Identification and Functional Analysis of ThADH1 and ThADH4 Genes Involved in Tolerance to Waterlogging Stress in Taxodium hybrid ‘Zhongshanshan 406’
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Waterlogging Treatment
2.2. Full-Length cDNA Cloning
2.3. Bioinformatics and Statistical Analyses
2.4. Quantitative Real-Time PCR Analysis
2.5. Vector Construction
2.6. Protoplast Transfection
2.7. Populus Transformation and Waterlogging Treatment
3. Results
3.1. Isolation and Characterization of ADH Genes from T. hybrid ‘Zhongshanshan 406’
3.2. Multiple Alignment and Phylogenetic Analysis of ThADH1 and ThADH4
3.3. Expression Patterns of ThADH1 and ThADH4 Genes
3.4. Subcellular Localization of ThADH1 and ThADH4 Proteins
3.5. Heterologous Overexpression of ThADH 1 and ThADH 4 in Populus and Comparison of Waterlogging Tolerance in Non-Transgenic and Transgenic Populus
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Chang, C.; Meyerowitz, E.M. Molecular cloning and DNA sequence of the Arabidopsis thaliana alcohol dehydrogenase gene. Proc. Natl. Acad. Sci. USA 1986, 83, 1408–1412. [Google Scholar] [CrossRef]
- Dennis, E.S.; Gerlach, W.L.; Pryor, A.J.; Bennetzen, J.L.; Inglis, A.; Llewllyn, D.; Sachs, M.M.; Ferl, R.J.; Peacock, W.J. Molecular analysis of the alcohol dehydrogenase (Adh1) gene of maize. Nucl. Acids Res. 1984, 12, 3983–4000. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Wu, R. Rice alcohol dehydrogenase genes: Anaerobic induction, organ specific expression and characterization of cDNA clones. Plant Mol. Biol. 1989, 13, 53–68. [Google Scholar] [CrossRef] [PubMed]
- Torregrosa, L.; Pradal, M.; Souquet, J.M.; Rambert, M.; Gunata, Z.; Tesniere, C. Manipulation of VvAdh to investigate its function in grape berry development. Plant Sci. 2008, 174, 149–155. [Google Scholar] [CrossRef]
- Xuewen, X.; Huihui, W.; Xiaohua, Q.; Qiang, X.; Xuehao, C. Waterlogging-induced increase in fermentation and related gene expression in the root of cucumber (Cucumis sativus L.). Sci. Hortic. 2014, 179, 388–395. [Google Scholar] [CrossRef]
- Kennedy, R.A.; Fox, R.T. Anaerobic Metabolism in Plants. Plant Physiol. 1992, 100, 1–6. [Google Scholar] [CrossRef]
- Bailey-Serres, J.; Voesenek, L.A.C.J. Flooding stress: Acclimations and genetic diversity. Annu. Rev. Plant Biol. 2008, 59, 313–318. [Google Scholar] [CrossRef]
- Bhupesh, T.; Mande, S.C. Conserved structural features and sequence patterns in the GroES fold family. Protein Eng. 1999, 12, 815–818. [Google Scholar]
- Zhang, J.Y.; Wang, G.; Huang, S.N.; Xuan, J.P.; Guo, Z.R. Functions of Alcohol Dehydrogenase Family in Abiotic Stress Responses in Plants. Chin. Agric. Sci. Bull. 2015, 31, 246–250. [Google Scholar]
- Ellis, M.H.; Setter, T.L. Hypoxia induces anoxia tolerance in completely submerged rice seedlings. J. Plant Physiol. 1999, 154, 219–230. [Google Scholar] [CrossRef]
- Chen, D.Q.; Zhu, Y.F.; Wu, G.Q.; Li, Y.N. Characterization Analysis of Response of Alcohol Dehydrogenase Gene (ADH1) in Coix lacroyma>/em> jobi L. to Waterlogging Stress. Adv. J. Food Sci. Technol. 2012, 4, 417–425. [Google Scholar]
- Dolferus, R.; Marbaix, G.; Jacobs, M. Alcohol dehydrogenase in Arabidopsis: Analysis of the induction phenomenon in plantlets and tissue cultures. Mol. Gen. Genet. MGG 1985, 199, 256–264. [Google Scholar] [CrossRef]
- Matsumura, H.; Takano, T.; Takeda, G.; Uchimiya, H. Adh1 is transcriptionally active but its translational product is reduced in a rad mutant of rice (Oryza sativa L.), which is vulnerable to submergence stress. Theor. Appl. Genet. 1998, 97, 1197–1203. [Google Scholar] [CrossRef]
- Jacobs, M.; Dolferus, R.; Bossche, D. Isolation and biochemical analysis of ethyl methanesulfonate-induced alcohol dehydrogenase null mutants of Arabidopsis thaliana (L.) Heynh. Biochem. Genet. 1988, 26, 105–122. [Google Scholar] [CrossRef]
- Hirokazu, T.; Hank, G.; Hideo, M.; Nobuhiro, T.; Mikio, N. Rice alcohol dehydrogenase 1 promotes survival and has a major impact on carbohydrate metabolism in the embryo and endosperm when seeds are germinated in partially oxygenated water. Ann. Bot. 2014, 113, 851–859. [Google Scholar]
- Jiang, M.; Deng, H.; Cai, Q.; Wu, G. Species richness in a riparian plant community along the banks of the Xiangxi River, the Three Gorges region. Int. J. Sustain. Dev. World Ecol. 2005, 12, 60–67. [Google Scholar] [CrossRef]
- Wang, P.; Zhang, Q.; Xu, Y.S.; Yu, F.H. Effects of water level fluctuation on the growth of submerged macrophyte communities. Flora-Morphol. Distrib. Funct. Ecol. Plants 2016, 223, 83–89. [Google Scholar] [CrossRef]
- Yu, X.; Luo, N.; Yan, J.; Tang, J.; Liu, S.; Jiang, Y. Differential growth response and carbohydrate metabolism of global collection of perennial ryegrass accessions to submergence and recovery following de-submergence. J. Plant Physiol. 2012, 169, 1040–1049. [Google Scholar] [CrossRef]
- Wang, Z.Q.; Yin, Y.L.; Hua, J.F.; Fan, W.C.; Xuan, L. Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’. Genes 2017, 8, 185. [Google Scholar] [CrossRef]
- Yin, Y.L.; Yu, C.G.; Hua, J.F.; Huan, J.J.; Han, L.W.; Qi, B.Y.; Ren, P.; Wu, X.H.; Qi, X.C. A trial on the silviculture of Taxodium hybrid ‘Zhonshanshan118’ planted in the hydro-fluctuation belt of the Three Gorges Reservoir within the Wanzhou district area of Chongqing City. China For. Sci. Technol. 2014, 2, 110–114. [Google Scholar]
- Fan, W.; Yang, Y.; Wang, Z.; Yin, Y.; Yu, C.; Shi, Q.; Guo, J.; Xuan, L.; Hua, J. Molecular cloning and expression analysis of three ThERFs involved in the response to waterlogging stress of Taxodium ‘Zhongshanshan406’ and subcellular localization of the gene products. PeerJ 2018, 6, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Qi, B.; Yang, Y.; Yin, Y.L.; Xu, M.; Li, H.G. De novo sequencing, assembly and analysis of the Taxodium ‘Zhongshansa’ roots and shoots transcriptome in response to short-term waterlogging. BMC Plant Biol. 2014, 14, 201–218. [Google Scholar] [CrossRef] [PubMed]
- Tadege, M.; Dupuis, I.I.; Kuhlemeier, C. Ethanolic fermentation: New functions for an old pathway. Trends Plant Sci. 1999, 4, 320–325. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gu, C.; Xuan, L.; Hua, J.; Shi, Q.; Fan, W.; Yin, Y.; Yu, F. Identification of suitable reference genes in Taxodium ‘Zhongshanshan’ under abiotic stresses. Trees 2017, 31, 1519–1530. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.; Xu, M.; Chen, Y.; Huang, M. Transient expression for functional gene analysis using Populus protoplasts. Plant Cell Tissue Organ Cult. 2013, 114, 11–18. [Google Scholar] [CrossRef]
- Xu, M.; Chen, C.; Cai, H.; Wu, L. Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus. Genes 2018, 9, 457. [Google Scholar] [CrossRef]
- Fukuda, T.; Yokoyama, J.; Nakamura, T.; Song, I.J.; Ito, T.; Ochiai, T.; Kanno, A.; Kameya, T.; Maki, M. Molecular phylogeny and evolution of alcohol dehydrogenase (Adh) genes in legumes. BMC Plant Biol. 2005, 6, 1–10. [Google Scholar]
- Strommer, J. The plant ADH gene family. Plant J. 2011, 66, 128–142. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, S.; Thibaut, D.; Hiraga, S.; Kato, M.; Chiba, M.; Hashiguchi, A.; Tougou, M.; Shimamura, S.; Yasue, H. Characterization of a novel flooding stress-responsive alcohol dehydrogenase expressed in soybean roots. Plant Mol. Biol. 2011, 77, 309–322. [Google Scholar] [CrossRef]
- Li, C.F.; Xu, D.P.; Han, W.B.; Zhang, X.J.; Qi, M.; Tian, C.J.; Zheng, S.F. Genome-wide Identification and Expression Analysis of the ADH Gene Family in Upland Cotton (Gossypium hirsutum L.). Mol. Plant Breed. 2018, 7, 2065–2077. [Google Scholar]
- Papdi, C.; Pérez-Salamó, I.; Joseph, M.P.; Giuntoli, B.; Bögre, L. The low oxygen, oxidative and osmotic stress responses synergistically act through the ethylene response factor VII genes RAP2.12, RAP2.2 and RAP2.3. Plant J. 2015, 82, 772–784. [Google Scholar] [CrossRef] [PubMed]
- Drew, M.C. Oxygen Deficiency and Root Metabolism: Injury and Acclimation under Hypoxia and Anoxia. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, 48, 223–250. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.W.; Yuan, J.P.; Qu, X.Q. Alcohol dehydrogenase (ADH) genes family in wheat (Triticum aestivum): Genome-wide identification, characterization, phylogenetic relationship and expression patterns. Reach Sq. 2020, 8, 1–14. [Google Scholar]
- Andrews, D.L.; Cobb, B.G.; Johnson, J.R. Hypoxic and anoxic induction of alcoholdehydrogenase in roots and shoots of seedlings of Zea mays: Adh transcripts and enzyme activity. Plant Physiol. 1993, 101, 407–414. [Google Scholar] [CrossRef] [PubMed]





| Prime-ID | Forward PCR Primer (5’-3’) | Reverse PCR Primer (5’-3’) |
|---|---|---|
| ThADH1_3OUTER | AAAGAAAGCATTACAGAGGCGTG | AAATCACTAGTGGAACGACGGTA |
| ThADH1_3INNER | CAGTACCAGTACCAAATACCGAGGGTTGA | CCTATAGTGAAATCACTAGTGGAGGATCCGCG |
| ThADH1_5OUTER | CTAATACGACTCACTATAGGGCAAGCAGTGGTAT | TTTTTCCTCCATTTGCTCGTTCTCAA |
| ThADH1_5INNER | CTAATACGACTCACTATAGGGC | TCTGATTTCCGCAGCAAACTTTC |
| ThADH1_ORF | ATGTCAAGCGCTACTGCAGG | ATCATCCAGTTTCATGACACATCT |
| ThADH1_qRT-PCR | AGCGCTACTGCAGGGAAGGT | TTGATCCTGACTTCCATTGC |
| ThADH4_3OUTER | TTCAAGAAGTTATAGCAGAGATGA | AAATCACTAGTGGAACGACGGTA |
| ThADH4_3INNER | GGCCAAAACACAATTGCCTGGAATTGTGGAG | CCTATAGTGAAATCACTAGTGGAGGATCCGCG |
| ThADH4_5OUTER | GAAACGTGCTTTCTTCCCCTCCCAT | GCTTTCTATTGTATTGGGCTTCGTCTT |
| ThADH4_5INNER | GGATCCACCTGAACATCTTCTATTACCAGA | ACCAGACAAAGTTATTGGGAGCAGAGG |
| ThADH4_ORF | ATGGAGATACAGAATGGAATA | GAAGTGAAGAACACATCTCA |
| ThADH4_qRT-PCR | CAAAGTCCCTCTGTCT | AATATGCGAGGAAACGTG |
| Gene_ID | Full-Length cDNA (bp) | 5′-UTR (bp) | 3′-UTR (bp) | ORF (bp) | Predicted Peptide | Secondary Structure Prediction | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| MW (kDa) | pI | GRAVY | Hh (%) | Ee (%) | Tt (%) | Cc (%) | |||||
| ThADH1 | 1518 | 89 | 283 | 1146 | 41.03 | 6.23 | −0.024 | 15.22 | 32.55 | 0.00 | 52.23 |
| ThADH4 | 1506 | 117 | 177 | 1212 | 43.7 | 5.91 | 0.064 | 16.13 | 29.53 | 0.00 | 54.34 |
| Biomass (g) | Height (cm) | ||
|---|---|---|---|
| 0 Day | ThADH1-Transgenic Populus | 0.5449 ± 0.015b | 11.5 ± 0.08b |
| ThADH4-Transgenic Populus | 0.3133 ± 0.009f | 5.275 ± 0.09e | |
| Non-transgenic Populus | 0.4713 ± 0.004c | 7.975 ± 0.17c | |
| Submerged 20 Days | ThADH1-Transgenic Populus | 0.6161 ± 0.011a | 12.025 ± 0.22a |
| ThADH4-Transgenic Populus | 0.3471 ± 0.014e | 6.075 ± 0.09d | |
| Non-transgenic Populus | 0.4131 ± 0.004d | 8.05 ± 0.13c |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xuan, L.; Hua, J.; Zhang, F.; Wang, Z.; Pei, X.; Yang, Y.; Yin, Y.; Creech, D.L. Identification and Functional Analysis of ThADH1 and ThADH4 Genes Involved in Tolerance to Waterlogging Stress in Taxodium hybrid ‘Zhongshanshan 406’. Genes 2021, 12, 225. https://doi.org/10.3390/genes12020225
Xuan L, Hua J, Zhang F, Wang Z, Pei X, Yang Y, Yin Y, Creech DL. Identification and Functional Analysis of ThADH1 and ThADH4 Genes Involved in Tolerance to Waterlogging Stress in Taxodium hybrid ‘Zhongshanshan 406’. Genes. 2021; 12(2):225. https://doi.org/10.3390/genes12020225
Chicago/Turabian StyleXuan, Lei, Jianfeng Hua, Fan Zhang, Zhiquan Wang, Xiaoxiao Pei, Ying Yang, Yunlong Yin, and David L. Creech. 2021. "Identification and Functional Analysis of ThADH1 and ThADH4 Genes Involved in Tolerance to Waterlogging Stress in Taxodium hybrid ‘Zhongshanshan 406’" Genes 12, no. 2: 225. https://doi.org/10.3390/genes12020225
APA StyleXuan, L., Hua, J., Zhang, F., Wang, Z., Pei, X., Yang, Y., Yin, Y., & Creech, D. L. (2021). Identification and Functional Analysis of ThADH1 and ThADH4 Genes Involved in Tolerance to Waterlogging Stress in Taxodium hybrid ‘Zhongshanshan 406’. Genes, 12(2), 225. https://doi.org/10.3390/genes12020225

