Target-Genes Reveal Species and Genotypic Specificity of Anthocyanin Pigmentation in Citrus and Related Genera
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. Total RNA Extraction and Expression Analysis
2.3. Primer Design and Citrus Genome Support
2.4. Image Analysis of the Petals
2.5. Statistical Analyses
2.6. Anthocyanin and Lycopene Quantification
3. Results and Discussion
3.1. Genome Data Support the Variability and Specificity of the Expression Analysis
3.2. Anthocyanin Pigmentation Is an Extremely Variable Trait among Citrus Species and Tissues
3.2.1. The Pigmentation of Young Leaves Was Inherited from Citron
3.2.2. The Molecular Mechanism Controlling the Pigmentation of Petals in Citrus Is Deeply Articulated and Unusual
3.2.3. The Pigmentation of the Rind Is Independent of the Genetic Basis of the Parents and Is under the Control Mainly of External Factors and Fruit Developmental Stage
3.2.4. Flesh Pigmentation Is Exclusive to Purple Sweet Oranges and to M. australasica and Is Differently Correlated with the Acidity Trait
3.2.5. The Pigmentation of the Stamens and Styles Is Species-Specific, while the Red Color of the Stigmas is Genotype Dependent
4. Conclusions
- The pigmentation in young leaves and petals depends on citron. In species different from Citrus, the purple color in both tissues is not always correlated, such as in Severinia (purple young leaves and white flowers). Ruby represents the MYB transcription factor that controls the pigmentation of petals, but not of leaves.
- The pigmentation of fruit tissues has been gained and lost frequently through the history of Citrus, but stably characterizes blood oranges. The control of the variability in the flesh and rind represents one of the main traits sought by consumers and producers, and one of the focuses of breeding programs all over the world.
- The pigmentation of stamens and styles has given rise to the citron parent, but this trait is genetically less stable than in leaves and petals. Ruby and Noemi also control the pigmentation of stamens, in species different from citron and its hybrids, such as in Microcitrus for stamens.
- The pigmentation of the stigma is Moro-dependent, the only genotype-dependent trait, representing a new strategic phenotypic marker. The study of light and cold-dependent control of stigma pigmentation is similar to that known in fruits, and is currently under evaluation.
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wu, G.A.; Terol, J.; Ibanez, V.; López-García, A.; Pérez-Román, E.; Borredá, C.; Domingo, C.; Tadeo, F.R.; Carbonell-Caballero, J.; Alonso, R.; et al. Genomics of the Origin and Evolution of Citrus. Nature 2018, 554, 311–316. [Google Scholar] [CrossRef] [PubMed]
- Ollitrault, P.; Curk, F.; Krueger, R. Citrus Taxonomy. In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Eds.; Woodhead Publishing, Elsevier: Duxford, UK, 2020. [Google Scholar] [CrossRef]
- Butelli, E.; Garcia-Lor, A.; Licciardello, C.; Las Casas, G.; Hill, L.; Recupero, G.R.; Keremane, M.L.; Ramadugu, C.; Krueger, R.; Xu, Q.; et al. Changes in Anthocyanin Production during Domestication of Citrus. Plant Physiol. 2017, 173, 2225–2242. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Wang, X.; Tang, Z.; Yuan, Y.; Xu, Y.; He, J.; Jiang, X.; Peng, S.A.; Li, L.; Butelli, E.; et al. Subfunctionalization of the Ruby2–Ruby1 Gene Cluster during the Domestication of Citrus. Nat. Plants 2018, 4, 930–941. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Deng, Z.; Zhu, H.; Hu, C.; Liu, R.; Young, J.C.; Tsao, R. Highly Pigmented Vegetables: Anthocyanin Compositions and Their Role in Antioxidant Activities. Food Res. Int. 2012, 46, 250–259. [Google Scholar] [CrossRef]
- Dixon, R.A.; Paiva, N.L. Stress-Induced Phenylpropanoid Metabolism. Plant Cell 1995, 7, 1085–1097. [Google Scholar] [CrossRef]
- Winkel-Shirley, B. Biosynthesis of Flavonoids and Effects of Stress. Curr. Opin. Plant Biol. 2002, 5, 218–223. [Google Scholar] [CrossRef]
- He, J.; Giusti, M.M. Anthocyanins: Natural Colorants with Health-Promoting Properties. Annu. Rev. Food Sci. Technol. 2010, 1, 163–187. [Google Scholar] [CrossRef]
- Titta, L.; Trinei, M.; Stendardo, M.; Berniakovich, I.; Petroni, K.; Tonelli, C.; Riso, P.; Porrini, M.; Minucci, S.; Pelicci, P.G.; et al. Blood Orange Juice Inhibits Fat Accumulation in Mice. Int. J. Obes. 2010, 34, 578–588. [Google Scholar] [CrossRef]
- Lo Piero, A.R.; Puglisi, I.; Rapisarda, P.; Petrone, G. Anthocyanins Accumulation and Related Gene Expression in Red Orange Fruit Induced by Low Temperature Storage. J. Agric. Food Chem. 2005, 53, 9083–9088. [Google Scholar] [CrossRef]
- Crifò, T.; Puglisi, I.; Petrone, G.; Recupero, G.R.; Lo Piero, A.R. Expression Analysis in Response to Low Temperature Stress in Blood Oranges: Implication of the Flavonoid Biosynthetic Pathway. Gene 2011, 476, 1–9. [Google Scholar] [CrossRef]
- Butelli, E.; Licciardello, C.; Zhang, Y.; Liu, J.; Mackay, S.; Bailey, P.; Reforgiato-Recupero, G.; Martin, C. Retrotransposons Control Fruit-Specific, Cold-Dependent Accumulation of Anthocyanins in Blood Oranges. Plant Cell 2012, 24, 1242–1255. [Google Scholar] [CrossRef] [PubMed]
- Carmona, L.; Alquézar, B.; Marques, V.V.; Peña, L. Anthocyanin Biosynthesis and Accumulation in Blood Oranges during Postharvest Storage at Different Low Temperatures. Food Chem. 2017, 237, 7–14. [Google Scholar] [CrossRef] [PubMed]
- Caruso, M.; Ferlito, F.; Licciardello, C.; Allegra, M.; Strano, M.C.; Di Silvestro, S.; Russo, M.P.; Pietro Paolo, D.; Caruso, P.; Las Casas, G.; et al. Pomological Diversity of the Italian Blood Orange Germplasm. Sci. Hortic. 2016, 213, 331–339. [Google Scholar] [CrossRef]
- Huang, D.; Yuan, Y.; Tang, Z.; Huang, Y.; Kang, C.; Deng, X.; Xu, Q. Retrotransposon Promoter of Ruby1 Controls Both Light- and Cold-Induced Accumulation of Anthocyanins in Blood Orange. Plant Cell Environ. 2019, 42, 3092–3104. [Google Scholar] [CrossRef]
- Dooner, H.K.; Robbins, T.P.; Jorgensen, R.A. Genetic and Developmental Control of Anthocyanin Biosynthesis. Annu. Rev. Genet. 1991, 25, 173–199. [Google Scholar] [CrossRef]
- Guo, N.; Han, S.; Zong, M.; Wang, G.; Zheng, S.; Liu, F. Identification and Differential Expression Analysis of Anthocyanin Biosynthetic Genes in Leaf Color Variants of Ornamental Kale. BMC Genom. 2019, 20, 564. [Google Scholar] [CrossRef]
- Liu, Y.; Tikunov, Y.; Schouten, R.E.; Marcelis, L.F.M.; Visser, R.G.F.; Bovy, A. Anthocyanin Biosynthesis and Degradation Mechanisms in Solanaceous Vegetables: A Review. Front. Chem. 2018, 6, 52. [Google Scholar] [CrossRef]
- Butelli, E.; Licciardello, C.; Ramadugu, C.; Durand-Hulak, M.; Celant, A.; Reforgiato Recupero, G.; Froelicher, Y.; Martin, C. Noemi Controls Production of Flavonoid Pigments and Fruit Acidity and Illustrates the Domestication Routes of Modern Citrus Varieties. Curr. Biol. 2019, 29, 158–164. [Google Scholar] [CrossRef]
- Ma, D.; Constabel, C.P. MYB Repressors as Regulators of Phenylpropanoid Metabolism in Plants. Trends Plant Sci. 2019, 24, 275–289. [Google Scholar] [CrossRef]
- Huang, D.; Tang, Z.; Fu, J.; Yuan, Y.; Deng, X.; Xu, Q. CsMYB3 and CsRuby1 Form an “Activator-and-Repressor” Loop for the Regulation of Anthocyanin Biosynthesis in Citrus. Plant Cell Physiol. 2019, 61, 318–330. [Google Scholar] [CrossRef]
- Moriguchi, T.; Kita, M.; Tomono, Y.; Endo-Inagaki, T.; Omura, M. One Type of Chalcone Synthase Gene Expressed during Embryogenesis Regulates the Flavonoid Accumulation in Citrus Cell Cultures. Plant Cell Physiol. 1999, 40, 651–655. [Google Scholar] [CrossRef][Green Version]
- Moriguchi, T.; Kita, M.; Tomono, Y.; Endo-Inagaki, T.; Omura, M. Gene Expression in Flavonoid Biosynthesis: Correlation with Flavonoid Accumulation in Developing Citrus Fruit. Physiol. Plant 2001, 11, 66–74. [Google Scholar] [CrossRef]
- Cotroneo, P.S.; Russo, M.P.; Ciuni, M.; Recupero, G.R.; Lo Piero, A.R. Quantitative Real-Time Reverse Transcriptase-PCR Profiling of Anthocyanin Biosynthetic Genes during Orange Fruit Ripening. J. Am. Soc. Hortic. Sci. 2006, 131, 537–543. [Google Scholar] [CrossRef]
- Licciardello, C.; Russo, M.P.; Vale’, G.; Recupero, R.G. Identification of Differentially Expressed Genes in the Flesh of Blood and Common Oranges. Tree Genet. Genomes 2008, 4, 315–331. [Google Scholar] [CrossRef]
- Muccilli, V.; Licciardello, C.; Fontanini, D.; Russo, M.P.; Cunsolo, V.; Saletti, R.; Reforgiato Recupero, G.; Foti, S. Proteome Analysis of Citrus sinensis L. (Osbeck) Flesh at Ripening Time. J. Proteom. 2009, 73, 134–152. [Google Scholar] [CrossRef] [PubMed]
- Hodgson, R.W. Horticultural Varieties of Citrus. In The Citrus Industry; Reuther, W., Webber, H.J., Batchelor, L.D., Eds.; University of California Press: Ruverside, CA, USA, 1967; pp. 431–591. [Google Scholar]
- Rapisarda, P.; Fabroni, S.; Peterek, S.; Russo, G.; Mock, H.P. Juice of New Citrus Hybrids (Citrus Clementina Hort. Ex Tan.×C. Sinensis L. Osbeck) as a Source of Natural Antioxidants. Food Chem. 2009, 117, 212–218. [Google Scholar] [CrossRef]
- Russo, G.; Licciardello, C.; Caruso, P.; Russo, M.P.; Petro Paolo, D.; Reforgiato Recupero, G.; Rapisarda, P.; Ballistreri, G.; Fabroni, S.; Caruso, M. New CREA Citrus Hybrids. Citrus Res. Technol. 2016, 37, 98–101. [Google Scholar] [CrossRef]
- Swingle, W.; Reece, P. The botany of Citrus and its wild relatives. In The Citrus Industry; Reuther, W., Webber, H.J., Batchelor, L.D., Eds.; University of California Press: Ruverside, CA, USA, 1967; pp. 190–430. [Google Scholar]
- La Rosa, G.; Reforgiato Recupero, G.; Nicolosi, E.; Russo, G.; Continella, G. Recupero e salvaguardia di germoplasma agrumicolo italiano. Italus Hortus 2005, 12, 31–36. [Google Scholar]
- Deng, X.; Yang, X.; Yamamoto, M.; Biswas, M.K. Domestication and history. In The Genus Citrus; Talon, M., Caruso, M., Gmitter, F.G., Eds.; Woodhead Publishing, Elsevier: Duxford, UK, 2020; pp. 33–51. [Google Scholar] [CrossRef]
- Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3-Masker: Integrating Masking of Template Sequence with Primer Design Software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef]
- Olio Analysis Tool. Eurofins Genomics. Available online: https://www.eurofinsgenomics.eu/en/dna-rna-oligonucleotides/oligo-tools/oligo-analysis-tool/ (accessed on 24 April 2018).
- Xu, Q.; Chen, L.L.; Ruan, X.; Chen, D.; Zhu, A.; Chen, C.; Bertrand, D.; Jiao, W.B.; Hao, B.H.; Lyon, M.P.; et al. The Draft Genome of Sweet Orange (Citrus Sinensis). Nat. Genet. 2013, 45, 59–68. [Google Scholar] [CrossRef]
- Johnson, M.; Zaretskaya, I.; Raytselis, Y.; Merezhuk, Y.; McGinnis, S.; Madden, T.L. NCBI BLAST: A Better Web Interface. Nucleic Acids Res. 2008, 36, W5–W9. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xu, Y.; Zhang, S.; Cao, L.; Huang, Y.; Cheng, J.; Wu, G.; Tian, S.; Chen, C.; Liu, Y.; et al. Genomic Analyses of Primitive, Wild and Cultivated Citrus Provide Insights into Asexual Reproduction. Nat. Genet. 2017, 49, 765–772. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; He, F.; Huang, Y.; He, J.; Yang, S.; Zeng, J.; Deng, C.; Jiang, X.; Fang, Y.; Wen, S.; et al. Genome of Wild Mandarin and Domestication History of Mandarin. Mol. Plant 2018, 11, 1024–1037. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Zheng, X.; Huang, Y.; Ye, J.; Chen, P.; Zhang, C.; Zhao, F.; Xie, Z.; Zhang, S.; Wang, N.; et al. Genome Sequencing and CRISPR/Cas9 Gene Editing of an Early Flowering Mini-Citrus (Fortunella Hindsii). Plant Biotechnol. J. 2019, 17, 2199–2210. [Google Scholar] [CrossRef] [PubMed]
- CLC sequence Viewer. Quiagen. Available online: www.clcbio.com (accessed on 3 February 2020).
- Sherry, S.; Xiao, C.; Durbrow, K.; Kimelman, M.; Rodarmer, K.; Shumway, M.; Yaschenko, E. NCBI SRA Toolkit Technology for Next Generation Sequence Data. In Proceedings of the Plant and Animal Genome XX Conference, San Diego, CA, USA, 14–18 January 2012. [Google Scholar]
- Krueger, F. Trim Galore. Available online: http://www.bioinformatics.babraham.ac.uk/projects/trimgalore/ (accessed on 12 February 2020).
- Lunter, G.; Goodson, M. Stampy: A Statistical Algorithm for Sensitive and Fast Mapping of Illumina Sequence Reads. Genome Res. 2011, 21, 936–939. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Narasimhan, V.; Danecek, P.; Scally, A.; Xue, Y.; Tyler-Smith, C.; Durbin, R. BCFtools/RoH: A Hidden Markov Model Approach for Detecting Autozygosity from next-Generation Sequencing Data. Bioinformatics 2016, 32, 1749–1751. [Google Scholar] [CrossRef]
- Scholz, M. Available online: http://www.metagenomics.wiki/tools/samtools/consensus-sequence (accessed on 20 April 2020).
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An Open-Source Platform for Biological-Image Analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Wang, F. SIOX Plugin in ImageJ: Area Measurement Made Easy. UV4Plants Bull. 2017, 2, 37–44. [Google Scholar] [CrossRef]
- Igathinathane, C.; Pordesimo, L.O.; Columbus, E.P.; Batchelor, W.D.; Methuku, S.R. Shape Identification and Particles Size Distribution from Basic Shape Parameters Using ImageJ. Comput. Electron. Agric. 2008, 63, 168–182. [Google Scholar] [CrossRef]
- Shapiro, S.S.; Wilk, M.B. An Analysis of Variance Test for Normality (Complete Samples). Biometrika 1965, 52, 591–611. [Google Scholar] [CrossRef]
- Wilcoxon, F. Individual Comparisons of Grouped Data by Ranking Methods. J. Econ. Entomol. 1946, 39, 269–270. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, R.; Shimodaira, H. Pvclust: An R Package for Assessing the Uncertainty in Hierarchical Clustering. Bioinformatics 2006, 22, 1540–1542. [Google Scholar] [CrossRef] [PubMed]
- Martins, T.G. Computing and Visualizing PCA. Available online: https://www.r-bloggers.com/computing-and-visualizing-pca-in-r/ (accessed on 22 June 2020).
- Mevik, B.-H. The pls Package: Principal Component and Partial Least Squares Regression in R. J. Stat. Softw. 2007, 18, 1–24. [Google Scholar] [CrossRef]
- Wickham, H. Ggplot2, 2nd ed.; Springer International Publishing: New York, NY, USA, 2009. [Google Scholar] [CrossRef]
- Rousseaux, E.; Bolano, D.; Ritschard, G. The Rsocialdata Package: Handling Survey Data in R. In Proceedings of the XXVII IUSSP International Population Conference, Busan, Korea, 26–31 August 2013. [Google Scholar]
- Hunter, J.E.; Cohen, S.H. Package: Igraph. Educ. Psychol. Meas. 2007. [Google Scholar] [CrossRef]
- R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2017; ISBN 3-900051-07-0. Available online: http://www.R-project.org (accessed on 10 March 2020).
- Rapisarda, P.; Fanella, F.; Maccarone, E. Reliability of Analytical Methods for Determining Anthocyanins in Blood Orange Juices. J. Agric. Food Chem. 2000, 48, 2249–2252. [Google Scholar] [CrossRef]
- Choudhary, R.; Bowser, T.J.; Weckler, P.; Maness, N.O.; McGlynn, W. Rapid Estimation of Lycopene Concentration in Watermelon and Tomato Puree by Fiber Optic Visible Reflectance Spectroscopy. Postharvest Biol. Technol. 2009, 52, 103–109. [Google Scholar] [CrossRef]
- Rapisarda, P.; Bellomo, S.E.; Fabroni, S.; Russo, G. Juice Quality of Two New Mandarin-like Hybrids (Citrus Clementina Hort. Ex Tan x Citrus Sinensis L. Osbeck) Containing Anthocyanins. J. Agric. Food Chem. 2008, 56, 2074–2078. [Google Scholar] [CrossRef]
- Torres, G.J.J.; Tadiotti, A.C.; De Sylos, C.M. Comparison of Carotenoid Content in Tomato, Tomato Pulp and Ketchup By Liquid Chromatography. Alim. Nutr. Araraquara 2006, 17, 353–358. [Google Scholar]
- Samuel, R.; Ehrendorfer, F.; Chase, M.W.; Greger, H. Phylogenetic Analyses of Aurantioideae (Rutaceae) Based on Non-Coding Plastid DNA Sequences and Phytochemical Features. Plant Biol. 2001, 3, 77–87. [Google Scholar] [CrossRef]
- Bayer, R.J.; Mabberley, D.J.; Morton, C.; Miller, C.H.; Sharma, I.K.; Pfeil, B.E.; Rich, S.; Hitchcock, R.; Sykes, S. A Molecular Phylogeny of the Orange Subfamily (Rutaceae: Aurantioideae) Using Nine CpDNA Sequences. Am. J. Bot. 2009, 96, 668–685. [Google Scholar] [CrossRef] [PubMed]
- Mou, F.J.; Tu, T.Y.; Chen, Y.Z.; Zhang, D.X. Phylogenetic Relationship of Clauseneae (Rutaceae) Inferred from Plastid and Nuclear DNA Data and Taxonomic Implication for Some Major Taxa. Nord. J. Bot. 2018, 36, e01552. [Google Scholar] [CrossRef]
- Ramstad, E.; Lin, N.C.; Lin, T.J.; Koo, W.Y. Coumurrayin, a New Coumarin from Murraya paniculata L. Jack. Tetrahedron Lett. 1968, 9, 811–813. [Google Scholar] [CrossRef]
- Ferracin, R.J.; Da Silva, M.F.D.G.F.; Fernandes, J.B.; Vieira, P.C. Flavonoids from the Fruits of Murraya Paniculata. Phytochemistry 1998, 47, 393–396. [Google Scholar] [CrossRef]
- Zhang, H.; Koes, R.; Shang, H.; Fu, Z.; Wang, L.; Dong, X.; Zhang, J.; Passeri, V.; Li, Y.; Jiang, H.; et al. Identification and Functional Analysis of Three New Anthocyanin R2R3-MYB Genes in Petunia. Plant Direct 2019, 1–13. [Google Scholar] [CrossRef]
- Dembeck, L.M.; Huang, W.; Carbone, M.A.; Mackay, T.F.C. Genetic Basis of Natural Variation in Body Pigmentation in Drosophila Melanogaster. Fly 2015, 9, 75–81. [Google Scholar] [CrossRef]
- Gompel, N.; Prud’Homme, B.; Wittkopp, P.J.; Kassner, V.A.; Carroll, S.B. Chance Caught on the Wing: Cis-Regulatory Evolution and the Origin of Pigment Patterns in Drosophila. Nature 2005, 433, 481–487. [Google Scholar] [CrossRef]
- Hoekstra, H.E. Genetics, Development and Evolution of Adaptive Pigmentation in Vertebrates. Heredity 2006, 97, 222–234. [Google Scholar] [CrossRef]
- Quattrocchio, F.; Wing, J.; Van Der Woude, K.; Souer, E.; De Vetten, N.; Joseph, M.; Koes, R. Molecular Analysis of the Anthocyanin2 Gene of Petunia and Its Role in the Evolution of Flower Color. Plant Cell 1999, 11, 1433–1444. [Google Scholar] [CrossRef]
- Baudry, A.; Heim, M.A.; Dubreucq, B.; Caboche, M.; Weisshaar, B.; Lepiniec, L. TT2, TT8, and TTG1 Synergistically Specify the Expression of BANYULS and Proanthocyanidin Biosynthesis in Arabidopsis Thaliana. Plant J. 2004, 39, 366–380. [Google Scholar] [CrossRef]
- Hatlestad, G.J.; Lloyd, A. The Betalain Secondary Metabolic Network. In Pigments in Fruits and Vegetables. Genomics and Dietetics; Chen, C., Ed.; Springer: New York, NY, USA, 2015; pp. 127–140. [Google Scholar]
- Sheehan, H.; Moser, M.; Klahre, U.; Esfeld, K.; Dell’Olivo, A.; Mandel, T.; Metzger, S.; Vandenbussche, M.; Freitas, L.; Kuhlemeier, C. MYB-FL Controls Gain and Loss of Floral UV Absorbance, a Key Trait Affecting Pollinator Preference and Reproductive Isolation. Nat. Genet. 2016, 48, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Continella, A.; Pannitteri, C.; La Malfa, S.; Legua, P.; Distefano, G.; Nicolosi, E.; Gentile, A. Influence of Different Rootstocks on Yield Precocity and Fruit Quality of ‘Tarocco Scirè’ Pigmented Sweet Orange. Sci. Hortic. 2018, 230, 62–67. [Google Scholar] [CrossRef]
- Choinski, J.S.; Ralph, P.; Eamus, D. Changes in Photosynthesis during Leaf Expansion in Corymbia Gummifera. Aust. J. Bot. 2003, 51, 111–118. [Google Scholar] [CrossRef]
- Cai, Z.Q.; Slot, M.; Fan, Z.X. Leaf Development and Photosynthetic Properties of Three Tropical Tree Species with Delayed Greening. Photosynthetica 2005, 43, 91–98. [Google Scholar] [CrossRef]
- Lawrence, W.J.C.; Price, J.R.; Robinson, G.M.; Robinson, R. A Survey of Anthocyanins. V. Biochem. J. 1938, 32, 1661–1667. [Google Scholar] [CrossRef]
- Neill, S.O.; Gould, K.S.; Kilmartin, P.A.; Mitchell, K.A.; Markham, K.R. Antioxidant Activities of Red versus Green Leaves in Elatostema Rugosum. Plant Cell Environ. 2002, 25, 539–547. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, H.; Lin-Wang, K.; Vimolmangkang, S.; Espley, R.V.; Wang, L.; Allan, A.C.; Han, Y. Transcriptome Analysis and Transient Transformation Suggest an Ancient Duplicated MYB Transcription Factor as a Candidate Gene for Leaf Red Coloration in Peach. BMC Plant Biol. 2014, 338, 1–13. [Google Scholar] [CrossRef]
- Jaakola, L.; Hohtola, A.; Määttä, K.; Törrönen, R.; Kärenlampi, S. Flavonoid Biosynthesis in Bilberry (Vaccinium myrtillus L.). Acta Hortic. 2002, 618, 415–419. [Google Scholar] [CrossRef]
- Curk, F.; Ollitrault, F.; Garcia-Lor, A.; Luro, F.; Navarro, L.; Ollitrault, P. Phylogenetic Origin of Limes and Lemons Revealed by Cytoplasmic and Nuclear Markers. Ann. Bot. 2016, 117, 565–583. [Google Scholar] [CrossRef]
- Scora, R.W. On the History and Origin of Citrus. Bull. Torrey Bot. Club 1975, 102, 369–375. [Google Scholar] [CrossRef]
- Nicolosi, E.; Deng, Z.N.; Gentile, A.; La Malfa, S.; Continella, G.; Tribulato, E. Citrus Phylogeny and Genetic Origin of Important Species as Investigated by Molecular Markers. Theor. Appl. Genet. 2000, 100, 1155–1166. [Google Scholar] [CrossRef]
- Faraco, M.; Spelt, C.; Bliek, M.; Verweij, W.; Hoshino, A.; Espen, L.; Prinsi, B.; Jaarsma, R.; Tarhan, E.; deBoer, A.H.; et al. Hyperacidification of Vacuoles by the Combined Action of Two Different P-ATPases in the Tonoplast Determines Flower Color. Cell Rep. 2014, 6, 32–43. [Google Scholar] [CrossRef]
- Spelt, C.; Quattrocchio, F.; Mol, J.; Koes, R. ANTHOCYANIN1 of Petunia Controls Pigment Synthesis, Vacuolar PH, and Seed Coat Development by Genetically Distinct Mechanisms. Plant Cell 2002, 14, 2121–2213. [Google Scholar] [CrossRef]
- Faraco, M.; Li, Y.; Li, S.; Spelt, C.; Di Sansebastiano, G.P.; Reale, L.; Ferranti, F.; Verweij, W.; Koes, R.; Quattrocchio, F.M. A Tonoplast P3B-ATPase Mediates Fusion of Two Types of Vacuoles in Petal Cells. Cell Rep. 2017, 19, 2413–2422. [Google Scholar] [CrossRef] [PubMed]
- Quattrocchio, F.; Verweij, W.; Kroon, A.; Spelt, C.; Mol, J.; Koes, R. PH4 of Petunia Is an R2R3 MYB Protein That Activates Vacuolar Acidification through Interactions with Basic-Helix-Loop-Helix Transcription Factors of the Anthocyanin Pathway. Plant Cell 2006, 18, 1274–1291. [Google Scholar] [CrossRef] [PubMed]
- Verweij, W.; Spelt, C.; Di Sansebastiano, G.P.; Vermeer, J.; Reale, L.; Ferranti, F.; Koes, R.; Quattrocchio, F. An H+ P-ATPase on the Tonoplast Determines Vacuolar PH and Flower Colour. Nat. Cell Biol. 2008, 10, 1456–1462. [Google Scholar] [CrossRef]
- Albert, N.W.; Lewis, D.H.; Zhang, H.; Schwinn, K.E.; Jameson, P.E.; Davies, K.M. Members of an R2R3-MYB Transcription Factor Family in Petunia Are Developmentally and Environmentally Regulated to Control Complex Floral and Vegetative Pigmentation Patterning. Plant J. 2011, 65, 771–784. [Google Scholar] [CrossRef]
- Schwinn, K.; Venail, J.; Shang, Y.; Mackay, S.; Alm, V.; Butelli, E.; Oyama, R.; Bailey, P.; Davies, K.; Martin, C. A Small Family of MYB-Regulatory Genes Controls Floral Pigmentation Intensity and Patterning in the Genus Antirrhinum. Plant Cell 2006, 18, 831–851. [Google Scholar] [CrossRef] [PubMed]
- Strazzer, P.; Spelt, C.E.; Li, S.; Bliek, M.; Federici, C.T.; Roose, M.L.; Koes, R.; Quattrocchio, F.M. Hyperacidification of Citrus Fruits by a Vacuolar Proton-Pumping P-ATPase Complex. Nat. Commun. 2019, 10, 1–11. [Google Scholar] [CrossRef]
- Lo Piero, A.R.; Puglisi, I.; Petrone, G. Gene Characterization, Analysis of Expression and in Vitro Synthesis of Dihydroflavonol 4-Reductase from [Citrus Sinensis (L.) Osbeck]. Phytochemistry 2006, 67, 684–695. [Google Scholar] [CrossRef]
- Sylvestre-Gonon, E.; Law, S.R.; Schwartz, M.; Robe, K.; Keech, O.; Didierjean, C.; Dubos, C.; Rouhier, N.; Hecker, A. Functional, Structural and Biochemical Features of Plant Serinyl-Glutathione Transferases. Front. Plant Sci. 2019, 10, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Lo Piero, A.R.; Puglisi, I.; Petrone, G. Gene Isolation, Analysis of Expression, and in Vitro Synthesis of Glutathione S-Transferase from Orange Fruit [Citrus Sinensis L. (Osbeck)]. J. Agric. Food Chem. 2006, 54, 9227–9233. [Google Scholar] [CrossRef] [PubMed]
- Licciardello, C.; D’Agostino, N.; Traini, A.; Recupero, G.R.; Frusciante, L.; Chiusano, M.L. Characterization of the Glutathione S-Transferase Gene Family through ESTs and Expression Analyses within Common and Pigmented Cultivars of (L.) Osbeck. BMC Plant Biol. 2014, 14, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Ballesta, M.T.; Zacarias, L.; Granell, A.; Lafuente, M.T. Accumulation of PAL Transcript and PAL Activity as Affected by Heat-Conditioning and Low-Temperature Storage and Its Relation to Chilling Sensitivity in Mandarin Fruits. J. Agric. Food Chem. 2000, 48, 2726–2731. [Google Scholar] [CrossRef] [PubMed]
- Licciardello, C.; Las Casas, G.; Caruso, M.; Caruso, P.; Russo, M.P.; Pietro Paolo, D.; Russo, G.; Reforgiato Recupero, G. The Evolution of Citrate Metabolism in Acidic and Acidless Citrus Genotypes during Fruit Development and Ripening. Acta Hortic. 2016, 1135, 53–60. [Google Scholar] [CrossRef]
- Wang, Y.; Ji, S.; Zang, W.; Wang, N.; Cao, J.; Li, X.; Sun, C. Identification of Phenolic Compounds from a Unique Citrus Species, Finger Lime (Citrus Australasica) and Their Inhibition of LPS-Induced NO-Releasing in BV-2 cell Line. Food Chem. Toxicol. 2019, 129, 54–63. [Google Scholar] [CrossRef] [PubMed]
- Galliot, C.; Stuurman, J.; Kuhlemeier, C. The Genetic Dissection of Floral Pollination Syndromes. Curr. Opin. Plant Biol. 2006, 9, 78–82. [Google Scholar] [CrossRef]
- Ahmed, N.U.; Park, J.I.; Jung, H.J.; Yang, T.J.; Hur, Y.; Nou, I.S. Characterization of Dihydroflavonol 4-Reductase (DFR) Genes and Their Association with Cold and Freezing Stress in Brassica Rapa. Gene 2014, 550, 46–55. [Google Scholar] [CrossRef]
- Zhao, D.; Tao, J. Recent Advances on the Development and Regulation of Flower Color in Ornamental Plants. Front. Plant Sci. 2015, 6, 1–13. [Google Scholar] [CrossRef]
- Serrano-Díaz, J.; Sánchez, A.M.; Maggi, L.; Martínez-Tomé, M.; García-Diz, L.; Murcia, M.A.; Alonso, G.L. Increasing the Applications of Crocus Sativus Flowers as Natural Antioxidants. J. Food Sci. 2012, 77, 1162–1168. [Google Scholar] [CrossRef]
- Caruso, M.; Las Casas, G.; Scaglione, D.; Gattolin, S.; Rossini, L.; Distefano, G.; Cattonaro, F.; Catara, A.; Licciardello, G.; Morgante, M.; et al. Detection of Natural and Induced Mutations from next Generation Sequencing Data in Sweet Orange Bud Sports. Acta Hortic. 2019, 1230, 117–122. [Google Scholar] [CrossRef]












![]() | ![]() | ![]() | ![]() | ![]() | ![]() | ![]() | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Taxonomic Classification | Species & Hybrid | Accession | Accession Code | Reference | Main Traits | Tissues | |||||||
| Young leaf | Petal | Style | Stamen | Stigma | Flesh/Juice | Rind | |||||||
| Sweet oranges & hybrids | C. reticulata x (C. reticulata x C. maxima) | C. sinensis | Navel | N | [27] | Typical non-pigmented orange | |||||||
| Vaniglia sanguigno | VS | [27] | Lycopene-rich and acidless flesh | * | |||||||||
| Tarocco Lempso | TL | [27] | Highly pigmented in the rind and less in the flesh | ||||||||||
| Tarocco Ippolito | TI | [27] | Highly purple, internally and externally | ||||||||||
| Doppio sanguigno | DS | [27] | Rind intensely red-coloured at fully maturity; flesh well-coloured | ||||||||||
| Moro | M | [27] | Highly pigmented, internally and externally | ||||||||||
| C. reticulata x C. sinensis | Mandarin-like | Sunred | S | [28,29] | Seedy fruits containing three-times more anthocyanins than Moro | ||||||||
| Citron & its direct hybrids | C. medica | C. medica | Diamante | CD | [30] | Typical citron | |||||||
| Buddha’s hand | MB | [30] | Fingered citron, purple flower bud and purple-tinted open flowers | ||||||||||
| C. medica hybrid | Unknown parent | Incomparabile lemon | LI | [31] | Ancient origin described as hybrid between sour orange and citron | ||||||||
| C. reticulata x C. medica | C. limonia | Volkamer lemon | CV | [30] | Used as rootstock | ||||||||
| Rangpur lime | RaL | [30] | New shoots lightly purple-tinted; flowers petals deeply purple-tinted | ||||||||||
| Red Lime | RL | [30] | New shoots lightly purple-tinted; flowers petals deeply purple-tinted | ||||||||||
| Lima rossa corrugata | LR | [30] | New shoots lightly purple-tinted; flowers petals deeply purple-tinted | ||||||||||
| C. aurantium x C. medica | C. limon | Zagara bianca | ZB | [30] | Non-pigmented flowers and young leaves | ||||||||
| Femminello Adamo | FA | [30] | Typical lemon | ||||||||||
| Pink fleshed | PF | [30] | Also called ‘Variegated Pink Fleshed Eureka Lemon’; rind variegated in green and yellow, fading during the ripening; lycopene-rich flesh | * | * | ||||||||
| C. micrantha x C. medica | C. aurantifolia | Mexican lime (tornless) | LMT | [30] | Also called ’West Indian lime’; new shoots, flower buds and young flowers faintly purple-tinted | ||||||||
| C. celebica | Southwickù CRC2453 | CC | [32] | Papedocitrus | |||||||||
| Other Citrus species | (C. maxima x C. reticulata) x C. medica | C. meyeri | Meyer lemon | LM | [30] | Flowers and new shoot purple-tinted | |||||||
| C. limon x C. aurantifolia (3n) | C. latifolia | Tahiti lime | LT | [30] | Triploid; purple coloration usually faint and evanescent in both flowers and shoots | ||||||||
| Subgenus Papeda and other genera | Microcitrus australasica x (Fortunella sp. x Citrus sp) | Citrus hybrid | Faustrime | MAF | [30] | Trigeneric hybrid | |||||||
| genus Microcitrus | M. australasica | Sanguinea | MAS | [30] | Red-pulped variety of the Australian finger-lime | ||||||||
| genus Murraya | M. paniculata | - | MP | [30] | Australian origin; ornamental uses; orange-coloured berries | * | |||||||
| genus Severinia | S. disticha | - | SD | [30] | Primitive Citrus, also called ’Philippine Box Orange’; yellowish-green peel at maturity (#) | ||||||||
| S. buxifolia | - | SB | [30] | Primitive Citrus, also called ’Chinese box orange’; black berries at maturity | |||||||||
| subgenus Papeda | C. hystrix | - | CH | [30] | Typical “double” leaves with wide petioles; petals yellowish white or red-tinted | ||||||||
| C. latipes | - | CL | [32] | Wild nonedible citrus species; commonly called “Khasi papeda” | |||||||||
| Gene Classification | Gene | Gene Position | Sequence 5′ 3′ | Fw/Rev | Amplicon (pb) |
|---|---|---|---|---|---|
| Housekeeping | EF * | Cs8g16990 | AAGCTGGTATCTCCAAGGATGGT | Fw | 72 |
| CCAAGGGTGAAAGCAAGCAA | Rev | ||||
| Phenylpropanoid pathway | PAL | Cs6g11950 | GGAAGCTCATGTTTGCCCAA | Fw | 118 |
| TCAGCGCCCTTGAAACCATA | Rev | ||||
| Early biosynthetic genes | CHS | Cs2g14720 | CCAGGCTGATTATCCCGACT | Fw | 90 |
| TTGTCACACATGCGCTTGAA | Rev | ||||
| CHI | Cs7g28130 | TCCAGGATCAACAAAGTCGCA | Fw | 95 | |
| ACACTCCTATCGCCGTGAAC | Rev | ||||
| F3H | Cs1g25280 | ATGGCTCCTTCAACCCTCAC | Fw | 86 | |
| ACCTTGGGACGCTCATCTTG | Rev | ||||
| Late biosynthetic genes | DFR | Cs3g25090 | TGCGTGGAAGTTTGCTGAAG | Fw | 101 |
| TGAGACTGGGTGGCATTGAC | Rev | ||||
| ANS | Cs5g09970 | CACTTGGCTTGGGACTGGAA | Fw | 114 | |
| CCAGTTCTGGTTGAGGGCAT | Rev | ||||
| UFGT | Cs5g24820 | TGATCGGGAGGCCATTCTTT | Fw | 99 | |
| TGCAAATCCCTCCACCATCT | Rev | ||||
| Anthocyanins vacuolization | GST | Cs6g15900 | GGGACAGCTTCACATTGGC | Fw | 73 |
| CCATTCCAGCTTCGTTCAT | Rev | ||||
| Transcription factors | CsRuby1 ** | Cs6g17570 | AGCTGCTGGGCAACAGATGGT | Fw | 68 |
| CTTCACATCGTTCGCTGTTC | Rev | ||||
| Noemi *** | Cs5g31400 | CAGGAACCGGTTATGATAGGTAGC | Fw | 80 | |
| TCTGGCGTCAATTCTTCTTCCGGTG | Rev |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Catalano, C.; Ciacciulli, A.; Salonia, F.; Russo, M.P.; Caruso, P.; Caruso, M.; Russo, G.; Distefano, G.; Licciardello, C. Target-Genes Reveal Species and Genotypic Specificity of Anthocyanin Pigmentation in Citrus and Related Genera. Genes 2020, 11, 807. https://doi.org/10.3390/genes11070807
Catalano C, Ciacciulli A, Salonia F, Russo MP, Caruso P, Caruso M, Russo G, Distefano G, Licciardello C. Target-Genes Reveal Species and Genotypic Specificity of Anthocyanin Pigmentation in Citrus and Related Genera. Genes. 2020; 11(7):807. https://doi.org/10.3390/genes11070807
Chicago/Turabian StyleCatalano, Chiara, Angelo Ciacciulli, Fabrizio Salonia, Maria Patrizia Russo, Paola Caruso, Marco Caruso, Giuseppe Russo, Gaetano Distefano, and Concetta Licciardello. 2020. "Target-Genes Reveal Species and Genotypic Specificity of Anthocyanin Pigmentation in Citrus and Related Genera" Genes 11, no. 7: 807. https://doi.org/10.3390/genes11070807
APA StyleCatalano, C., Ciacciulli, A., Salonia, F., Russo, M. P., Caruso, P., Caruso, M., Russo, G., Distefano, G., & Licciardello, C. (2020). Target-Genes Reveal Species and Genotypic Specificity of Anthocyanin Pigmentation in Citrus and Related Genera. Genes, 11(7), 807. https://doi.org/10.3390/genes11070807








