CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. Plasmid Construction
2.3. Genetic Transformation of B. napus
2.4. Mutation Analysis
2.5. Analysis of Lipids
3. Results
3.1. CRISPR/Cas9-Mediated Editing of BnFAD2 and BnFAE1
3.2. Mutations at BnFAD2 and BnFAE1 Altered Fatty Acid Profiles in the Edited Plants
3.3. Oil Content in Seeds of the Edited Plants
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dupont, J.; White, P.J.; Johnston, K.M.; Heggtveit, H.A.; McDonald, B.E.; Grundy, S.M.; Bonanome, A. Food safety and health effects of canola oil. J. Am. Coll. Nutr. 1989, 8, 360–375. [Google Scholar] [CrossRef] [PubMed]
- Ohlrogge, J.B. Design of New Plant Products: Engineering of Fatty Acid Metabolism. Plant Physiol. 1994, 104, 821–826. [Google Scholar] [CrossRef] [PubMed]
- Thelen, J.J.; Ohlrogge, J.B. Metabolic engineering of fatty acid biosynthesis in plants. Metab. Eng. 2002, 4, 12–21. [Google Scholar] [CrossRef] [PubMed]
- Nesi, N.; Delourme, R.; Bregeon, M.; Falentin, C.; Renard, M. Genetic and molecular approaches to improve nutritional value of Brassica napus L. seed. Comptes Rendus Biol. 2008, 331, 763–771. [Google Scholar] [CrossRef]
- Knutzon, D.S.; Thompson, G.A.; Radke, S.E.; Johnson, W.B.; Knauf, V.C.; Kridl, J.C. Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proc. Natl. Acad. Sci. USA 1992, 89, 2624–2628. [Google Scholar] [CrossRef]
- Topfer, R.; Martini, N.; Schell, J. Modification of plant lipid synthesis. Science 1995, 268, 681–686. [Google Scholar] [CrossRef]
- Hardin-Fanning, F. The effects of a Mediterranean-style dietary pattern on cardiovascular disease risk. Nurs. Clin. N. Am. 2008, 43, 105–115. [Google Scholar] [CrossRef]
- O’Byrne, D.J.; Knauft, D.A.; Shireman, R.B. Low fat-monounsaturated rich diets containing high-oleic peanuts improve serum lipoprotein profiles. Lipids 1997, 32, 687–695. [Google Scholar] [CrossRef]
- Chang, N.W.; Huang, P.C. Effects of the ratio of polyunsaturated and monounsaturated fatty acid to saturated fatty acid on rat plasma and liver lipid concentrations. Lipids 1998, 33, 481–487. [Google Scholar] [CrossRef]
- Yang, Q.; Fan, C.; Guo, Z.; Qin, J.; Wu, J.; Li, Q.; Fu, T.; Zhou, Y. Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic and low linolenic acid contents. Theor. Appl. Genet. 2012, 125, 715–729. [Google Scholar] [CrossRef]
- Hu, X.; Sullivan-Gilbert, M.; Gupta, M.; Thompson, S.A. Mapping of the loci controlling oleic and linolenic acid contents and development of fad2 and fad3 allele-specific markers in canola (Brassica napus L.). Theor. Appl. Genet. 2006, 113, 497–507. [Google Scholar] [CrossRef]
- Fu, Y.; Mason, A.S.; Zhang, Y.; Yu, H. Identification and Development of KASP Markers for Novel Mutant BnFAD2 Alleles Associated With Elevated Oleic Acid in Brassica napus. Front. Plant Sci. 2021, 12, 715633. [Google Scholar] [CrossRef]
- Bai, S.; Engelen, S.; Denolf, P.; Wallis, J.G.; Lynch, K.; Bengtsson, J.D.; Van Thournout, M.; Haesendonckx, B.; Browse, J. Identification, characterization and field testing of Brassica napus mutants producing high-oleic oils. Plant J. 2019, 98, 33–41. [Google Scholar] [CrossRef]
- Wells, R.; Trick, M.; Soumpourou, E.; Clissold, L.; Morgan, C.; Werner, P.; Gibbard, C.; Clarke, M.; Jennaway, R.; Bancroft, I. The control of seed oil polyunsaturate content in the polyploid crop species Brassica napus. Mol. Breed. 2014, 33, 349–362. [Google Scholar] [CrossRef]
- Peng, Q.; Hu, Y.; Wei, R.; Zhang, Y.; Guan, C.; Ruan, Y.; Liu, C. Simultaneous silencing of FAD2 and FAE1 genes affects both oleic acid and erucic acid contents in Brassica napus seeds. Plant Cell Rep. 2010, 29, 317–325. [Google Scholar] [CrossRef]
- Shi, J.; Lang, C.; Wang, F.; Wu, X.; Liu, R.; Zheng, T.; Zhang, D.; Chen, J.; Wu, G. Depressed expression of FAE1 and FAD2 genes modifies fatty acid profiles and storage compounds accumulation in Brassica napus seeds. Plant Sci. 2017, 263, 177–182. [Google Scholar] [CrossRef]
- Shi, J.; Lang, C.; Wu, X.; Liu, R.; Zheng, T.; Zhang, D.; Chen, J.; Wu, G. RNAi knockdown of fatty acid elongase1 alters fatty acid composition in Brassica napus. Biochem. Biophys. Res. Commun. 2015, 466, 518–522. [Google Scholar] [CrossRef]
- James, D.W.; Lim, E., Jr.; Keller, J.; Plooy, I.; Ralston, E.; Dooner, H.K. Directed tagging of the Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene with the maize transposon activator. Plant Cell 1995, 7, 309–319. [Google Scholar]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef]
- Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef]
- Nayak, T.; Szewczyk, E.; Oakley, C.E.; Osmani, A.; Ukil, L.; Murray, S.L.; Hynes, M.J.; Osmani, S.A.; Oakley, B.R. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics 2006, 172, 1557–1566. [Google Scholar] [CrossRef]
- Scheben, A.; Wolter, F.; Batley, J.; Puchta, H.; Edwards, D. Towards CRISPR/Cas crops–bringing together genomics and genome editing. New Phytol. 2017, 216, 682–698. [Google Scholar] [CrossRef]
- Bortesi, L.; Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol. Adv. 2015, 33, 41–52. [Google Scholar] [CrossRef]
- Belhaj, K.; Chaparro-Garcia, A.; Kamoun, S.; Patron, N.J.; Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Curr. Opin. Biotechnol. 2015, 32, 76–84. [Google Scholar] [CrossRef]
- Wu, J.; Chen, C.; Xian, G.; Liu, D.; Lin, L.; Yin, S.; Sun, Q.; Fang, Y.; Zhang, H.; Wang, Y. Engineering herbicide-resistant oilseed rape by CRISPR/Cas9-mediated cytosine base-editing. Plant Biotechnol. J. 2020, 18, 1857–1859. [Google Scholar] [CrossRef]
- Yang, Y.; Zhu, K.; Li, H.; Han, S.; Meng, Q.; Khan, S.U.; Fan, C.; Xie, K.; Zhou, Y. Precise editing of CLAVATA genes in Brassica napus L. regulates multilocular silique development. Plant Biotechnol. J. 2018, 16, 1322–1335. [Google Scholar] [CrossRef]
- Okuzaki, A.; Ogawa, T.; Koizuka, C.; Kaneko, K.; Inaba, M.; Imamura, J.; Koizuka, N. CRISPR/Cas9-mediated genome editing of the fatty acid desaturase 2 gene in Brassica napus. Plant Physiol. Biochem. 2018, 131, 63–69. [Google Scholar] [CrossRef]
- Huang, H.; Cui, T.; Zhang, L.; Yang, Q.; Yang, Y.; Xie, K.; Fan, C.; Zhou, Y. Modifications of fatty acid profile through targeted mutation at BnaFAD2 gene with CRISPR/Cas9-mediated gene editing in Brassica napus. Theor. Appl. Genet. 2020, 133, 2401–2411. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Ma, X.; Zhu, Q.; Zeng, D.; Li, G.; Liu, Y.G. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 2017, 10, 1246–1249. [Google Scholar] [CrossRef] [PubMed]
- De Block, M.; De Brouwer, D.; Tenning, P. Transformation of Brassica napus and Brassica oleracea Using Agrobacterium tumefaciens and the Expression of the bar and neo Genes in the Transgenic Plants. Plant Physiol. 1989, 91, 694–701. [Google Scholar] [CrossRef] [PubMed]
- Bhalla, P.L.; Singh, M.B. Agrobacterium-mediated transformation of Brassica napus and Brassica oleracea. Nat. Protoc. 2008, 3, 181–189. [Google Scholar] [CrossRef]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef]
- Tan, H.; Yang, X.; Zhang, F.; Zheng, X.; Qu, C.; Mu, J.; Fu, F.; Li, J.; Guan, R.; Zhang, H.; et al. Enhanced seed oil production in canola by conditional expression of Brassica napus LEAFY COTYLEDON1 and LEC1-LIKE in developing seeds. Plant Physiol. 2011, 156, 1577–1588. [Google Scholar] [CrossRef]
- Liu, W.; Xie, X.; Ma, X.; Li, J.; Chen, J.; Liu, Y.G. DSDecode: A Web-Based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations. Mol. Plant 2015, 8, 1431–1433. [Google Scholar] [CrossRef]
- Liu, H.; Ding, Y.; Zhou, Y.; Jin, W.; Xie, K.; Chen, L.L. CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants. Mol. Plant 2017, 10, 530–532. [Google Scholar] [CrossRef]
- Braatz, J.; Harloff, H.J.; Mascher, M.; Stein, N.; Himmelbach, A.; Jung, C. CRISPR-Cas9 Targeted Mutagenesis Leads to Simultaneous Modification of Different Homoeologous Gene Copies in Polyploid Oilseed Rape (Brassica napus). Plant Physiol. 2017, 174, 935–942. [Google Scholar] [CrossRef]
- Yang, H.; Wu, J.J.; Tang, T.; Liu, K.D.; Dai, C. CRISPR/Cas9-mediated genome editing efficiently creates specific mutations at multiple loci using one sgRNA in Brassica napus. Sci. Rep. 2017, 7, 7489. [Google Scholar] [CrossRef]
- Bortesi, L.; Zhu, C.; Zischewski, J.; Perez, L.; Bassie, L.; Nadi, R.; Forni, G.; Lade, S.B.; Soto, E.; Jin, X.; et al. Patterns of CRISPR/Cas9 activity in plants, animals and microbes. Plant Biotechnol. J. 2016, 14, 2203–2216. [Google Scholar] [CrossRef]
- Doench, J.G.; Hartenian, E.; Graham, D.B.; Tothova, Z.; Hegde, M.; Smith, I.; Sullender, M.; Ebert, B.L.; Xavier, R.J.; Root, D.E. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat. Biotechnol. 2014, 32, 1262–1267. [Google Scholar] [CrossRef]
- Haun, W.; Coffman, A.; Clasen, B.M.; Demorest, Z.L.; Lowy, A.; Ray, E.; Retterath, A.; Stoddard, T.; Juillerat, A.; Cedrone, F.; et al. Improved soybean oil quality by targeted mutagenesis of the fatty acid desaturase 2 gene family. Plant Biotechnol. J. 2014, 12, 934–940. [Google Scholar] [CrossRef]
- Miquel, M.; James, D., Jr.; Dooner, H.; Browse, J. Arabidopsis requires polyunsaturated lipids for low-temperature survival. Proc. Natl. Acad. Sci. USA 1993, 90, 6208–6212. [Google Scholar] [CrossRef]
- James, D.W.; Dooner, H.K., Jr. Novel seed lipid phenotypes in combinations of mutants altered in fatty acid biosynthesis inArabidopsis. Theor. Appl. Genet. 1991, 82, 409–412. [Google Scholar] [CrossRef]
- Lee, K.R.; Jeon, I.; Yu, H.; Kim, S.G.; Kim, H.S.; Ahn, S.J.; Lee, J.; Lee, S.K.; Kim, H.U. Increasing Monounsaturated Fatty Acid Contents in Hexaploid Camelina sativa Seed Oil by FAD2 Gene Knockout Using CRISPR-Cas9. Front. Plant Sci. 2021, 12, 702930. [Google Scholar] [CrossRef]



| Line ID | BnFAD2 | BnFAE1 | |
|---|---|---|---|
| BnaC05g40970D | BnaA08g11130D | BnaC03g65980D | |
| Line 1 | +1 bp | WT | WT |
| Line 5 | WT | −1 bp | WT |
| Line 6 | −3 bp, S1 | −1 bp | −1 bp |
| Line 7 | +1 bp | WT | WT |
| Line 8 | −2 bp | WT | WT |
| Line 11 | −1 bp | −1 bp | −1 bp |
| Line 12 | S1 | WT | WT |
| Line 14 | S1, +1bp | −5 bp | −5 bp |
| Line 15 | −2 bp | WT | WT |
| Line 17 | WT | WT | −1 bp |
| Line 19 | −1 bp | WT | WT |
| Line 22 | WT | −2 bp | WT |
| Line 24 | WT | WT | −1 bp |
| Line 25 | −1bp | WT | WT |
| Line 27 | −1 bp | +1 bp | WT |
| Line 29 | +1 bp | WT | WT |
| Gene (Locus) | Sequence | Putative Off-Target Location | No. of Plants Sequenced | Off-Target Editing |
|---|---|---|---|---|
| on-target | ||||
| FAD2 (BnaC05g40970D) | TGTCACTCAATCGTCTCCCA CGG | |||
| off-target | ||||
| 1 | TGTCACTCAATCGTCTCACA CGG | BnaA05g26900D | 16 | no |
| 2 | TGTCGCTTCCTCGTCTCCCA CGG | BnaC09g54430D | 16 | no |
| 3 | TGTCACCCAATGGTCTCCCT CGC | BnaC04g05410D | 16 | no |
| 4 | TTTAACTCAATCTCCTCCCA CGA | BnaA05g28940D | 16 | no |
| on-target | ||||
| FAE1 (BnaA08g11130D) | GTAAAGGAGCTTTACGTTAA CGG | |||
| off-target | ||||
| 1 | TTCAACGAGCTTGACGTTAA CGG | BnaA07g33300D | 16 | no |
| on-target | ||||
| FAE1 (BnaC03g65980D) | GTAAAGGAGCTTTACGTTAA TGG | |||
| off-target | ||||
| 1 | GTGAAGGATCTTTACGTAAC TGG | BnaCnng35470D | 16 | no |
| 2 | GTAAAGGAAGTTGAAGTTAA TGG | BnaA04g10800D | 16 | no |
| Lines | Generation | Relative FA Content (%) | ||||||
|---|---|---|---|---|---|---|---|---|
| C16:0 | C18:0 | C18:1 | C18:2 | C18:3 | C20:1 | C22:1 | ||
| CY2 | T4 | 3.09 ± 0.13 | 1.07 ± 0.12 | 21.4 ± 0.48 | 12.26 ± 0.44 | 7.13 ± 0.37 | 11.53 ± 0.58 | 42.58 ± 0.53 |
| Line 6-9-7-3-1 | T4 | 3.67 ± 0.06 * | ND | 73.3 ± 0.34 ** | 9.43 ± 0.23 ** | 6.8 ± 0.35 * | 3.13 ± 0.2 ** | 2.35 ± 0.18 ** |
| Line 11-9-18-7-4 | T4 | 3.5 ± 0.06 * | ND | 75.43 ± 0.39 ** | 8.37 ± 0.2 ** | 6.67 ± 0.24 * | 3.07 ± 0.07 ** | 2.1 ± 0.17 ** |
| Line 14-7-12-4-9 | T4 | 3.37 ± 0.09 | ND | 76.47 ± 0.35 ** | 7.43 ± 0.32 ** | 6.23 ± 0.15 * | 3.07 ± 0.18 ** | 2.04 ± 0.1 ** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, J.; Ni, X.; Huang, J.; Fu, Y.; Wang, T.; Yu, H.; Zhang, Y. CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes 2022, 13, 1681. https://doi.org/10.3390/genes13101681
Shi J, Ni X, Huang J, Fu Y, Wang T, Yu H, Zhang Y. CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes. 2022; 13(10):1681. https://doi.org/10.3390/genes13101681
Chicago/Turabian StyleShi, Jianghua, Xiyuan Ni, Jixiang Huang, Ying Fu, Tanliu Wang, Huasheng Yu, and Yaofeng Zhang. 2022. "CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus" Genes 13, no. 10: 1681. https://doi.org/10.3390/genes13101681
APA StyleShi, J., Ni, X., Huang, J., Fu, Y., Wang, T., Yu, H., & Zhang, Y. (2022). CRISPR/Cas9-Mediated Gene Editing of BnFAD2 and BnFAE1 Modifies Fatty Acid Profiles in Brassica napus. Genes, 13(10), 1681. https://doi.org/10.3390/genes13101681
