A Useful SNP Panel to Distinguish Two Cockle Species, Cerastoderma edule and C. glaucum, Co-Occurring in Some European Beds, and Their Putative Hybrids
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples for Genomic 2b Restriction Site-Associated DNA Sequencing (2b–RAD) Libraries
2.2. DNA Extraction and Single Nucleotide Polymorphisms Calling and Genotyping
2.3. Validation of Diagnostic Single Nucleotide Polymorphisms
3. Results and Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Malham, S.K.; Hutchinson, T.H.; Longshaw, M. A review of the biology of European cockles (Cerastoderma spp.). J. Mar. Biol. Assoc. UK 2012, 92, 1563–1577. [Google Scholar] [CrossRef]
- Food and Agriculture Organization of the United Nations (FAO). Statistics. Available online: http://www.fao.org/fishery/statistics/global-production/en (accessed on 20 August 2019).
- Donadi, S.; van der Heide, T.; van der Zee, E.M.; Eklöf, J.S.; de Koppel, J.V.; Weerman, E.J.; Piersma, T.; Olff, H.; Eriksson, B.K. Cross-habitat interactions among bivalve species control community structure on intertidal flats. Ecology 2013, 94, 489–498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Villalba, A.; Iglesias, D.; Ramilo, A.; Darriba, S.; Parada, J.M.; No, E.; Abollo, E.; Molares, J.; Carballal, M.J. Cockle Cerastoderma edule fishery collapse in the Ría de Arousa (Galicia, NW Spain) associated with the protistan parasite Marteilia cochillia. Dis. Aquat. Org. 2014, 109, 55–80. [Google Scholar] [CrossRef] [PubMed]
- Carrasco, N.; Hine, P.M.; Durfort, M.; Andree, K.B.; Malchus, N.; Lacuesta, B.; González, M.; Roque, A.; Rodgers, C.; Furones, M.D. Marteilia cochillia sp. nov., a new Marteilia species affecting the edible cockle Cerastoderma edule in European Waters. Aquaculture 2013, 412–413, 223–230. [Google Scholar] [CrossRef]
- Carballal, M.J.; Iglesias, D.; Darriba, S.; Cao, A.; Mariño, J.C.; Ramilo, A.; No, E.; Villalba, A. Parasites, pathological conditions and resistance to Marteilia cochillia in lagoon cockle Cerastoderma glaucum from Galicia (NW Spain). Dis. Aquat. Org. 2016, 122, 137–152. [Google Scholar] [CrossRef] [PubMed]
- Brock, V. Genetic relations between the bivalves Cardium (Cerastoderma) edule, Cardium lamarcki and Cardium glaucum, studied by means of crossed immunoelectrophoresis. Mar. Biol. 1987, 93, 493–498. [Google Scholar] [CrossRef]
- Ladhar-Chaabouni, R.; Hamza-Chaffai, A.; Hardivillier, Y.; Chénais, B.; Denis, F. A pilot study of genetic differentiation between two phenotypes of a Mediterranean population of the bivalve Cerastoderma glaucum and genetic discrimination with other Cerastoderma glaucum and Cerastoderma edule populations outside the Mediterranean. Mar. Ecol. 2010, 31, 355–363. [Google Scholar] [CrossRef]
- Sromek, L.; Forcioli, D.; Lasota, R.; Furla, P.; Wolowicz, M. Next-generation phylogeography of the cockle Cerastoderma glaucum: Highly heterogeneous genetic differentiation in a lagoon species. Ecol. Evol. 2019, 9, 4667–4682. [Google Scholar] [CrossRef]
- Brock, V. Morphological and biochemical criteria for the separation of Cardium glaucum (Bruguière) from Cardium edule (L.). Ophelia 1978, 17, 207–214. [Google Scholar] [CrossRef]
- Parada, J.M. Validation of lateral visibility of the ligament as a characteristic for fast discrimination between juveniles of Cerastoderma edule and C. glaucum (Mollusca, Bivalvia). Nova Acta Cient. Compost. 2018, 25, 1–8. [Google Scholar]
- Kingston, P.F. Interspecific hybridization in Cardium. Nature 1973, 243, 360. [Google Scholar] [CrossRef]
- Tarnowska, K.; Krakau, M.; Jacobsen, S.; Wolowick, M.; Féral, J.P.; Chenuil, A. Comparative phylogeography of two sister (congeneric) species of cardiid bivalve: Strong influence of habitat, life history and post-glacial history. Estuar. Coast. Shelf Sci. 2012, 107, 150–158. [Google Scholar] [CrossRef]
- Yankson, K. Reproductive cycles of Cerastoderma glaucum (Bruguiére) and C. edule (L.) with special reference to the effects of the 1981-82 severe winter. J. Molluscan Stud. 1986, 52, 6–14. [Google Scholar] [CrossRef]
- Freire, R.; Arias, A.; Méndez, J.; Insua, A. Identification of European comercial cockles (Cerastoderma edule and C. glaucum) by species-specific PCR amplification of the ribosomal DNA ITS region. Eur. Food Res. Technol. 2011, 232, 83–86. [Google Scholar] [CrossRef]
- Toz, S.O.; Tetik, A.; Ertabaklar, H.; Zeyrek, F.Y.; Culha, G.; Ozbel, Y. Optimisation of diagnostic real time PCR assays for ITS-1 and ITS-2 regions of Leishmania Genus. Trop. Med. Int. Health 2009, 14, 181–182. [Google Scholar]
- Freire, R.; Arias, A.; Mendez, J.; Insua, A. Sequence variation of the internal transcribed spacer (ITS) region of ribosomal DNA in Cerastoderma species (Bivalvia: Cardiidae). J. Molluscan Stud. 2010, 76, 77–86. [Google Scholar] [CrossRef]
- Vince Cruz-Abeledo, C.C.; Ting, K.; Ablan-Lagman, M.C. Identification of a species diagnostic character for instar and juvenile mud crabs (Genus Scylla). Aquaculture 2018, 491, 205–209. [Google Scholar] [CrossRef]
- Thiriot-Quievreux, C.; Wolowicz, M. Karyotypes of Cerastoderma glucum (Bivalvia) from Baltic and Mediterranean populations. Hydrobiologia 1996, 324, 149–155. [Google Scholar] [CrossRef]
- Robledo, D.; Palaiokostas, C.; Bargelloni, L.; Martinez, P.; Houston, R. Applications of genotyping by sequencing in aquaculture breeding and genetics. Rev. Aquacult. 2018, 10, 670–682. [Google Scholar] [CrossRef]
- Maroso, F.; Casanova, A.; do Prado, F.D.; Bouza, C.; Pardo, B.G.; Blanco, A.; Hermida, M.; Fernandez, C.; Vera, M.; Martinez, P. Species identification of two closely exploited flatfish, turbot (Scophthalmus maximus) and brill (Scophthalmus rhombus), using a ddRADseq genomic approach. Aquat. Conserv. Mar. Freshw. Ecosys. 2018, 28, 1253–1260. [Google Scholar] [CrossRef]
- Wang, S.; Meyer, E.; McKay, J.K.; Matz, M.V. 2b-RAD: A simple and flexible method for genome-wide genotyping. Nat. Methods 2012, 9, 808–810. [Google Scholar] [CrossRef] [PubMed]
- Catchen, J.; Hohenlohe, P.A.; Bassham, S.; Amores, A.; Cresko, W.A. Stacks: An analysis tool set for population genomics. Mol. Ecol. 2013, 22, 3124–3140. [Google Scholar] [CrossRef] [PubMed]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S.E., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- ThermoFisher. Multiple Primer Analyzer. Available online: https://www.thermofisher.com/es/es/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html (accessed on 3 June 2019).
- Vera, M.; Álvarez-Dios, J.A.; Millán, A.; Pardo, B.G.; Bouza, C.; Hermida, M.; Fernandez, C.; de la Herran, R.; Molina-Luzon, M.J.; Martínez, P. Validation of single nucleotide polymorphism (SNP) markers from an immune Expressed Sequence Tag (EST) turbot, Scophthalmus maximus, database. Aquaculture 2011, 313, 31–41. [Google Scholar] [CrossRef]
- Gardeström, J.; Pereyra, R.T.; Andre, C. Characterization of six microsatellite loci in the Baltic blue mussel Mytilus trossulus and cross-species amplification in North Sea Mytilus edulis. Conserv. Genet. 2008, 9, 1003–1005. [Google Scholar] [CrossRef]
- Diz, A.P.; Presa, P. The genetic diversity pattern of Mytilus galloprovincialis in Galician Rias (NW Iberian estuaries). Aquaculture 2009, 287, 278–285. [Google Scholar] [CrossRef]
- Brock, V.; Christiansen, G. Evolution of Cardium (Cerastoderma) edule, C. lamarcki and C. glaucum: Studies of DNA-variation. Mar. Biol. 1989, 102, 505–511. [Google Scholar] [CrossRef]
- André, C.; Lindegarth, M.; Jonsson, P.R.; Sundberg, P. Species identification of bivalve larvae using random amplified polymorphic DNA (RAPD): Differentiation berween Cerastoderma edule and C. lamarcki. J. Mar. Biol. Assoc. UK 1999, 79, 563–565. [Google Scholar] [CrossRef]
- Freire, R.; Insua, A.; Mendez, J. Cerastoderma glaucum 5S ribosomal DNA: Characterization of the repeat unit, divergence with respect to Cerastoderma edule, and PCR-RFLPs for the identification of both cockles. Genome 2005, 48, 427–442. [Google Scholar] [CrossRef] [PubMed]
- Castro, J.; Rodriguez, S.; Pardo, B.G.; Sanchez, L.; Martinez, P. Population analysis of an unusual NOR-site polymorphism in brown trout (Salmo trutta L.). Heredity 2001, 86, 291–302. [Google Scholar] [CrossRef]
- Singh, M.; Kumar, R.; Nagpure, N.S.; Kushwaha, B.; Mani, I.; Lakra, W.S. Extensive NOR site polymorphism in geographically isolated populations of Golden mahseer, Tor putitora. Genome 2009, 52, 783–789. [Google Scholar] [CrossRef]
- Alquezar, D.E.; Hemmerter, S.; Cooper, R.D.; Beebe, N.W. Incomplete concerted evolution and reproductive isolation at the rDNA locus uncovers nine cryptic species within Anopheles longirostris from Papua New Guinea. BMC Evol. Biol. 2010, 10, 392. [Google Scholar] [CrossRef] [PubMed]
- Lunerova, J.; Renny-Byfield, S.; Matyasek, R.; Leitch, A.; Kovarik, A. Concerted evolution rapidly eliminates sequence variation in rDNA coding regions but not in intergenic spacers in Nicotiana tabacum allotetraploid. Plant Syst. Evol. 2017, 303, 1043–1060. [Google Scholar] [CrossRef]
Bed (Drainage) | Code | Geographical Coordinates | N | Specimens | Technique | |||
---|---|---|---|---|---|---|---|---|
Cerastoderma edule | Cerastoderma glaucum | Suspected Hybrids | 2bRAD GBS | SNaPshot | ||||
Texel—Netherlands (Atlantic) | NTX | 53°00.22′ N, 4°46.23′ E | 8 | 8 | 8 | |||
Somme Bay—France (Atlantic) | FBS | 50°12.08′ N, 1°37.62′ W | 30 | 30 | 30 | 8 | ||
Burry—Wales (Atlantic) | WBY | 51°38.55′ N, 4°09.98′ W | 8 | 8 | 8 | |||
Dundalk Bay—Ireland (Atlantic) | IDA | 53°53.05′ N, 6°20.48′ W | 8 | 8 | 8 | |||
Miño–Galicia Spain (Atlantic) | SMI | 43°21.69′ N, 8°12.35′ W | 30 | 30 | 30 | |||
Ria de Noia—Spain (Atlantic) | SNO | 42°47.42′ N, 8°55.36′ W | 8 | 8 | 8 | |||
Campelo—Spain (Atlantic) | SCA | 42°25.25′ N, 8°41.09′ W | 30 | 30 | 30 | |||
Redondela—Spain (Atlantic) | SRG | 42°17.63′ N, 8°37.24′ W | 30 | 30 | 30 | 19 | ||
Tejo Mouth–Portugal (Atlantic) | PTE | 38°46.00′ N, 9°02.00′ W | 8 | 8 | 8 | |||
Ria Formosa–Portugal (Atlantic) | PRF | 36°59.86′ N, 7°49.81′ W | 30 | 30 | 30 | |||
Delta del Ebro—Spain (Mediterranean) | EDCE | 40°41.75′ N, 0°45.12′ E | 29 | 29 | 29 | |||
Nykobing Mors—Denmark (Atlantic) * | DNCE | 56°46.91′ N, 8°52.27′ W | 11 | 6 | 2 | 3 | 11 | |
Espasante—Spain (Atlantic) * | EECE | 43°43.44′ N, 7°48.26′ W | 9 | 8 | 1 | 9 | ||
Carril—Spain (Atlantic) * | ECCE | 42°36.75′ N, 8°46.50′ W | 10 | 6 | 3 | 1 | 10 | |
Combarro—Spain (Atlantic) * | EACE | 42°25.92′ N, 8°42.30′ W | 7 | 4 | 3 | 7 | ||
Lourizán—Spain (Atlantic) * | ELCE | 42°24.53′ N, 8°40.66′ W | 9 | 7 | 2 | 9 |
Marker | SNPs Variants C.edule/C. glaucum | External Primers (5′-3′) | Tailed Internal Primer (5′-3′) | IP Sense | GenBank Accession Number |
---|---|---|---|---|---|
Cerast_1173A | A/G (129) | F: GGGACGGCACTTTTCACAAT R: TGGTGCTGTGGATGAATCGA | gactTGGTGGGCACTTGGATGC | R | MN178492 (240) |
Cerast_1316 | T/C (55) | F: TAGACAAAACAGGCCTACGC R: TCGTGATCTGCCAAAGGTTT | gactgactgacGCAACAGATTGCCAGCTGT | R | MN178494 (171) |
Cerast_1400 | G/A (99) | F: AGCACGGTTGTTGATTGGAC R: TTTAAGCCAGGGTCCTCGG | gactgactgactACTCTTCTTCATGGTTGAAAAGTC | F | MN178495 (218) |
Cerast_456 | C/T (90) | F: CAGCTTGGCATAACGTCACC R: TTATGCCTTGCGAATGTCCG | gactgactgactgactgactgaCAGAAGGATGCGGCATTGT | F | MN178490 (190) |
Cerast_31 | A/G (141) | F: CAGACCAGGCAAACACATCA R: CAGCTCGCATTTGTTCCCTT | gactgactgactgactgactgacATGATTAAGCAAGCTACTGCTAG | F | MN178488 (241) |
Cerast_1255 | A/T (115) | F: AATCGTTCATCATGTCCCGC R: AGTTGGTGTTCACAATTCCCC | gactgactgactgactgactgactgactgaATTGATTCGCAGTGTTTTGCT | R | MN178493 (192) |
Cerast_586 | C/T (154) | F: TGAATCTGTCCGCATCCTGA R: GATAAAACCTAACAGGTGGGC | gactgactgactgactgactgactgactgactgactgacATGGGCATGCGCAAAGG | F | MN178491 (213) |
Cerast_450 | A/T (165) | F: TTCACTCCACAACGAATCCA R: CCGGTACCCCAAACAATATAACA | gactgactgactgactgactgactgactgactgactgactCATTATAAATTCCTAGCGAGCAGA | F | MN178489 (250) |
Cerast_2530 | T/A (126) | F: TGTGATTTGTGTGGTGCTGT R: GTGTCTTCTAACATGGCATGCT | gactgactgactgactgactgactgactgactgactgactgactgactTGAATTTTGGCATGTTTTTGCTCTAG | R | MN178496 (243) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maroso, F.; Pérez de Gracia, C.; Iglesias, D.; Cao, A.; Díaz, S.; Villalba, A.; Vera, M.; Martínez, P. A Useful SNP Panel to Distinguish Two Cockle Species, Cerastoderma edule and C. glaucum, Co-Occurring in Some European Beds, and Their Putative Hybrids. Genes 2019, 10, 760. https://doi.org/10.3390/genes10100760
Maroso F, Pérez de Gracia C, Iglesias D, Cao A, Díaz S, Villalba A, Vera M, Martínez P. A Useful SNP Panel to Distinguish Two Cockle Species, Cerastoderma edule and C. glaucum, Co-Occurring in Some European Beds, and Their Putative Hybrids. Genes. 2019; 10(10):760. https://doi.org/10.3390/genes10100760
Chicago/Turabian StyleMaroso, Francesco, Celia Pérez de Gracia, David Iglesias, Asunción Cao, Seila Díaz, Antonio Villalba, Manuel Vera, and Paulino Martínez. 2019. "A Useful SNP Panel to Distinguish Two Cockle Species, Cerastoderma edule and C. glaucum, Co-Occurring in Some European Beds, and Their Putative Hybrids" Genes 10, no. 10: 760. https://doi.org/10.3390/genes10100760