Sequence Analysis and FISH Mapping of Four Satellite DNA Families among Cervidae
Abstract
1. Introduction
2. Material and Methods
2.1. Samples
2.2. Satellite DNA Isolation
2.3. Sequence Analysis
2.4. Phylogenetic Analysis of the Satellite DNAs
2.5. Fluorescence in Situ Hybridisation
3. Results
3.1. Sequence Analysis
3.2. Fluorescence in Situ Hybridisation
3.3. Outgroup FISH with satI and satII DNA in Bovidae and Cervidae
3.4. Phylogenetic Analysis of the Satellite DNAs
4. Discussion
4.1. SatI DNA
4.2. SatII DNA
4.3. Satellite III Sequences
4.4. Satellite IV Sequences
4.5. Outgroup FISH Comparisons
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wilson, D.E.; Reeder, D.M. Mammal Species of the World: A Taxonomic and Geographic Reference, 1st ed.; Johns Hopkins University Press: Baltimore, MD, USA, 2005. [Google Scholar]
- Groves, C.; Grubb, P. Ungulate Taxonomy, 1st ed.; Johns Hopkins University Press: Baltimore, MD, USA, 2011. [Google Scholar]
- Wurster, D.H.; Benirschke, K. Indian muntjac, Muntiacus muntjak: A deer with a low diploid chromosome number. Science 1970, 168, 1364–1366. [Google Scholar] [CrossRef] [PubMed]
- Nietzel, H. Chromosome evolution of cervidae: Karyotypic and molecular aspects. In Cytogenetics: Basic and Applied Aspects, 1st ed.; Obe, G., Basler, A., Eds.; Springer: Berlin/Heidelberg, Germany, 1987; pp. 90–112. [Google Scholar]
- Fontana, F.; Rubini, M. Chromosomal evolution in cervidae. Biosystems 1990, 24, 157–174. [Google Scholar] [CrossRef]
- Yang, F.; O’Brien, P.C.; Wienberg, J.; Neitzel, H.; Lin, C.C.; Ferguson-Smith, M.A. Chromosomal evolution of the Chinese muntjac (Muntiacus reevesi). Chromosoma 1997, 106, 37–43. [Google Scholar] [CrossRef] [PubMed]
- Bonnet-Garnier, A.; Claro, F.; Thévenon, S.; Gautier, M.; Hayes, H. Identification by R-banding and FISH of chromosome arms involved in Robertsonian translocations in several deer species. Chromosome Res. 2003, 11, 649–663. [Google Scholar] [CrossRef]
- Chi, J.X.; Huang, L.; Nie, W.; Wang, J.; Su, B.; Yang, F. Defining the orientation of the tandem fusions that occurred during the evolution of Indian muntjac chromosomes by BAC mapping. Chromosoma 2005, 114, 167–172. [Google Scholar] [CrossRef]
- Beridze, T. Satellite DNA; Springer: Berlin/Heidelberg, Germany, 1986. [Google Scholar]
- Modi, W.S.; Gallagher, D.S.; Womack, J.E. Evolutionary histories of highly repeated DNA families among the artiodactyla (mammalia). J. Mol. Evol. 1996, 42, 337–349. [Google Scholar] [CrossRef]
- Li, Y.C.; Lee, C.; Hseu, T.H.; Li, S.Y.; Lin, C.C.; Hsu, T.H. Direct visualization of the genomic distribution and organization of two cervid centromeric satellite DNA families. Cytogenet. Cell Genet. 2000, 89, 192–198. [Google Scholar] [CrossRef]
- Lee, C.; Court, D.R.; Cho, C.; Haslett, J.L.; Lin, C.C. Higher-order organization of subrepeats and the evolution of cervid satellite I DNA. J. Mol. Evol. 1997, 44, 327–335. [Google Scholar] [CrossRef]
- O’Neill, M.J.; O’Neill, R.J. Sex chromosome repeats tip the balance towards speciation. Mol. Ecol. 2018, 27, 3783–3798. [Google Scholar] [CrossRef]
- Buntjer, J.B.; Nijman, I.J.; Zijlstra, C.; Lenstra, J.A. A satellite DNA element specific for roe deer (Capreolus capreolus). Chromosoma 1998, 107, 1–5. [Google Scholar] [CrossRef]
- Levinson, G.; Gutman, G.A. Slipped-strand mispairing: A major mechanism for DNA sequence evolution. Mol. Biol. Evol. 1987, 4, 203–221. [Google Scholar] [PubMed]
- Charlesworth, B.; Sniegowski, P.; Stephan, W. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 1994, 371, 215–220. [Google Scholar] [CrossRef] [PubMed]
- Nijman, I.J.; Lenstra, J.A. Mutation and recombination in cattle satellite DNA: A feedback model for the evolution of satellite DNA repeats. J. Mol. Evol. 2001, 52, 361–371. [Google Scholar] [CrossRef] [PubMed]
- Jobse, C.; Buntjer, J.B.; Haagsma, N.; Breukelman, H.J.; Beintema, J.J.; Lenstra, J.A. Evolution and recombination of bovine DNA repeats. J. Mol. Evol. 1995, 41, 277–283. [Google Scholar] [CrossRef]
- Bachmann, L.; Sperlich, D. Gradual evolution of a specific satellite DNA family in Drosophila ambigua, D. tristis, and D. obscura. Mol. Biol. Evol. 1993, 10, 647–659. [Google Scholar]
- Garrido-Ramos, M.A.; de la Herrán, R.; Jamilena, M.; Lozano, R.; Ruiz Rejón, C.; Ruiz Rejón, M. Evolution of centromeric satellite DNA and its use in phylogenetic studies of the Sparidae family (Pisces, Perciformes). Mol. Phylogenet. Evol. 1999, 12, 200–204. [Google Scholar] [CrossRef]
- Li, Y.C.; Lee, C.; Sanoudou, D.; Hseu, T.H.; Li, S.Y.; Lin, C.C. Interstitial colocalization of two cervid satellite DNAs involved in the genesis of the Indian muntjac karyotype. Chromosome Res. 2000, 8, 363–373. [Google Scholar] [CrossRef]
- Slamovits, C.H.; Cook, J.A.; Lessa, E.P.; Rossi, M.S. Recurrent amplifications and deletions of satellite DNA accompanied chromosomal diversification in South American tuco-tucos (genus Ctenomys, Rodentia: Octodontidae): A phylogenetic approach. Mol. Biol. Evol. 2001, 18, 1708–1719. [Google Scholar] [CrossRef]
- Plohl, M.; Luchetti, A.; Mestrović, N.; Mantovani, B. Satellite DNAs between selfishness and functionality: Structure, genomics and evolution of tandem repeats in centromeric (hetero)chromatin. Gene 2008, 409, 72–82. [Google Scholar] [CrossRef]
- Kopecna, O.; Kubickova, S.; Cernohorska, H.; Cabelova, K.; Vahala, J.; Martinkova, N.; Rubes, J. Tribe-specific satellite DNA in non-domestic Bovidae. Chromosome Res. 2014, 22, 277–291. [Google Scholar] [CrossRef]
- Vozdova, M.; Kubickova, S.; Cernohorska, H.; Fröhlich, J.; Rubes, J. Satellite DNA sequences in Canidae and their chromosome distribution in dog and red fox. Cytogenet. Genome Res. 2016, 150, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Vozdova, M.; Kubickova, S.; Cernohorska, H.; Fröhlich, J.; Vodicka, R.; Rubes, J. Comparative study of the bush dog (Speothos venaticus) karyotype and analysis of satellite DNA sequences and their chromosome distribution in six species of Canidae. Cytogenet. Genome Res. 2019, 159, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Ugarković, D.; Plohl, M. Variation in satellite DNA profiles—Causes and effects. EMBO J. 2002, 21, 5955–5959. [Google Scholar] [CrossRef] [PubMed]
- Chaves, R.; Guedes-Pinto, H.; Heslop-Harrison, J.; Schwarzacher, T. The species and chromosomal distribution of the centromeric alpha-satellite I sequence from sheep in the tribe Caprini and other Bovidae. Cytogenet. Cell Genet. 2000, 91, 62–66. [Google Scholar] [CrossRef]
- Chaves, R.; Guedes-Pinto, H.; Heslop-Harrison, J.S. Phylogenetic relationships and the primitive X chromosome inferred from chromosomal and satellite DNA analysis in Bovidae. Proc. Biol. Sci. 2005, 272, 2009–2016. [Google Scholar] [CrossRef]
- Li, Y.-C.; Cheng, Y.-M.; Hsieh, L.-J.; Ryder, O.A.; Yang, F.; Liao, S.-J.; Hsiao, K.-M.; Tsai, F.-J.; Tsai, C.-H.; Lin, C.C. Karyotypic evolution of a novel cervid satellite DNA family isolated by microdissection from the Indian muntjac Y-chromosome. Chromosoma 2005, 114, 28–38. [Google Scholar] [CrossRef]
- Li, Y.-C.; Lin, C.-C. Cervid satellite DNA and karyotypic evolution of Indian muntjac. Genes Genomics 2012, 34, 7–11. [Google Scholar] [CrossRef]
- Hsieh, L.-J.; Cheng, Y.-M.; Wang, Y.-C.; Lin, C.-C.; Li, Y.-C. Organization and evolution of a novel cervid satellite DNA with yeast CDEI-like repeats. Zool. Stud. 2014, 53, 25. [Google Scholar] [CrossRef]
- Cernohorska, H.; Kubickova, S.; Vahala, J.; Robinson, T.J.; Rubes, J. Cytotypes of Kirk’s dik-dik (Madoqua kirkii, Bovidae) show multiple tandem fusions. Cytogenet. Genome Res. 2011, 132, 255–263. [Google Scholar] [CrossRef]
- Grant, C.E.; Bailey, T.L.; Noble, W.S. FIMO: Scanning for occurrences of a given motif. Bioinformatics 2011, 27, 1017–1018. [Google Scholar] [CrossRef]
- Płucienniczak, A.; Skowroński, J.; Jaworski, J. Nucleotide sequence of bovine 1.715 satellite DNA and its relation to other bovine satellite sequences. J. Mol. Biol. 1982, 158, 293–304. [Google Scholar] [CrossRef]
- Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
- Katoh, K.; Kuma, K.; Toh, H.; Miyata, T. MAFFT version 5: Improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33, 511–518. [Google Scholar] [CrossRef]
- Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
- Lefort, V.; Longueville, J.-E.; Gascuel, O. SMS: Smart model selection in PhyML. Mol. Biol. Evol. 2017, 34, 2422–2424. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- Revell, L.J. Phytools: An R package for phylogenetic comparative biology (and other things). Methods Ecol. Evol. 2012, 3, 217–223. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.r-project.org/ (accessed on 17 March 2020).
- Lin, C.C.; Sasi, R.; Fan, Y.S.; Chen, Z.Q. New evidence for tandem chromosome fusions in the karyotypic evolution of Asian muntjacs. Chromosoma 1991, 101, 19–24. [Google Scholar] [CrossRef]
- Cheng, Y.-M.; Li, T.-S.; Hsieh, L.-J.; Hsu, P.-C.; Li, Y.-C.; Lin, C.-C. Complex genomic organization of Indian muntjac centromeric DNA. Chromosome Res. 2009, 17, 1051–1062. [Google Scholar] [CrossRef]
- Bogenberger, J.M.; Neitzel, H.; Fittler, F. A highly repetitive DNA component common to all Cervidae: Its organization and chromosomal distribution during evolution. Chromosoma 1987, 95, 154–161. [Google Scholar] [CrossRef]
- Scherthan, H. Characterisation of a tandem repetitive sequence cloned from the deer Capreolus capreolus and its chromosomal localisation in two muntjac species. Hereditas 1991, 115, 43–49. [Google Scholar] [CrossRef]
- Denome, R.M.; O’Callaghan, B.; Luitjens, C.; Harper, E.; Bianco, R. Characterization of a satellite DNA from Antilocapra americana. Gene 1994, 145, 257–259. [Google Scholar] [CrossRef]
- Goss, R.J. Deer Antlers: Regeneration, Function and Evolution, 1st ed.; Academic Press: Cambridge, MA, USA, 1983. [Google Scholar]
- Blake, R.D.; Wang, J.Z.; Beauregard, L. Repetitive sequence families in Alces alces americana. J. Mol. Evol. 1997, 44, 509–520. [Google Scholar] [CrossRef]
- Ropiquet, A.; Gerbault-Seureau, M.; Deuve, J.L.; Gilbert, C.; Pagacova, E.; Chai, N.; Rubes, J.; Hassanin, A. Chromosome evolution in the subtribe Bovina (Mammalia, Bovidae): The karyotype of the Cambodian banteng (Bos javanicus birmanicus) suggests that Robertsonian translocations are related to interspecific hybridization. Chromosome Res. 2008, 16, 1107–1118. [Google Scholar] [CrossRef]
- Rubes, J.; Kubickova, S.; Pagacova, E.; Cernohorska, H.; Di Berardino, D.; Antoninova, M.; Vahala, J.; Robinson, T.J. Phylogenomic study of spiral-horned antelope by cross-species chromosome painting. Chromosome Res. 2008, 16, 935–947. [Google Scholar] [CrossRef]
- Louzada, S.; Vieira-da-Silva, A.; Mendes-da-Silva, A.; Kubickova, S.; Rubes, J.; Adega, F.; Chaves, R. A novel satellite DNA sequence in the Peromyscus genome (PMSat): Evolution via copy number fluctuation. Mol. Phylogenet. Evol. 2015, 92, 193–203. [Google Scholar] [CrossRef]
- Buckland, R.A.; Evans, H.J. Cytogenetic aspects of phylogeny in the Bovidae. I. G-banding. Cytogenet. Cell Genet. 1978, 21, 42–63. [Google Scholar] [CrossRef]
- Burkin, D.J.; Broad, T.E.; Jones, C. The chromosomal distribution and organization of sheep satellite I and II centromeric DNA using characterized sheep-hamster somatic cell hybrids. Chromosome Res. 1996, 4, 49–55. [Google Scholar] [CrossRef]
- Tanaka, K.; Matsuda, Y.; Masangkay, J.S.; Solis, C.D.; Anunciado, R.V.; Kuro-o, M.; Namikawa, T. Cytogenetic analysis of the tamaraw (Bubalus mindorensis): A comparison of R-banded karyotype and chromosomal distribution of centromeric satellite DNAs, telomeric sequence, and 18S-28S rRNA genes with domestic water buffaloes. J. Hered. 2000, 91, 117–121. [Google Scholar] [CrossRef][Green Version]
- Qureshi, S.A.; Blake, R.D. Sequence characteristics of a cervid DNA repeat family. J. Mol. Evol. 1995, 40, 400–404. [Google Scholar] [CrossRef]
- Li, Y.C.; Lee, C.; Chang, W.S.; Li, S.-Y.; Lin, C.C. Isolation and identification of a novel satellite DNA family highly conserved in several Cervidae species. Chromosoma 2002, 111, 176–183. [Google Scholar] [CrossRef]
- Buckland, R. Sequence and evolution of related bovine and caprine satellite DNAs. Identification of a short DNA-sequence potentially involved in satellite DNA amplification. J. Mol. Biol. 1985, 186, 25–30. [Google Scholar] [CrossRef]
- Tanaka, K.; Matsuda, Y.; Masangkay, J.S.; Solis, C.D.; Anunciado, R.V.P.; Namikawa, T. Characterization and chromosomal distribution of satellite DNA sequences of the water buffalo (Bubalus bubalis). J. Hered. 1999, 90, 418–422. [Google Scholar] [CrossRef]
- Lin, C.C.; Li, Y.C. Chromosomal distribution and organization of three cervid satellite DNAs in Chinese water deer (Hydropotes inermis). Cytogenet. Genome Res. 2006, 114, 147–154. [Google Scholar] [CrossRef]
- Frohlich, J.; Kubickova, S.; Musilova, P.; Cernohorska, H.; Muskova, H.; Vodicka, R.; Rubes, J. Karyotype relationships among selected deer species and cattle revealed by bovine FISH probes. PLoS ONE 2017, 12, e0187559. [Google Scholar] [CrossRef]
- Cerutti, F.; Gamba, R.; Mazzagatti, A.; Piras, F.M.; Cappelletti, E.; Belloni, E.; Nergadze, S.G.; Raimondi, E.; Giulotto, E. The major horse satellite DNA family is associated with centromere competence. Mol. Cytogenet. 2016, 9, 35. [Google Scholar] [CrossRef]
- Vafa, O.; Shelby, R.D.; Sullivan, K.F. CENP-A associated complex satellite DNA in the kinetochore of the Indian muntjac. Chromosoma 1999, 108, 367–374. [Google Scholar] [CrossRef]
- Carroll, C.W.; Silva, M.C.C.; Godek, K.M.; Jansen, L.E.T.; Straight, A.F. Centromere assembly requires the direct recognition of CENP-A nucleosomes by CENP-N. Nat. Cell Biol. 2009, 11, 896–902. [Google Scholar] [CrossRef]
- Schalch, T.; Steiner, F.A. Structure of centromere chromatin: From nucleosome to chromosomal architecture. Chromosoma 2017, 126, 443–455. [Google Scholar] [CrossRef]
- Escudeiro, A.; Adega, F.; Robinson, T.J.; Heslop-Harrison, J.S.; Chaves, R. Conservation, divergence, and functions of centromeric satellite DNA families in the Bovidae. Genome Biol. Evol. 2019, 11, 1152–1165. [Google Scholar] [CrossRef]
- López-Flores, I.; de la Herrán, R.; Garrido-Ramos, M.A.; Boudry, P.; Ruiz-Rejón, C.; Ruiz-Rejón, M. The molecular phylogeny of oysters based on a satellite DNA related to transposons. Gene 2004, 339, 181–188. [Google Scholar] [CrossRef]
- Plohl, M.; Meštrović, N.; Mravinac, B. Centromere identity from the DNA point of view. Chromosoma 2014, 123, 313–325. [Google Scholar] [CrossRef]
- Chaves, R.; Ferreira, D.; Mendes-da-Silva, A.; Meles, S.; Adega, F. FA-SAT is an old satellite DNA frozen in several bilateria genomes. Genome Biol. Evol. 2017, 9, 3073–3087. [Google Scholar] [CrossRef]
- Liu, Y.; Nie, W.-h.; Huang, L.; Wang, J.-h.; Su, W.-t.; Lin, C.C.; Yang, F.-t. Cloning, characterization, and FISH mapping of four satellite DNAs from black muntjac (Muntiacus crinifrons) and Fea’s muntjac (M. feae). Zoological Research 2008, 29, 225–235. [Google Scholar] [CrossRef]


| Original Sequence | Species of Origin | Primers for Amplification | Product Length (Predicted) | Annealing Temperature | |
|---|---|---|---|---|---|
| SatI | U48429.1 | Cervus elaphus | CAAGACGAAAGGATGTCTGAATCC | 727 bp | 58 oC |
| GGTGTCCATTCCACTTGAGGC | |||||
| SatII | U49916.1 | Odocoileus virginianus | CTGTGAGTGTGGAGCCCCGAGC | 580 bp | 64 oC |
| GTGGGAAGAGGCAGAGCCGACC | |||||
| SatIII | Y10686.1 | Capreolus capreolus | GAGGTGTGACCGTGACAGGACCC | 2030 bp | 64 oC |
| CGAGGCTGGGATGTTGTGAGAAGC | |||||
| SatIII-partial | C. capreolus | ACAGATGGAGAACATCCCTCTGG | 578 bp | 57 oC | |
| GTGAATACGAAAAGGACTGTGGG | |||||
| SatIV | AY064469.1 | O. hemionus | TTGATATTAGGTGATTGGATGGG | 728 bp | 57 oC |
| AAGATGTCAGAACTTCAGGTTTGC |
| Species | SatI | SatII | SatIII | SatIV | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Length (bp) | GC Content (%) | Similarity (%) | No. of 31-bp Units | Length (bp) | GC Content (%) | Similarity (%) | Length (bp) | GC Content (%) | Length (bp) | GC Content (%) | Similarity (%) | |
| CEL | 724–725 | 54 | 94–96 | 21 | 655–656 | 67 | 89–97 | 727–728 | 45 | 97 | ||
| DDA | 725–726 | 54 | 93–94 | 21 | 654–664 | 67 | 89–93 | 727 | 45 | 99 | ||
| REL | 723–725 | 54 | 96–99 | 20 | 655–657 | 68 | 95–98 | 727–728 | 46 | 98 | ||
| CAL | 724–725 | 54 | 94–100 | 20 | 655–656 | 68 | 94–97 | 726–727 | 45 | 97 | ||
| EDA | 723–725 | 55 | 93–96 | 20 | 656 | 68 | 96–98 | 727 | 46 | 100 | ||
| RTI | 725 | 55 | 94–96 | 20 | 654–656 | 67 | 93–97 | 726–727 | 46 | 97 | ||
| MRE | 904–908 | 51 | 81–93 | 27 | 588–590 | 63 | 86–99 | 727 | 44 | 99 | ||
| CCA | 909–910 | 48 | 88–98 | 21 | 578 | 63 | 96–98 | 2000 | 51 | 725 | 44 | 99 |
| AAL | 906–911 | 50 | 79–88 | 27 | 522–523 | 60 | 92–98 | 2025 | 52 | 723–724 | 45 | 96 |
| RTA | 906–911 | 53 | 82–93 | 26 | 573–577 | 65 | 87–99 | 2018 | 52 | 726–727 | 45 | 99 |
| OVI | 908–910 | 52 | 77–87 | 25 | 578–580 | 66 | 94–97 | 2073 | 52 | 726–727 | 45 | 96 |
| SatI | SatII | SatIII | SatIV | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Cervini | Muntiacini | Capreolinae | Cervini | Muntiacini | Capreolinae | Capreolinae | Cervini | Muntiacini | Capreolinae | ||
| SatI | Cervini | 88–99 | |||||||||
| Muntiacini | 77–84 | 81–93 | |||||||||
| Capreolinae | 74–81 | 75–83 | 75–86 | ||||||||
| SatII | Cervini | 86–98 | |||||||||
| Muntiacini | 78–83 | 86–99 | |||||||||
| Capreolinae | 74–85 | 74–78 | 74–88 | ||||||||
| SatIII | Capreolinae | 82–89 | |||||||||
| SatIV | Cervini | 96–99 | |||||||||
| Muntiacini | 95–97 | 99 | |||||||||
| Capreolinae | 86–97 | 85–94 | 85–95 | ||||||||
| Species | 2n | No. of Autosomes | X | SatI | SatII | SatIII | SatIV | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Ac | Bi | Ac | Bi | X | Ac | Bi | X | Ac | Bi | X | Ac | Bi | X | |||
| CEL | 68 | 64 | 2 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| DDA | 68 | 64 | 2 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| EDA | 68 | 64 | 2 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| CAL | 66 | 60 | 4 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| RTI | 60 | 48 | 10 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| REL | 58 | 44 | 12 | Ac | + | − | + | + | + | + | − | − | − | − | − | − |
| MRE | 46 | 46 | 0 | Ac | + | N | + | + | N | + | − | N | − | +/− | N | − |
| CCA | 70 | 68 | 0 | Bi | +/− | N | − | + | N | + | +/− | N | − | − | N | − |
| AAL | 68 | 62 | 4 | Bi | +/− | +/− | + | + | + | + | − | − | − | +/− | +/− | − |
| RTA | 70 | 66 | 2 | Bi | + | − | − | + | + | + | +/− | − | − | − | − | − |
| OVI | 70 | 66 | 2 | Bi | + | + | + | + | + | + | +/− | +/− | − | +/− | − | − |
| Satellite Sequence | Number of Sequences | Alignment Length (bp) | Proportion of Gaps (%) | Substitution Model | α |
|---|---|---|---|---|---|
| satI | 53 | 952 | 7.8 | GTR + Γ | 2.3 |
| satII | 51 | 707 | 6.8 | K80 + Γ | 2.7 |
| satIII | 7 | 2089 | 1.9 | K80 + Γ | 1.8 |
| satIV | 29 | 738 | 0.8 | K80 + Γ | 37.9 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vozdova, M.; Kubickova, S.; Cernohorska, H.; Fröhlich, J.; Martínková, N.; Rubes, J. Sequence Analysis and FISH Mapping of Four Satellite DNA Families among Cervidae. Genes 2020, 11, 584. https://doi.org/10.3390/genes11050584
Vozdova M, Kubickova S, Cernohorska H, Fröhlich J, Martínková N, Rubes J. Sequence Analysis and FISH Mapping of Four Satellite DNA Families among Cervidae. Genes. 2020; 11(5):584. https://doi.org/10.3390/genes11050584
Chicago/Turabian StyleVozdova, Miluse, Svatava Kubickova, Halina Cernohorska, Jan Fröhlich, Natália Martínková, and Jiri Rubes. 2020. "Sequence Analysis and FISH Mapping of Four Satellite DNA Families among Cervidae" Genes 11, no. 5: 584. https://doi.org/10.3390/genes11050584
APA StyleVozdova, M., Kubickova, S., Cernohorska, H., Fröhlich, J., Martínková, N., & Rubes, J. (2020). Sequence Analysis and FISH Mapping of Four Satellite DNA Families among Cervidae. Genes, 11(5), 584. https://doi.org/10.3390/genes11050584

