MiR-4334-5p Facilitates Foot and Mouth Disease Virus Propagation by Suppressing Interferon Pathways via Direct Targeting ID1
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Reagents
2.2. Virus and Viral Challenge Assays
2.3. MiRNA Extraction and Quantification
2.4. Transfection and Luciferase Reporter Assay
2.5. Quantitative Real-Time PCR
2.6. Enzyme-Linked Immunosorbent Assay
2.7. Western Blotting
2.8. Bioinformatics Analysis
2.9. Statistics Analysis
3. Results
3.1. MiR-4334-5p Expression Was Induced by FMDV
3.2. FMDV Replication Was Up-Regulated by miR-4334-5p Mimics
3.3. FMDV Replication Was down-Regulated by miR-4334-5p Inhibitors
3.4. Bioinformatics Analysis Demonstrated miR-4334-5p Participated in Interferon Regulation
3.5. miR-4334-5p Directly Targets the 3′-UTR of ID1 Gene
3.6. The Interferon and Antiviral Genes Expression Was Suppressed by miR-4334-5p via Targeting ID1
4. Discussions
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Grubman, M.J.; Baxt, B. Foot-and-mouth disease. Clin. Microbiol. Rev. 2004, 17, 465–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, L.; Wang, K.; Chen, H.; Liu, X.; Lv, J.; Hou, S.; Zhang, Y.; Sun, Y. Host microRNA miR-1307 suppresses foot-and-mouth disease virus replication by promoting VP3 degradation and enhancing innate immune response. Virology 2019, 535, 162–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Z.; Li, C.; Du, X.; Wang, G.; Cao, W.; Yang, F.; Feng, H.; Zhang, X.; Shi, Z.; Liu, H.; et al. Foot-and-mouth disease virus infection inhibits LGP2 protein expression to exaggerate inflammatory response and promote viral replication. Cell Death Dis. 2017, 8, e2747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Los Santos, T.; De Avila Botton, S.; Weiblen, R.; Grubman, M.J. The leader proteinase of foot-and-mouth disease virus inhibits the induction of β interferon mRNA and blocks the host innate immune response. J. Virol. 2006, 80, 1906–1914. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Yang, W.; Yang, F.; Liu, H.; Zhu, Z.; Lian, K.; Lei, C.; Li, S.; Liu, X.; Zheng, H.; et al. The VP3 structural protein of foot-and-mouth disease virus inhibits the IFN-β signaling pathway. FASEB J. 2016, 30, 1757–1766. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Fang, L.; Li, K.; Zhong, H.; Fan, J.; Ouyang, C.; Zhang, H.; Duan, E.; Luo, R.; Zhang, Z.; et al. Foot-and-mouth disease virus 3C protease cleaves NEMO to impair innate immune signaling. J. Virol. 2012, 86, 9311–9322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cui, H.; Zhang, C.; Zhao, Z.; Zhang, C.; Fu, Y.; Li, J.; Chen, G.; Lai, M.; Li, Z.; Dong, S.; et al. Identification of cellular microRNA miR-188-3p with broad-spectrum anti-influenza A virus activity. Virol. J. 2020, 17, 12. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Jiang, Y.; Xu, X.; Su, X.; Liu, Y.; Ma, Y.; Zhao, Y.; Shen, Z.; Huang, B.; Cao, X. Inducible degradation of lncRNA Sros1 promotes IFN-γ-mediated activation of innate immune responses by stabilizing Stat1 mRNA. Nat. Immunol. 2019, 20, 1621–1630. [Google Scholar] [CrossRef] [Scilit]
- Grishok, A.; Pasquinelli, A.E.; Conte, D.; Li, N.; Parrish, S.; Ha, I.; Baillie, D.L.; Fire, A.; Ruvkun, G.; Mello, C.C. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell Death Dis 2001, 106, 23–34. [Google Scholar] [CrossRef] [Scilit]
- Song, X.; Li, Y.; Cao, X.; Qi, Y. MicroRNAs and Their Regulatory Roles in Plant-Environment Interactions. Annu. Rev. Plant. Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef] [Scilit]
- Fang, Z.; Rajewsky, N. The impact of miRNA target sites in coding sequences and in 3′UTRs. PLoS ONE 2011, 6, e18067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, B.W.; Hung, J.H.; Weng, Z.; Zamore, P.D.; Ameres, S.L. The 3′-to-5′ exoribonuclease Nibbler shapes the 3′ ends of microRNAs bound to Drosophila Argonaute1. Curr. Biol. 2011, 21, 1878–1887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, Y.C.; Huang, Y.F.; Wu, Y.W.; Chen, H.F.; Wu, Y.H.; Hsu, C.C.; Hsu, Y.C.; Lee, J.C. MicroRNA-155 inhibits dengue virus replication by inducing heme oxygenase-1-mediated antiviral interferon responses. FASEB J. 2020, 34, 7283–7294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Cao, J.; Zhang, S.; Sun, L.; Nan, Y.; Yao, H.; Fan, J.; Zhu, L.Y.; Yu, L. MicroRNA-802 induces hepatitis B virus replication and replication through regulating SMARCE1 expression in hepatocellular carcinoma. Cell Death Dis. 2019, 10, 783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gutkoska, J.; LaRocco, M.; Ramirez-Medina, E.; de Los Santos, T.; Lawrence, P. Host microRNA-203a Is antagonistic to the progression of foot-and-mouth disease virus infection. Virology 2017, 504, 52–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, T.; Wang, Y.; Chen, H.; Wang, K.; Gao, X.; Liu, L.; Zhang, Y.; Sun, Y. MicroRNA-4331-5p promotes FMDV replication through inhibiting interferon pathways in PK-15 cells. Virus Res. 2020, 286, 198064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasorella, A.; Benezra, R.; Iavarone, A. The ID proteins: Master regulators of cancer stem cells and tumour aggressiveness. Nat. Rev. Cancer 2014, 14, 77–91. [Google Scholar] [CrossRef] [Scilit]
- Schwarzenbach, H.; da Silva, A.M.; Calin, G.; Pantel, K. Data Normalization Strategies for MicroRNA Quantification. Clin. Chem. 2015, 61, 1333–1342. [Google Scholar] [CrossRef] [Scilit]
- Jensen, S.; Thomsen, A.R. Sensing of RNA viruses: A review of innate immune receptors involved in recognizing RNA virus invasion. J. Virol. 2012, 86, 2900–2910. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Li, Z.; Huang, J.; Chen, S.; Yin, H.; Tian, J.; Qu, L. miR-101 inhibits feline herpesvirus 1 replication by targeting cellular suppressor of cytokine signaling 5 (SOCS5). Vet. Microbiol. 2020, 245, 108707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Chen, L.; Du, J.; Hu, X.; Xie, Y.; Wu, J.; Lin, X.; Yin, N.; Sun, M.; Li, H. MicroRNA-7 Inhibits Rotavirus Replication by Targeting Viral NSP5 In Vivo and In Vitro. Viruses 2020, 12, 209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Shen, A.; Rider, P.J.; Yu, Y.; Wu, K.; Mu, Y.; Hao, Q.; Liu, Y.; Gong, H.; Zhu, Y.; et al. A liver-specific microRNA binds to a highly conserved RNA sequence of hepatitis B virus and negatively regulates viral gene expression and replication. FASEB J. 2011, 25, 4511–4521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.; Feng, P.; Gu, T. MicroRNA-21-3p modulates FGF2 to facilitate influenza A virus H5N1 replication by refraining type I interferon response. Biosci. Rep. 2020, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Feng, L.; Li, J.; Xu, H.; Mei, X.; Feng, L.; Sun, H.; Gao, J.; Zhang, X. miR-545 promoted enterovirus 71 replication via directly targeting phosphatase and tensin homolog and tumor necrosis factor receptor-associated factor 6. J. Cell Physiol. 2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basagoudanavar, S.H.; Ranjitha, H.B.; Hosamani, M.; Kolangath, S.M.; Selvan, R.P.T.; Sreenivasa, B.P.; Saravanan, P.; Sanyal, A.; Venkataramanan, R. Efficient inhibition of foot-and-mouth disease virus replication in vitro by artificial microRNA targeting 3D polymerase. Acta Virol. 2019, 63, 475–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drew, T.W. The emergence and evolution of swine viral diseases: To what extent have husbandry systems and global trade contributed to their distribution and diversity? Rev. Sci. Tech. 2011, 30, 95–106. [Google Scholar] [CrossRef] [Scilit]
- Jopling, C.L. Targeting microRNA-122 to Treat Hepatitis C Virus Infection. Viruses 2010, 2, 1382–1393. [Google Scholar] [CrossRef] [Scilit]





| Oligo | Sequence (5′-3′) |
|---|---|
| ssc-miR-4334-5p-mimics-sense | CCCUGGAGUGACGGGGGUG |
| ssc-miR-4334-5p-mimics-anti-sense | CCCCCGUCACUCCAGGGUU |
| ssc-miR-4334-5p-scramble-mimics-sense | GGUGGCGCGUCGAGCGUGA |
| ssc-miR-4334-5p-scramble-mimics-anti-sense | ACGCUCGACGCGCCACCUU |
| ssc-miR-4334-5p- Inhibitor | CACCCCCGUCACUCCAGGG |
| ssc-miR-4334-5p- Scramble-Inhibitor | CCACGGUCGACACCGCCUC |
| ssc-miR-4334-5p-F | CCCTGGAGTGACGGGGGTG |
| miR-16-F | GCAGTAGCAGCACGTA |
| Primer | Sequence (5′-3′) | |
|---|---|---|
| ID1-3′-UTR-Glo primer | GLO-ID1-NheI-sense | CTAGCTAGCAGCGCCGCCCTTGGGGACCTG |
| GLO-ID1-SalI-anti-sense | GCGTCGACTACCAACATCTAAGGCATTT | |
| ID1-3′-UTR- mutant primer | Sense | TGGGGGCAGTGAGGTCCCGGCGAGAG |
| Anti-sense | GGGACCTCACTGCCCCCACCGCAGGT | |
| Primers | Sequence (5′-3′) |
|---|---|
| FMDV-VP1-F | GACAACACCACCAACCCA |
| FMDV-VP1-R | CCTTCTGAGCCAGCACTT |
| sscISG54-F | CTGGCAAAGAGCCCTAAGGA |
| sscISG54-R | CTCAGAGGGTCAATGGAATTCC |
| sscTNFα-F | CGTTGTAGCCAATGTCAAAGCC |
| sscTNFα-R | TGCCCAGATTCAGCAAAGTCCA |
| sscOAS-F | AAGCATCAGAAGCTTTGCATCTT |
| sscOAS-R | CAGGCCTGGGTTTCTTGAGTT |
| sscIFN-β-F | GCTAACAAGTGCATCCTCCAAA |
| sscIFN-β-R | AGCACATCATAGCTCATGGAAAGA |
| sscID1-F | GAGTTGGAGCTGAACTCGGAA |
| sscID1-R | ACACAAGATGCGATCGTCCG |
| β-actin-F | GCTGGCCGGGACCTGACAGACTACC |
| β-actin-R | TCTCCAGGGAGGAAGAGGATGCGGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Ren, T.; Chen, H.; Wang, K.; Zhang, Y.; Liu, L.; Sun, Y. MiR-4334-5p Facilitates Foot and Mouth Disease Virus Propagation by Suppressing Interferon Pathways via Direct Targeting ID1. Genes 2020, 11, 1136. https://doi.org/10.3390/genes11101136
Wang Y, Ren T, Chen H, Wang K, Zhang Y, Liu L, Sun Y. MiR-4334-5p Facilitates Foot and Mouth Disease Virus Propagation by Suppressing Interferon Pathways via Direct Targeting ID1. Genes. 2020; 11(10):1136. https://doi.org/10.3390/genes11101136
Chicago/Turabian StyleWang, Yanxue, Tingting Ren, Haotai Chen, Kailing Wang, Yongguang Zhang, Lei Liu, and Yuefeng Sun. 2020. "MiR-4334-5p Facilitates Foot and Mouth Disease Virus Propagation by Suppressing Interferon Pathways via Direct Targeting ID1" Genes 11, no. 10: 1136. https://doi.org/10.3390/genes11101136
APA StyleWang, Y., Ren, T., Chen, H., Wang, K., Zhang, Y., Liu, L., & Sun, Y. (2020). MiR-4334-5p Facilitates Foot and Mouth Disease Virus Propagation by Suppressing Interferon Pathways via Direct Targeting ID1. Genes, 11(10), 1136. https://doi.org/10.3390/genes11101136
