Methylation Analysis of CpG Islands in Pineapple SERK1 Promoter
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Gene Expression Analysis
2.3. Methylation Analysis of the AcSERK1 Promoter Region
97 °C Pre-denaturation | 7 min |
Hot-start Taq enzyme (5U·μL−1) | 0.55 μL |
97 °C Pre-denaturation | 7 min |
95 °C 1 min, 55 °C 1 min, 72 °C 1 min | 10 cycles |
95 °C 1 min, 53 °C 1 min, 72 °C 1 min | 10 cycles |
95 °C 1 min, 50 °C 1 min, 72 °C 1 min | 10 cycles |
95 °C 1 min, 48 °C 1 min, 72 °C 1 min | 10 cycles |
72 °C Extension | 10 min |
2.4. Methylation Inhibitor Pretreatment before Somatic Embryogenesis Induction
3. Results
3.1. Methylation Analysis of CpG Islands in the AcSERK1 Promoter Region
3.2. Effect of Methylation on the Expression of AcSERK1
3.3. Effect of Methylation Inhibition on SE in Pineapple
4. Discussion
Author Contributions
Funding
Conflicts of Interest
References
- Sripaoraya, S.; Marchant, R.; Power, J.B.; Davey, M.R. Plant regeneration by somatic embryogenesis and organogenesis in commercial pineapple (Ananas comosus L.). In Vitro Cell. Dev. Biol. Plant 2003, 39, 450–454. [Google Scholar] [CrossRef]
- Gaj, M.D. Factors Influencing Somatic Embryogenesis Induction and Plant Regeneration with Particular Reference to Arabidopsis thaliana (L.) Heynh. Plant Growth Regul. 2004, 43, 27–47. [Google Scholar] [CrossRef]
- Lotan, T.; Ohto, M.A.; Yee, K.M.; West, M.A.; Lo, R.; Kwong, R.W.; Yamagishi, K.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 1998, 93, 1195–1205. [Google Scholar] [CrossRef] [Green Version]
- Stone, S.L.; Kwong, L.W.; Yee, K.M. LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc. Natl. Acad. Sci. USA 2001, 98, 11806–11811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harding, E.W.; Tang, W.; Nichols, K.W. Expression and maintenance of embryogenic potential is enhanced through constitutive expression of AGAMOUS-Like 15. Plant Physiol. 2003, 133, 653–663. [Google Scholar] [CrossRef] [Green Version]
- Boutilier, K.; Offringa, R.; Sharma, V.K. Ectopic expression of BABY BOOM triggers a conversion from vegetative to embryonic growth. Plant Cell 2002, 14, 1737–1749. [Google Scholar] [CrossRef] [Green Version]
- Zuo, J.; Niu, Q.W.; Frugis, G. The WUSCHEL gene promotes vegetative-to-embryonic transition in Arabidopsis. Plant J. 2002, 30, 349–359. [Google Scholar] [CrossRef]
- Schmidt, E.D.; Guzzo, F.; Toonen, M.A. A leucine-rich repeat containing receptor-like kinase marks somatic plant cells competent to form embryos. Development 1997, 124, 2049–2062. [Google Scholar]
- Thomas, C.; Meyer, D.; Himber, C. Spatial expression of a sunflower SERK gene during induction of somatic embryogenesis and shoot organogenesis. Plant Physiol. Biochem. 2004, 42, 35–42. [Google Scholar] [CrossRef]
- Brandt, B.; Hothorn, M. SERK co-receptor kinases. Curr. Biol. 2016, 26, 225–226. [Google Scholar] [CrossRef] [Green Version]
- Fan, M.; Wang, M.; Bai, M.Y. Diverse roles of SERK family genes in plant growth, development and defense response. Sci. China Life Sci. 2016, 59, 889–896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, J.; He, Y.; Wu, C.; Liu, H.; Hu, Z.; Sun, G. Cloning and Molecular Characterization of a SERK Gene Transcriptionally Induced during Somatic Embryogenesis in Ananas comosus cv. Shenwan. Plant Mol. Biol. Rep. 2012, 30, 195–203. [Google Scholar] [CrossRef]
- Rocha, D.I.; Pinto, D.L.; Vieira, L.M.; Tanaka, F.A.; Dornelas, M.C.; Otoni, W.C. Cellular and molecular changes associated with competence acquisition during passion fruit somatic embryogenesis: Ultrastructural characterization and analysis of SERK gene expression. Protoplasma 2016, 253, 595–609. [Google Scholar] [CrossRef] [PubMed]
- Hecht, V.; Vielle-Calzada, J.P.; Hartog, M.V.; Boutilier, K.; Grossniklaus, U.; Vries, S.C.D. The Arabidopsis SOMATIC EMBRYOGENESIS RECEPTOR KINASE 1 Gene Is Expressed in Developing Ovules and Embryos and Enhances Embryogenic Competence in Culture. Plant Physiol. 2001, 127, 803–816. [Google Scholar] [CrossRef]
- Yamamuro, C.; Zhu, J.K.; Yang, Z. Epigenetic modifications and plant hormone action. Mol. Plant. 2016, 9, 57–70. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Zhang, X. Regulation of somatic embryogenesis in higher plants. Crit. Rev. Plant Sci. 2010, 29, 36–57. [Google Scholar] [CrossRef]
- Rezaul, K.; Yew, S.T.; Pooja, S.; Norzulaani, K.; Jennifer, A.H. Expression and DNA methylation of SERK, BBM, LEC2 and WUS genes in in vitro cultures of Boesenbergia rotunda (L.). Mansf. Physiol. Mol. Biol. Plants 2018, 24, 741–751. [Google Scholar]
- He, Y.H.; Luo, J.; Wu, H.T.; Wang, R.X.; Gao, A.P.; Zhao, C.X.; Yu, X.L.; Ye, Z.X.; Wang, Z.H.; Hang, J.Z.; et al. Somatic embryogenesis from leaf base callus of Ananas comosus. J. Fruit Sci. 2007, 24, 59–63. (In Chinese) [Google Scholar]
- Christman, J.K. 5-Azacytidine and 5-aza-2′-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene 2002, 21, 5483–5495. [Google Scholar] [CrossRef] [Green Version]
- Fehér, A. Somatic embryogenesis—Stress-induced remodeling of plant cell fate. Biochim. Biophys. Acta Gene Regul. Mech. 2015, 1849, 385–402. [Google Scholar] [CrossRef]
- Fortes, A.M.; Testillano, P.S.; Del, C.R.M.; Pais, M.S. Studies on callose and cutin during the expression of competence and determination for organogenic nodule formation from internodes of Humulus lupulus var. Nugget. Physiol. Plant 2002, 116, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Testillano, P.S.; Risueño, M.C. Tracking Gene and Protein Expression During Microspore Embryogenesis by Confocal Laser Scanning Microscopy. In Advances in Haploid Production in Higher Plants; Springer: Dordrecht, The Netherlands, 2009; pp. 339–347. [Google Scholar]
- El-Tantawy, A.A.; Solís, M.T.; Costa, M.L.D.; Coimbra, S.; Risueño, M.C.; Testillano, P.S. Arabinogalactan protein profiles and distribution patterns during microspore embryogenesis and pollen development in Brassica napus. Plant Reprod. 2013, 26, 231–243. [Google Scholar] [CrossRef]
- Smertenko, A.; Bozhkov, P.V. Somatic embryogenesis: life and death processes during apical-basal patterning. J. Exp. Bot. 2014, 65, 1343–1360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valledor, L.; Hasbún, R.; Meijón, M.; Rodríguez, J.L.; Santamaría, E.; Viejo, M.; Berdasco, M.; Feito, I.; Fraga, F.M.; Rodríguez, R.; et al. Involvement of DNA methylation in tree development and micropropagation. Plant Cell Tissue Organ Cult. 2007, 91, 75–86. [Google Scholar] [CrossRef] [Green Version]
- Viejo, M.; Rodríguez, R.; Valledor, L.; Pérez, M.; Cañal, M.J.; Hasbún, R. DNA methylation during sexual embryogenesis and implications on the induction of somatic embryogenesis in Castanea sativa Miller. Sex. Plant Reprod. 2010, 23, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Solís, M.; Rodríguezserrano, M.; Meijón, M.; Cifuentes, A.; Risueño, M.C.; Testillano, P.S. DNA methylation dynamics and MET1a-like gene expression changes during stress-induced pollen reprogramming to embryogenesis. J. Exp. Bot. 2012, 63, 6431–6444. [Google Scholar] [CrossRef] [PubMed]
- El-Tantawy, A.A.; Solís, M.T.; Risueño, M.C.; Testillano, P.S. Changes in DNA Methylation Levels and Nuclear Distribution Patterns after Microspore Reprogramming to Embryogenesis in Barley. Cytogenet. Genome Res. 2014, 143, 200–208. [Google Scholar] [CrossRef] [Green Version]
- Rodríguezsanz, H.; Morenoromero, J.; Solís, M.; Köhler, C.; Risueño, M.C.; Testillano, P.S. Changes in histone methylation and acetylation during microspore reprogramming to embryogenesis occur concomitantly with BnHKMT and BnHAT expression and are associated with cell totipotency, proliferation, and differentiation in Brassica napus. Cytogenet. Genome Res. 2014, 143, 209–218. [Google Scholar] [CrossRef] [Green Version]
- Karasawa, K.; Tanigawa, K.; Harada, A.; Yamashita, A. Transcriptional regulation of acyl-coa:Glycerol-sn-3-phosphate acyltransferases. Int. J. Mol. Sci. 2019, 20, 964. [Google Scholar] [CrossRef] [Green Version]
- Solís, M.; Eltantawy, A.A.; Cano, V.; Risueño, M.C.; Testillano, P.S. 5-azacytidine promotes microspore embryogenesis initiation by decreasing global DNA methylation, but prevents subsequent embryo development in rapeseed and barley. Front. Plant Sci. 2014, 6, 472. [Google Scholar] [CrossRef] [Green Version]
- Corredoira, E.; Cano, V.; Bárány, I.; Solís, M.-T.; Rodríguez, H.; Vieitez, A.-M.; Risueño, M.C.; Testillano, P.S. Initiation of leaf somatic embryogenesis involves high pectin esterification, auxin accumulation and DNA demethylation in Quercus alba. J. Plant Physiol. 2017, 213, 42–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luan, A.P.; He, Y.H.; Guo, C.H.; Mao, Q.; Xie, T.; Gong, X.; Chen, C.J. Effect of methylation inhibitors in the synchronized regulation of pineapple SE. Acta Hortic. Sin. 2015, 42, 2649. [Google Scholar]
- Nozomi, Y.; Hatsumi, K.; Takashi, T.; Yukiko, M. Formation of embryogenic cell clumps from carrot epidermal cells is suppressed by 5-azacytidine, a DNA methylation inhibitor. J. Plant Physiol. 2005, 162, 47–54. [Google Scholar]
- Luan, A.; He, Y.; Xie, T.; Chen, C.; Mao, Q.; Wang, X.; Li, C.; Ding, Y.; Lin, W.; Xia, J.; et al. Identification of an Embryonic Cell-Specific Region within the Pineapple SERK1 Promoter. Genes 2019, 10, 883. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence | References |
---|---|---|
AcSERK1F | 5′-AACCGTTCTACTTTACTGGCTTTGG-3′ | Ma et al., 2012 [12] |
AcSERK1R | 5′-GCATCTCTTCAGCGTAAGGGTAAT-3′ | |
β-actinF | 5′-CTGGCCTACGTGGCACTTGACTT-3′ | |
β-actinR | 5′-CACTTCTGGGCAGCGGAACCTTT-3′ |
CpG Island | Forward | Reverse | Product Size |
---|---|---|---|
CpG-1 | AAAAAGAAGATATTTGGGAACTTTTG | CTAATTTATTTCTTTATTATCTTCTT | 392 bp |
CpG-2 | GGGGGAAAAAAGTAGAAG | CATTGCCGCCGCCGCGAGCTCCGCCG | 292 bp |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luan, A.; Chen, C.; Xie, T.; He, J.; He, Y. Methylation Analysis of CpG Islands in Pineapple SERK1 Promoter. Genes 2020, 11, 425. https://doi.org/10.3390/genes11040425
Luan A, Chen C, Xie T, He J, He Y. Methylation Analysis of CpG Islands in Pineapple SERK1 Promoter. Genes. 2020; 11(4):425. https://doi.org/10.3390/genes11040425
Chicago/Turabian StyleLuan, Aiping, Chengjie Chen, Tao Xie, Junhu He, and Yehua He. 2020. "Methylation Analysis of CpG Islands in Pineapple SERK1 Promoter" Genes 11, no. 4: 425. https://doi.org/10.3390/genes11040425
APA StyleLuan, A., Chen, C., Xie, T., He, J., & He, Y. (2020). Methylation Analysis of CpG Islands in Pineapple SERK1 Promoter. Genes, 11(4), 425. https://doi.org/10.3390/genes11040425