content (%)
C16:0C18:0C18:1C18:2C18:3C20:1C22:1
CY2T43.09 ± 0.131.07 ± 0.1221.4 ± 0.4812.26 ± 0.447.13 ± 0.3711.53 ± 0.5842.58 ± 0.53
Line 6-9-7-3-1T43.67 ± 0.06 *ND73.3 ± 0.34 **9.43 ± 0.23 **6.8 ± 0.35 *3.13 ± 0.2 **2.35 ± 0.18 **
Line 11-9-18-7-4T43.5 ± 0.06 *ND75.43 ± 0.39 **8.37 ± 0.2 **6.67 ± 0.24 *3.07 ± 0.07 **2.1 ± 0.17 **
Line 14-7-12-4-9T43.37 ± 0.09ND76.47 ± 0.35 **7.43 ± 0.32 **6.23 ± 0.15 *3.07 ± 0.18 **2.04 ± 0.1 **
Relative FA contents were calculated as the percentage that each fatty acid represented of the total fatty acid profile. Mature seeds were used for the analysis. Values are means ± SE (n = 3). Asterisks indicate statistically significant differences compared with the control (Student’s t test: * p < 0.05; ** p < 0.01). ND, Not detectable.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Shi, J.; Ni, X.; Huang, J.; Fu, Y.; Wang, T.; Yu, H.; Zhang, Y. CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes 2022, 13, 1681. https://doi.org/10.3390/genes13101681

AMA Style

Shi J, Ni X, Huang J, Fu Y, Wang T, Yu H, Zhang Y. CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes. 2022; 13(10):1681. https://doi.org/10.3390/genes13101681

Chicago/Turabian Style

Shi, Jianghua, Xiyuan Ni, Jixiang Huang, Ying Fu, Tanliu Wang, Huasheng Yu, and Yaofeng Zhang. 2022. "CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus" Genes 13, no. 10: 1681. https://doi.org/10.3390/genes13101681

APA Style

Shi, J., Ni, X., Huang, J., Fu, Y., Wang, T., Yu, H., & Zhang, Y. (2022). CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes, 13(10), 1681. https://doi.org/10.3390/genes13101681

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop