Study of the Relationship between Polymorphisms in the IL-8 Gene Promoter Region and Coccidiosis Resistance Index in Jinghai Yellow Chickens
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals
2.2. Sample Collection
2.3. DNA Extraction
2.4. Primer Design and PCR Amplification
2.5. SNP Identification
2.6. Transcription Factor Binding Site Prediction
2.7. Linkage Disequilibrium and Haplotype Analysis
2.8. Resistance Index Detection
2.9. Statistical Analysis
3. Results
3.1. Clinical Observation
3.2. SNP Identification in IL-8 Promoter
3.3. Prediction Results for Transcription Factor Changes Caused by Mutations in SNPs in the Promoter Region of the IL-8 Gene
3.4. Association Analysis of SNPs in the IL-8 Gene Promoter Region and Plasma Resistance Indexes
3.4.1. Association Analysis between Each Genotype of the T–550C Mutation and Coccidiosis
Resistance Indexes of Chickens
3.4.2. Association Analysis between Each Genotype of the G–398T Mutation and Resistance Indexes of Chicken Coccidiosis
3.4.3. Association Analysis between Each Genotype of the T–360C Mutation and Coccidiosis
Resistance Indexes of Chickens
3.5. Linkage Disequilibrium Analysis of Each Mutation Site in the IL-8 Gene Promoter Region
3.6. Haplotype Analysis and Association Analysis between Haplotype Combinations and Resistance Indexes of the IL-8 Gene Promoter Region Mutation Sites
4. Discussion
4.1. Prediction of Transcription Factor Binding Sites in the IL-8 Gene Promoter Region
4.2. Relationship between SNPs in the IL-8 Gene Promoter Region and Resistance Indexes of Chicken Coccidiosis
4.3. Linkage Disequilibrium and Haplotype Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Yu, H.; Zou, W.; Xin, S.; Wang, X.; Mi, C.; Dai, G.; Zhang, T.; Zhang, G.; Xie, K.; Wang, J.; et al. Association analysis of single nucleotide polymorphisms in the 5’ regulatory region of the IL-6 gene with Eimeria tenella resistance in Jinghai yellow chickens. Genes 2019, 10, 890. [Google Scholar] [CrossRef] [PubMed]
- Blake, D.P.; Tomley, F.M. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 2014, 30, 12–19. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zou, W.; Yu, H.; Lin, Y.; Dai, G.; Zhang, T.; Zhang, G.; Xie, K.; Wang, J.; Shi, H. RNA sequencing analysis of chicken cecum tissues following Eimeria tenella infection In Vivo. Genes 2019, 10, 420. [Google Scholar] [CrossRef] [PubMed]
- Guo, A.; Cai, J.; Gong, W.; Yan, H.; Luo, X.; Tian, G.; Zhang, S.; Zhang, H.; Zhu, G.; Cai, X. Transcriptome analysis in chicken cecal epithelia upon infection by Eimeria tenella In Vivo. PLoS ONE 2013, 8, e64236. [Google Scholar] [CrossRef]
- Jang, S.I.; Lillehoj, H.S.; Lee, S.H.; Lee, K.W.; Park, M.S.; Bauchan, G.R.; Lillehoj, E.P.; Bertrand, F.; Dupuis, L.; Deville, S. Immunoenhancing effects of Montanide™ ISA oil-based adjuvants on recombinant coccidia antigen vaccination against Eimeria acervulina infection. Vet. Parasitol. 2010, 172, 221–228. [Google Scholar] [CrossRef]
- Abdelrahman, W.; Mohnl, M.; Teichmann, K.; Doupovec, B.; Schatzmayr, G.; Lumpkins, B.; Mathis, G. Comparative evaluation of probiotic and salinomycin effects on performance and coccidiosis control in broiler chickens. Poult. Sci. 2014, 93, 3002–3008. [Google Scholar] [CrossRef]
- Abbas, R.Z.; Iqbal, Z.; Blake, D.; Khan, M.N.; Saleemi, M.K. Anticoccidial drug resistance in fowl coccidia: The state of play revisited. Worlds Poult. Sci. J. 2011, 67, 337–350. [Google Scholar] [CrossRef]
- Wallach, M. Role of antibody in immunity and control of chicken coccidiosis. Trends Parasitol. 2010, 26, 382–387. [Google Scholar] [CrossRef]
- Coussens, L.M.; Werb, Z. Inflammation and cancer. Nature 2002, 420, 860–867. [Google Scholar] [CrossRef]
- Neuschäfer-Rube, F.; Pathe-Neuschafer-Rube, A.; Hippenstiel, S.; Puschel, G.P. PGE2 enhanced TNFalphamediated IL-8 induction in monocytic cell lines and PBMC. Cytokine 2019, 113, 105–116. [Google Scholar] [CrossRef]
- Papadopoulou, C.; Corrigall, V.; Taylor, P.R.; Poston, R.N. The role of the chemokines MCP-1, GRO-alpha, IL-8 and their receptors in the adhesion of monocytic cells to human atherosclerotic plaques. Cytokine 2008, 43, 181–186. [Google Scholar] [CrossRef]
- Cornelissen, J.B.; Swinkels, W.J.; Boersma, W.A.; Rebel, J.M. Host response to simultaneous infections with Eimeria acervulina, maxima and tenella: A cumulation of single responses. Vet. Parasitol. 2009, 162, 58–66. [Google Scholar] [CrossRef] [PubMed]
- Swaggerty, C.L.; Pevzner, I.Y.; Kogut, M.H. Selection for pro-inflammatory mediators produces chickens more resistant to Eimeria tenella. Poult. Sci. 2015, 94, 37–42. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y. RNA Sequencing Analysis of Chicken Cecum Tissues Following E. tenella Infection and Coccidiosis Evaluation of Jinghai Yellow Chicken Cross-Breeding System Parents. Master’s Thesis, Yangzhou University, Yangzhou, China, 2015. [Google Scholar]
- Min, W.; Lillehoj, H.S.; Burnside, J.; Weining, K.C.; Staeheli, P.; Zhu, J.J. Adjuvant effects of IL-1β, IL-2, IL8, IL-15, IFN-α, IFN-γ, TNF-β4 and lymphotactin, on DNA vaccination against Eimeria acervulina. Vaccine 2001, 20, 267–274. [Google Scholar] [CrossRef]
- Ding, X.; Lillehoj, H.S.; Quiroz, M.A.; Bevensee, E.; Lillehoj, E.P. Protective immunity against Eimeria acervulina following in OVO immunization with a recombinant subunit vaccine and cytokine genes. Infect. Immun. 2004, 72, 6939–6944. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.X.; Yang, M.X.; Wang, Z.B.; Geng, Z.X.; Cao, G.; Li, W.H. Effects of ZHIGANTAI(ZHGT) capsule on the SOD & CAT activity and the MDA contents in the blood serum and hepatic tissue of fatty liver rat with hyperlipidemia. Chin. J. Basic Med. Tradit. Chin. Med. 2002, 8, 35–38. [Google Scholar]
- Chapman, S.J. Review of discovering statistics using IBM SPSS statistics, 4th editor. J. Pol. Sci. Educ. 2017, 14, 57–62. [Google Scholar] [CrossRef]
- Guryev, V.; Smits, B.M.; van de Belt, J.; Verheul, M.; Hubner, N.; Cuppen, E. Haplotype block structure is conserved across mammals. PLoS Genet. 2006, 2, e121. [Google Scholar] [CrossRef]
- Cui, J.X.; Du, H.L.; Liang, Y.; Deng, X.M.; Li, N.; Zhang, X.Q. Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poult. Sci. 2006, 85, 26–31. [Google Scholar] [CrossRef]
- Qiu, X.; Li, N.; Deng, X.; Zhao, X.; Meng, Q.; Wang, X. The single nucleotide polymorphisms of chicken melanocortin-4 receptor (MC4R) gene and their association analysis with carcass traits. Sci. China C Life Sci. 2006, 49, 560–566. [Google Scholar] [CrossRef]
- Xin, S.; Wang, X.; Dai, G.; Zhang, J.; An, T.; Zou, W.; Zhang, G.; Xie, K.; Wang, J. Bioinformatics analysis of SNPs in IL-6 gene promoter of Jinghai yellow chickens. Genes 2018, 9, 446. [Google Scholar] [CrossRef] [PubMed]
- Korkaya, H.; Liu, S.; Wicha, M.S. Regulation of cancer stem cells by cytokine networks: Attacking cancer’s inflammatory roots. Clin. Cancer Res. 2011, 17, 6125–6129. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.P.; Cao, C.; Wu, Y.F.; Li, M.; Lai, T.W.; Zhu, C.; Wang, Y.; Ying, S.M.; Chen, Z.H.; Shen, H.H.; et al. Activating transcription factor 3 represses cigarette smoke-induced IL6 and IL8 expression via suppressing NF-kappaB activation. Toxicol. Lett. 2017, 270, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.; Fan, F.; Fan, W.; Zhao, H.; Tong, T.; Blanck, P.; Alomo, I.; Rajasekaran, B.; Zhan, Q. Transcription factors Oct-1 and NF-YA regulate the p53-independent induction of the GADD45 following DNA damage. Oncogene 2001, 20, 2683–2690. [Google Scholar] [CrossRef] [PubMed]
- Pabst, T.; Mueller, B.U.; Zhang, P.; Radomska, H.S.; Narravula, S.; Schnittger, S.; Behre, G.; Hiddemann, W.; Tenen, D.G. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat. Genet. 2001, 27, 263–270. [Google Scholar] [CrossRef] [PubMed]
- Ohta, K.; Nobukuni, Y.; Mitsubuchi, H.; Ohtab, T.; Tohmab, T.; Jinno, Y.; Endo, F.; Matsuda, I. Characterization of the gene encoding human pituitary-specific transcription factor, Pit-1. Gene 1992, 122, 387–388. [Google Scholar] [CrossRef]
- Georgieva, N.V.; Koinarski, V.; Gadjeva, V. Antioxidant status during the course of Eimeria tenella infection in broiler chickens. Vet. J. 2006, 172, 488–492. [Google Scholar] [CrossRef]
- Lillehoj, H.S.; Ding, X.; Quiroz, M.A.; Bevensee, E.; Lillehoj, E.P. Resistance to intestinal coccidiosis following DNA immunization with the cloned 3-1E Eimeria gene plus IL-2, IL-15, and IFN-gamma. Avian. Dis. 2005, 49, 112–117. [Google Scholar] [CrossRef]
- Boyman, O.; Kovar, M.; Rubinstein, M.P.; Surh, C.D.; Sprent, J. Selective stimulation of T cell subsets with antibody-cytokine immune complexes. Science 2006, 311, 1924–1927. [Google Scholar] [CrossRef]
- Johnson, G.C.; Esposito, L.; Barratt, B.J.; Smith, A.N.; Heward, J.; Di Genova, G.; Ueda, H.; Cordell, H.J.; Eaves, I.A.; Dudbridge, F.; et al. Haplotype tagging for the identification of common disease genes. Nat. Genet. 2001, 29, 233–237. [Google Scholar] [CrossRef]
- Wang, S.; He, S.; Yuan, F.; Zhu, X. Tagging SNP-set selection with maximum information based on linkage disequilibrium structure in genome-wide association studies. Bioinformatics 2017, 33, 2078–2081. [Google Scholar] [CrossRef] [PubMed]
- Horne, B.D.; Camp, N.J. Principal component analysis for selection of optimal SNP-sets that capture intragenic genetic variation. Genet. Epidemiol. 2004, 26, 11–21. [Google Scholar] [CrossRef] [PubMed]







| Primer | Primers Sequence (5′→3′) | Annealing Temperature | Length (bp) |
|---|---|---|---|
| P1 | F: TTCCATTCGCATAAGTCATC R: AAAGTTGATTTGGGGATACC | 51 °C | 638 |
| P2 | F: TGTAATTGGGAATTCAAGGGGGA R: CCCATTTGGTGTGTGATAAGATGA | 58 °C | 708 |
| P3 | F: AGTCCACAGACCACAAAGCA R: TCGCAATATAAGTTTCTGATGGCTT | 58 °C | 693 |
| P4 | F: AAACCAGCAACACAAAGTC R: CATCTCAGCAAGTGCCAAG | 60 °C | 574 |
| Mutation Site | Base | Transcription Factor | Transcription Factor Binding Site Base Sequence | Transcription Factor Position |
|---|---|---|---|---|
| −550 | T C | Oct-1 | gttgcatttg | −551~−542 |
| −398 | G | C/EBPalp | gaaataaata | −398~−389 |
| T | Pit-1a | taaataaata | −398~−389 | |
| C/EBPalp | acataaataa | −401~−392 | ||
| −360 | T C | NF-1 | agccagttat | −362~−353 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.-H.; Yu, H.-L.; Zou, W.-B.; Mi, C.-H.; Dai, G.-J.; Zhang, T.; Zhang, G.-X.; Xie, K.-Z.; Wang, J.-Y. Study of the Relationship between Polymorphisms in the IL-8 Gene Promoter Region and Coccidiosis Resistance Index in Jinghai Yellow Chickens. Genes 2020, 11, 476. https://doi.org/10.3390/genes11050476
Wang X-H, Yu H-L, Zou W-B, Mi C-H, Dai G-J, Zhang T, Zhang G-X, Xie K-Z, Wang J-Y. Study of the Relationship between Polymorphisms in the IL-8 Gene Promoter Region and Coccidiosis Resistance Index in Jinghai Yellow Chickens. Genes. 2020; 11(5):476. https://doi.org/10.3390/genes11050476
Chicago/Turabian StyleWang, Xiao-Hui, Hai-Liang Yu, Wen-Bin Zou, Chang-Hao Mi, Guo-Jun Dai, Tao Zhang, Gen-Xi Zhang, Kai-Zhou Xie, and Jin-Yu Wang. 2020. "Study of the Relationship between Polymorphisms in the IL-8 Gene Promoter Region and Coccidiosis Resistance Index in Jinghai Yellow Chickens" Genes 11, no. 5: 476. https://doi.org/10.3390/genes11050476
APA StyleWang, X.-H., Yu, H.-L., Zou, W.-B., Mi, C.-H., Dai, G.-J., Zhang, T., Zhang, G.-X., Xie, K.-Z., & Wang, J.-Y. (2020). Study of the Relationship between Polymorphisms in the IL-8 Gene Promoter Region and Coccidiosis Resistance Index in Jinghai Yellow Chickens. Genes, 11(5), 476. https://doi.org/10.3390/genes11050476

