Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton
Round 1
Reviewer 1 Report
The manuscript titled, “Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton” is an interesting study of the multi-functional cotton EXO70 gene family, spanning comprehensive bioinformatics and molecular analyses. They identified 165 family members in the EXO70 gene family of cotton, analyzed their expression pattern and found that over 4000 genes were altered by the silencing of GhEXO70A1-A gene, which expresses a plasma membrane-localized protein. Through Yeast-two-hybrid assay, they found that GhEXO70A1-1 interacts with GhEXO84A, GhEXO84B, and GhEXO84C.
The title may be modified as “Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton”.
Some minor points to revise in the manuscript are;
The results must be discussed appropriately in the Discussion section. The Discussion section should be improved.
Please italicize gene names (symbols) throughout the manuscript.
Please cite more recent literature in Introduction and Discussion sections.
A few errors in the language are;
Section 1: Please put a comma after “cells” in the second sentence of Introduction’s first paragraph.
Section 2.4: Please rewrite the last sentence. “T vector was connected to it” seems a bit awkward.
Section 3.1: Please shift the third and fourth sentences to “Discussion” section.
Figure 3 Caption: Rewrite (C).
Figure 4: Remove the word “Tissue” from “Tissue::Root”, “Tissue::Stem…”.
Section 4.1: Paragraph 2 Rewrite second sentence.
Author Response
Dear Reviewers:
Thank you for your comments on our manuscript entitled " Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:
Comments to the Author
The manuscript titled, “Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton” is an interesting study of the multi-functional cotton EXO70 gene family, spanning comprehensive bioinformatics and molecular analyses. They identified 165 family members in the EXO70 gene family of cotton, analyzed their expression pattern and found that over 4000 genes were altered by the silencing of GhEXO70A1-A gene, which expresses a plasma membrane-localized protein. Through Yeast-two-hybrid assay, they found that GhEXO70A1-1 interacts with GhEXO84A, GhEXO84B, and GhEXO84C.
Point 1: The title may be modified as “Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton”.

Response 1: Thank you for your suggestion. We have corrected it in the manuscript (L2-L3).
Point 2: The results must be discussed appropriately in the Discussion section. The Discussion section should be improved.
Response 2: Thank you for your comment. We have improved the Discussion section. We have added “The latest research shows that AtEXO70A1 recruits the entire complex to the cytoplasmic membrane by binding to negatively charged phospholipids, providing an important research basis for the study of plant cell polarity and morphogenesis [50].” in Discussion sections (L422-L424).
Point 3: Please italicize gene names (symbols) throughout the manuscript.
Response 3: We are sorry for this mistake and we have corrected them in the current manuscript.
Point 4: Please cite more recent literature in Introduction and Discussion sections.
Response 4: Thank you for your comment. We have improved the Introduction and Discussion sections. We have added “AtEXO70B1 and AtEXO70B2 regulate FLS2 to participate in plant immune response [25]. AtEXO70D regulates cytokinin sensitivity by mediating the selective autophagy of Type-A ARR protein, thereby maintaining cell homeostasis and normal plant growth and development [26].” in Introduction sections (L64-L67). We have added “The latest research shows that AtEXO70A1 recruits the entire complex to the cytoplasmic membrane by binding to negatively charged phospholipids, providing an important research basis for the study of plant cell polarity and morphogenesis [50].” in Discussion sections (L422-L424).
Point 5: Section 1: Please put a comma after “cells” in the second sentence of Introduction’s first paragraph.
Response 5: Thank you for your comments. We have corrected it in the current manuscript (L32).
Point 6: Section 2.4: Please rewrite the last sentence. “T vector was connected to it” seems a bit awkward.
Response 6: Thank you for your comments. We have replaced “T vector was connected to it” with “It was cloned into the B-zero vector” in the manuscript (L147-L148).
Point 7: Section 3.1: Please shift the third and fourth sentences to “Discussion” section.
Response 7: Thank you for your comments. We have shifted the third and fourth sentences (Section 3.1) to “Discussion” section in the current manuscript (L419-L421).
Point 8: Figure 3 Caption: Rewrite (C).
Response 8: Thank you for your comments. We have replaced “gene structure of exons and introns in GhEXO70 genes.” with “Gene structure of the GhEXO70 family” in the manuscript (L595).
Point 9: Figure 4: Remove the word “Tissue” from “Tissue::Root”, “Tissue::Stem…”.
Response 9: Thank you for your comments. We have corrected it in the figure 4.
Point 10: Section 4.1: Paragraph 2 Rewrite second sentence.
Response 10: Thank you for your comments. We have corrected it in the current manuscript. We have replaced “Genes within the same subgroup structures had similar structures.” with “Genes within the same subgroup had similar structures.” in the manuscript (L407-L408).
Author Response File:
Author Response.docx
Reviewer 2 Report
The manuscript describes cotton Exo70s identified in database and their features including phylogenetic relationships and genome structures. In addition, authors focused on GhEXO70A1-A, and demonstrated its localization on ER and plasma membrane, interactions with other exocyst members and the effects of knockdown on transcriptome. These data suggest the involvement of GhEXO70A1-A in vesicle trafficking as shown in other plant species. Genomic and functional characterization of cotton Exo70s will be fundamental and important information to understand diverse functions of plant Exo70s.
- Authors focused on not only the number of cotton Exo70 genes and their phylogenetic relationships but also their gene structures (for example exon-intron organization and the presence of transmembrane domain). To clarify whether the gene structures are conserved among several plant species or unique in cotton Exo70s, authors should describe them in comparison with Exo70s of other model plants including arabidopsis and rice.
- If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5. The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.
- In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized at ER and plasma membranes, subcellular localization of GhEXO70A1-A must be demonstrated as co-localization with marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.
- In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells should be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.
- In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.
- In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.
- If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5. The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.
- In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized on ER and plasma membranes, subcellular localization of GhEXO70A1-A should be demonstrated as co-localization of marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.
- In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells must be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.
- In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.
- In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.
Author Response
Dear Reviewer:
Thank you for your comments on our manuscript entitled " Identification, Characterization, and Function Study of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:
Comments to the Author
The manuscript describes cotton Exo70s identified in database and their features including phylogenetic relationships and genome structures. In addition, authors focused on GhEXO70A1-A, and demonstrated its localization on ER and plasma membrane, interactions with other exocyst members and the effects of knockdown on transcriptome. These data suggest the involvement of GhEXO70A1-A in vesicle trafficking as shown in other plant species. Genomic and functional characterization of cotton Exo70s will be fundamental and important information to understand diverse functions of plant Exo70s.
Point 1: Authors focused on not only the number of cotton Exo70 genes and their phylogenetic relationships but also their gene structures (for example exon-intron organization and the presence of transmembrane domain). To clarify whether the gene structures are conserved among several plant species or unique in cotton Exo70s, authors should describe them in comparison with Exo70s of other model plants including Arabidopsis and rice.
Response 1: Thank you for your comment. Through the exon analysis of the EXO70 gene of Arabidopsis and rice, the results showed that only the EXO70 of group A contained more exons in Arabidopsis and rice. The number of EXO70 in Arabidopsis A group ≥9, and the number of EXO70 in rice A group ≥12 (Table S2 and Table S3). This phenomenon is not unique to cotton Exo70s, but conserved in plants.
We have added “Further analysis of the exons of the EXO70 gene in Arabidopsis and rice showed that only Group A EXO70 contained more exons in Arabidopsis and rice. The number of EXO70 in Arabidopsis A group ≥9, and the number of EXO70 in rice A group ≥12,Therefore, this phenomenon is not unique to cotton EXO70s, but is conserved in plants (Table S2 and Table S3).” in the manuscript (L223-L227).
We have added “Table S2. Predicted EXO70 genes from Arabidopsis thaliana and the corresponding proteins. Table S3. Predicted EXO70 proteins and the corresponding gene from Oryza sativa.” in the manuscript (L458-L459).
Table S2. Predicted EXO70 genes from Arabidopsis thaliana and the corresponding proteins.
|
Gene Name |
Gene ID |
Gene Models |
Exon Number |
Protein Length (aa) |
|
AtEXO70A1-1 |
AT5G03540 |
AT5G03540.1 |
12 |
638 |
|
AtEXO70A1-2 |
AT5G03540 |
AT5G03540.2 |
11 |
523 |
|
AtEXO70A1-3 |
AT5G03540 |
AT5G03540.3 |
13 |
664 |
|
AtEXO70A2 |
AT5G52340 |
AT5G52340.1 |
11 |
631 |
|
AtEXO70A3 |
AT5G52350 |
AT5G52350.1 |
9 |
586 |
|
AtEXO70B1 |
AT5G58430 |
AT5G58430.1 |
1 |
624 |
|
AtEXO70B2 |
AT1G07000 |
AT1G07000.1 |
2 |
599 |
|
AtEXO70C1 |
AT5G13150 |
AT5G13150.1 |
1 |
653 |
|
AtEXO70C2 |
AT5G13990 |
AT5G13990.1 |
1 |
695 |
|
AtEXO70D1 |
AT1G72470 |
AT1G72470.1 |
1 |
633 |
|
AtEXO70D2 |
AT1G54090 |
AT1G54090.1 |
1 |
622 |
|
AtEXO70D3 |
AT3G14090 |
AT3G14090.1 |
1 |
623 |
|
AtEXO70E1 |
AT3G29400 |
AT3G29400.1 |
1 |
658 |
|
AtEXO70E2-1 |
AT5G61010 |
AT5G61010.1 |
1 |
639 |
|
AtEXO70E2-2 |
AT5G61010 |
AT5G61010.2 |
1 |
639 |
|
AtEXO70F1 |
AT5G50380 |
AT5G50380.1 |
1 |
683 |
|
AtEXO70G1 |
AT4G31540 |
AT4G31540.1 |
1 |
687 |
|
AtEXO70G2 |
AT1G51640 |
AT1G51640.1 |
1 |
660 |
|
AtEXO70H1 |
AT3G55150 |
AT3G55150.1 |
1 |
636 |
|
AtEXO70H2 |
AT2G39380 |
AT2G39380.1 |
1 |
637 |
|
AtEXO70H3 |
AT3G09530 |
AT3G09530.1 |
1 |
637 |
|
AtEXO70H4 |
AT3G09520 |
AT3G09520.1 |
1 |
628 |
|
AtEXO70H5 |
AT2G28640 |
AT2G28640.1 |
2 |
605 |
|
AtEXO70H6 |
AT1G07725 |
AT1G07725.1 |
2 |
615 |
|
AtEXO70H7-1 |
AT5G59730 |
AT5G59730.1 |
1 |
634 |
|
AtEXO70H7-2 |
AT5G59730 |
AT5G59730.2 |
1 |
632 |
|
AtEXO70H8 |
AT2G28650 |
AT2G28650.1 |
1 |
573 |
Table S3. Predicted EXO70 proteins and the corresponding gene from Oryza sativa.
|
Gene name |
Gene Locus |
Exon Number |
Protein Length (aa) |
|
OsEXO70A1 |
Os04g0685600 |
12 |
634 |
|
OsEXO70A2 |
Os11g0157400 |
12 |
643 |
|
OsEXO70A3 |
Os12g0159700 |
18 |
976 |
|
OsEXO70A4 |
Os04g0685500 |
12 |
661 |
|
OsEXO70B1 |
Os01g0827500 |
1 |
652 |
|
OsEXO70B2 |
Os05g0473500 |
1 |
661 |
|
OsEXO70B3 |
Os01g0827600 |
4 |
553 |
|
OsEXO70C1 |
Os12g0165600 |
1 |
700 |
|
OsEXO70C2 |
Os11g0167600 |
1 |
692 |
|
OsEXO70D1 |
Os08g0455700 |
1 |
632 |
|
OsEXO70D2 |
Os09g0439600 |
1 |
638 |
|
OsEXO70E1 |
Os01g0763700 |
1 |
602 |
|
OsEXO70F1 |
Os02g0505400 |
1 |
689 |
|
OsEXO70F2 |
Os04g0382200 |
1 |
688 |
|
OsEXO70F3 |
Os01g0921400 |
3 |
556 |
|
OsEXO70F4 |
Os08g0530300 |
1 |
606 |
|
OsEXO70F5 |
Os10g33850 |
3 |
461 |
|
OsEXO70G1 |
Os02g0149700 |
1 |
494 |
|
OsEXO70G2 |
Os06g0698600 |
1 |
673 |
|
OsEXO70G3 |
Os08g0519900 |
2 |
687 |
|
OsEXO70H1a |
Os11g0650100 |
1 |
579 |
|
OsEXO70H1b |
Os11g0649900 |
1 |
579 |
|
OsEXO70H2 |
Os03g0448200 |
1 |
556 |
|
OsEXO70H3 |
Os12g0100700 |
3 |
590 |
|
OsEXO70H4 |
Os11g0100800 |
3 |
590 |
|
OsEXO70I1 |
Os01g0905300 |
1 |
381 |
|
OsEXO70I2 |
Os01g0905200 |
2 |
557 |
|
OsEXO70I3 |
Os04g0111500 |
3 |
398 |
|
OsEXO70I4 |
Os07g0210300 |
5 |
691 |
|
OsEXO70I5 |
Os07g0210900 |
5 |
588 |
|
OsEXO70I6 |
Os07g0210000 |
4 |
646 |
|
OsEXO70J1 |
Os08g0232700 |
1 |
526 |
|
OsEXO70J2 |
Os09g0347300 |
1 |
598 |
|
OsEXO70J3 |
Os05g0369500 |
1 |
528 |
|
OsEXO70J5 |
Os05g0369300 |
1 |
520 |
|
OsEXO70J6 |
Os01g0383100 |
3 |
681 |
|
OsEXO70J7 |
Os02g0575900 |
3 |
700 |
|
OsEXO70J8 |
Os06g0183600 |
1 |
486 |
|
OsEXO70K1 |
Os06g0255900 |
1 |
412 |
|
OsEXO70K2 |
Os07g0211000 |
3 |
426 |
|
OsEXO70L1 |
Os11g0572200 |
2 |
433 |
We have added “Prediction of the transmembrane domain of Arabidopsis EXO70, the results showed that AtEXO70C1, AtEXO70C2, AtEXO70H5, AtEXO70H8, AtEXO70A3 have transmembrane domains, but they are not obvious, and the other EXO70s have no transmembrane domains (Figure S2). The prediction results of rice EXO70 show that OsEXO70A3, OsEXO70A4, OsEXO70H1a, OsEXO70H1b, OsEXO70H2, OsEXO70H3, OsEXO70H4, OsEXO70I3, OsEXO70I4, OsEXO70L1, OsEXO6K1, OsEXO70L, OsEXO70J1, OsEXO70J1, OsEXO70J2, OsEXO70J6, OsEXO70J8, OsEXO70K1, OsEXO7K2, OsEXO70L1 have a transmembrane domain. And OsEXO70A4 has a more obvious transmembrane domain at the C-terminus, and none of the other rice EXO70s has a transmembrane domain (Figure S3). Among the prediction results of the transmembrane domain of cotton EXO70, only GhEXO70E2-D has a transmembrane domain, and the others have no transmembrane domain. Both Arabidopsis and cotton contain fewer EXO70s with transmembrane domains. As rice is a monocot, it may be evolving to have more EXO70, and there are more EXO70s with transmembrane domains.” in the manuscript (L287-L300).
We have added “Figure S2. Analysis of transmembrane domains of EXO70 gene family in Arabidopsis. Figure S3. Analysis of transmembrane domains of EXO70 gene family in rice.” in the manuscript(L460-L462).
Figure S2. Analysis of transmembrane domains of EXO70 gene family in Arabidopsis.
Figure S3. Analysis of transmembrane domains of EXO70 gene family in rice.
Point 2: If authors can find relationships between cotton Exo70 subgroups and promoter organization, discuss it in Figure 5. The information may support to predict the Exo70 functions at subgroup level, Moreover, if the motifs unique in cotton Exo70 promoter can be found in comparison with arabidopsis and rice Exo70 promoters, please describe it, which may lead to identification of novel functions of cotton Exo70s.
Response 2: Thank you for your comment. Through the analysis of the promoters of the EXO70 gene in Arabidopsis and rice, the results show that the promoters of the EXO70 gene in Arabidopsis and rice also contain cis-acting elements that respond to environmental stress and plant hormones (Figure S5 and Figure S6). This phenomenon is not unique to cotton Exo70s, but conserved in plants.
We have added “To further verify whether the above cis-acting elements are unique to cotton EXO70s, we also analyzed the EXO70s gene promoters in Arabidopsis and rice. The results indicate that the promoters of EXO70 genes in Arabidopsis and rice also contain cis-acting elements that respond to environmental stress and plant hormones (Figure S5 and Figure S6). It shows that this phenomenon is not unique to cotton EXO70, but is conserved in plants.” in the manuscript (L339-L344).
We have added “Figure S5. Cis-acting elements in Arabidopsis EXO70s promoter. Figure S6. Cis-acting elements in rice EXO70s promoter.” in the manuscript (L463-L464).
Figure S5. Cis-acting elements in Arabidopsis EXO70s promoter.
Figure S6. Cis-acting elements in rice EXO70s promoter.
Point 3: In Figure 6, the data of GhEXO70A1-A localization is not clear. If authors want to conclude that GhEXO70A1-A localized at ER and plasma membranes, subcellular localization of GhEXO70A1-A must be demonstrated as co-localization with marker proteins for ER and plasma membranes. In tabacco, several useful marker proteins are available.
Response 3: Thank you for your comment and suggestion. Our subcellular localization results can clearly observe that 2300-GhEXO70A1-A-GFP is located on the plasma membrane, but due to the lack of plasma membrane and endoplasmic reticulum markers in the laboratory, the article’s localization on the endoplasmic reticulum membrane was changed to the plasma membrane. And it is not necessary to add a marker in most articles, for example "Identification and Characterization of the EXO70 Gene Family in Polyploid Wheat and Related Species. International journal of molecular sciences, 2018.”
Point 4: In Figure 7, protein expression of GhEXO70A1-A and other exocyst members in yeast cells should be checked. In addition, if there is the data of combinations of AD-GhEXO70A1-A and BD-other exocyst members, please show them.
Response 4: Thank you for your suggestion, I think it's very good. We designed primers for the CDS partial fragments of GhEXO70A1-A and other subunits of the secretory complex. Then the co-transformed yeasts were selected, shaken and identified by PCR to determine whether the subunits of GhEXO70A1-A and other cytokine complexes were expressed in yeast. The test results are shown in Figure A below. GhEXO70A1-A and other subunits of the secretory complex are all expressed in yeast.
We performed yeast double hybridization on AD-GhEXO70A1-A and BD-other exocyst members. As shown in Figure B below, because AD-GhEXO70A1-A has self-activation with BD, it has spots on the four-deficiency plate with BD-other exocyst members, so this result cannot be used as evidence of the interaction between subunits.
Figure Expression and identification of EXO70 and secretory complex subunits and interaction analysis of AD-GhEXO70A1-A and BD-other exocyst members
Table Primers used in this study.
|
Primer name |
Sequence(5’-3’) |
|
GhEXO84A-F1 |
ATGTCTATCGGAGATGTTTCTGAG |
|
GhEXO84A-R1 |
AAAGAAGATGTTGTAGCACCACC |
|
GhEXO84B-F1 |
ATGGCTACTGCTAAGGCTAAGACT |
|
GhEXO84B-R1 |
GTAGAAGATGGATGCAAAGAAAGC |
|
GhEXO84C-F1 |
ATGATGGAATCTTCTGAAGAGGAT |
|
GhEXO84C-R1 |
AATCCAGATTCTCTAGTAGTTAAAGAAATC |
|
GhSEC5-F1 |
ATGTCTACTGATAGTGATGATGAAGATG |
|
GhSEC5-R1 |
CAATCAAAGTTATCCTTGACCAAT |
|
GhSEC6-F1 |
ATGATGGTTGAAGATCTCGGAG |
|
GhSEC6-R1 |
TGAACCTTGAACTTTTGTTGAGC |
|
GhSEC8-F1 |
ATGGGAATCTTTGATGGATTCC |
|
GhSEC8-R1 |
TATGATCCATCAACGATTCCTTG |
|
GhSEC10-F1 |
ATGCCTGAAAGATCTAAATCTTCC |
|
GhSEC10-R1 |
TGTGAAGCAGCATCGAATCTAG |
|
GhSEC15A-F1 |
ATGGATAGTAAGCCTAAGAAGAGAGGT |
|
GhSEC15A-R1 |
CAGAATCCTCATCCACTTCCTC |
|
GhSEC15B-F1 |
ATGAAGTCTACTAGACCTAGAAGAAAGATG |
|
GhSEC15B-R1 |
TCCTCATCATCTTCCAATGCG |
|
GhEXO70A1-F1 |
ATGGGAATAGCAGTTGCAGG |
|
GhEXO70A1-R1 |
TTCTGGACATCATCTTTGCCA |
Point 5: In Figure 8, the effects of GhEXO70A1-A knockdown on transcriptome were analyzed by NGS analysis. GhEXO70A1-A knockdown was performed by VIGS. Because VIGS can affect expression levels of other Exo70 members as off-target, authors should confirm expression levels of other members of Exo70 family in the NGS data.
Response 5: Thank you for your comments. We sorted out the expression of other EXO70 genes in the NGS data, and the results are shown in the figure below, GhEXO70B-D, GhEXO70B-A, GhEXO70E6-D, GhEXO70F1-D, GhEXO70E3-D, GhEXO70H6-D, GhEXO70E1-D, GhEXO70H6-A, GhEXO70H3-D, GhEXO70D1-D, GhEXO70E3-A, GhEXO70C1-A, GhEXO70E5-A, GhEXO70C5-A have significant changes, and there are no significant changes in other EXO70 genes. However, except for GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A, which decreased to 32.1%, 46.9%, and 56.6% of the control, all other genes fell to more than 60% of the control, and the fold increase was also less than 1. Although the three genes GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A declined slightly, their expression abundance was also very low. The above results show that the knockdown of GhEXO70A1-A by VIGS does affect the expression of other EXO70 genes, but the effect is not significant after analysis. The changes in differential genes should be mainly caused by the changes in GhEXO70A1-A.
Point 6: In a sentence of Discussion “for vesicle transport, cell secretion, growth, and division, ”, delete “and”.
Response 6: Thank you for your suggestion. We are sorry for this mistake and we have deleted the “and”(L418) in the manuscript as suggested.
Author Response File:
Author Response.pdf
Round 2
Reviewer 2 Report
In this revised manuscript, authors added some descriptions about genome structures of cotton EXO70s including exon-intron organization, presence of transmembrane domain and cis-element of promoter sequences in comparison with those of arabidopsis and rice. On the other hand, authors should briefly describe the effects of EXO70A1 knockdown on other EXO70 members and add the data in supplementary Figure, even if the effect is minor. Although co-localization of GhEXO70A1 with plasma membrane marker was not shown, this manuscript seems to be enough to explain cotton Exo70 family. Therefore, I recommend the publication of this manuscript.
Author Response
Dear Reviewer:
Thank you for your comments on our manuscript entitled "Identification and Comprehensive Structural and Functional Analyses of the EXO70 Gene Family in Cotton" (genes-1393683). Those comments were very helpful for improving our manuscript. We believed we have answered all reviewers’ comments. The main corrections in the paper and the responds to the editors’ and reviewers’ comments are as follows:
Comments to the Author
In this revised manuscript, authors added some descriptions about genome structures of cotton EXO70s including exon-intron organization, presence of transmembrane domain and cis-element of promoter sequences in comparison with those of arabidopsis and rice. On the other hand, authors should briefly describe the effects of EXO70A1 knockdown on other EXO70 members and add the data in supplementary Figure, even if the effect is minor. Although co-localization of GhEXO70A1 with plasma membrane marker was not shown, this manuscript seems to be enough to explain cotton Exo70 family. Therefore, I recommend the publication of this manuscript.
Response: Thank you for your comments and suggestion. We have added “We sorted out the expression of other EXO70 genes in the NGS data, and the results are shown in the figure S7, GhEXO70B-D, GhEXO70B-A, GhEXO70E6-D, GhEXO70F1-D, GhEXO70E3-D, GhEXO70H6-D, GhEXO70E1-D, GhEXO70H6-A, GhEXO70H3-D, GhEXO70D1-D, GhEXO70E3-A, GhEXO70C1-A, GhEXO70E5-A, GhEXO70C5-A have significant changes, and there are no significant changes in other EXO70 genes. However, except for GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A, which decreased to 32.1%, 46.9%, and 56.6% of the control, all other genes fell to more than 60% of the control, and the fold increase was also less than 1. Although the three genes GhEXO70C1-A, GhEXO70H6-D, and GhEXO70H6-A declined slightly, their expression abundance was also very low. The above results show that the knockdown of GhEXO70A1-A by VIGS does affect the expression of other EXO70 genes, but the effect is not significant after analysis. The changes in differential genes should be mainly caused by the changes in GhEXO70A1-A.” in the manuscript (L375-L387).
We have added “Figure S7. Expression analysis of other changed EXO70 genes in NGS data.” in the manuscript (L476-L477).
Author Response File:
Author Response.docx
