Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Synthesis of TQ-Encapsulated PBM-NPs
2.3. Synthesis of Nanoparticle-Aptamer Conjugates
2.4. Engineering of Aptamer-Conjugated, TQ-Encapsulated PBM-NPs
2.5. Characterization of PBM-NPs
2.6. Nanoparticle Tracking Analysis (NTA) of PBM-NPs
2.7. Super Plasmon Resonance (SPR) Analysis of A10-Conjugated PBM-NPs
2.8. Immunohistochemistry
2.9. Cell Lines and Generation of Docetaxel (DTX)-Resistant Cells
2.10. MTT Assay
2.11. Immunofluorescence Evaluations
2.12. Flow Cytometry Assay
2.13. Quantitative Reverse Transcription PCR (qRT-PCR)
2.14. Western Blot Analyses
2.15. Statistical Analysis
3. Results
3.1. Characterization of the PSMA Aptamer (A10)-Conjugated, TQ-Encapsulated PBM-NPs
3.2. NMR Characterization, SPR Binding Affinity, and Cellular Uptake of TQ-Encapsulated PBM-NPs
3.3. PCa Cancer Tissues Display Altered Expressions of SHH and GLI1 that Increase with Higher Cancer Stages
3.4. PSMA Aptamer (A10)-Conjugated, TQ-Encapsulated PBM-NPs Sensitize DTX-R PCa Cells to Low Concentrations of TQ
3.5. Drug-Resistant PCa Cells Overexpress ATP-Binding Cassette (ABC) Transporter and Hh Pathway Genes
3.6. A10-Conjugated, TQ-Encapsulated PBM-NPs Downregulate PSMA and Hh Proteins in DTX-Resistant PCa Cells
3.7. A10-Conjugated, TQ-Encapsulated PBM-NPs Alter mRNA Expression of Hh Signaling Molecules in DTX-Resistant PCa Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Miyahira, A.K.; Sharp, A.; Ellis, L.; Jones, J.; Kaochar, S.; Larman, H.B.; Quigley, D.A.; Ye, H.; Simons, J.W.; Pienta, K.J.; et al. Prostate cancer research: The next generation; report from the 2019 Coffey-Holden Prostate Cancer Academy Meeting. Prostate 2020, 80, 113–132. [Google Scholar] [CrossRef] [PubMed]
- Ku, S.Y.; Gleave, M.E.; Beltran, H. Towards precision oncology in advanced prostate cancer. Nat. Rev. Urol. 2019, 16, 645–654. [Google Scholar] [CrossRef] [PubMed]
- Ren, S.; Wei, G.H.; Liu, D.; Wang, L.; Hou, Y.; Zhu, S.; Peng, L.; Zhang, Q.; Cheng, Y.; Su, H.; et al. Whole-genome and Transcriptome Sequencing of Prostate Cancer Identify New Genetic Alterations Driving Disease Progression. Eur. Urol. 2018, 73, 322–339. [Google Scholar] [CrossRef]
- Abeshouse, A.; Ahn, J.; Akbani, R.; Ally, A.; Amin, S.; Andry, C.D.; Annala, M.; Aprikian, A.; Armenia, J.; Arora, A.; et al. The Molecular Taxonomy of Primary Prostate Cancer. Cell 2015, 163, 1011–1025. [Google Scholar] [CrossRef] [PubMed]
- Barbieri, C.E.; Baca, S.C.; Lawrence, M.S.; Demichelis, F.; Blattner, M.; Theurillat, J.P.; White, T.A.; Stojanov, P.; Van Allen, E.; Stransky, N.; et al. Exome sequencing identifies recurrent SPOP, FOXA1 and MED12 mutations in prostate cancer. Nat. Genet. 2012, 44, 685–689. [Google Scholar] [CrossRef] [PubMed]
- Augello, M.A.; Liu, D.; Deonarine, L.D.; Robinson, B.D.; Huang, D.; Stelloo, S.; Blattner, M.; Doane, A.S.; Wong, E.W.P.; Chen, Y.; et al. CHD1 Loss Alters AR Binding at Lineage-Specific Enhancers and Modulates Distinct Transcriptional Programs to Drive Prostate Tumorigenesis. Cancer Cell 2019, 35, 817–819. [Google Scholar] [CrossRef]
- Pietrobono, S.; Gagliardi, S.; Stecca, B. Non-canonical Hedgehog Signaling Pathway in Cancer: Activation of GLI Transcription Factors Beyond Smoothened. Front. Genet. 2019, 10, 556. [Google Scholar] [CrossRef]
- Taipale, J.; Beachy, P.A. The Hedgehog and Wnt signalling pathways in cancer. Nature 2001, 411, 349–354. [Google Scholar] [CrossRef]
- Sheng, T.; Li, C.; Zhang, X.; Chi, S.; He, N.; Chen, K.; McCormick, F.; Gatalica, Z.; Xie, J. Activation of the hedgehog pathway in advanced prostate cancer. Mol. Cancer 2004, 3, 29. [Google Scholar] [CrossRef]
- Oldak, M.; Grzela, T.; Lazarczyk, M.; Malejczyk, J.; Skopinski, P. Clinical aspects of disrupted Hedgehog signaling (Review). Int. J. Mol. Med. 2001, 8, 445–452. [Google Scholar] [PubMed]
- Chen, M.; Carkner, R.; Buttyan, R. The hedgehog/Gli signaling paradigm in prostate cancer. Expert Rev. Endocrinol. Metab. 2011, 6, 453–467. [Google Scholar] [CrossRef] [PubMed]
- Stecca, B.; Mas, C.; Ruiz i Altaba, A. Interference with HH-GLI signaling inhibits prostate cancer. Trends Mol. Med. 2005, 11, 199–203. [Google Scholar] [CrossRef] [PubMed]
- Karhadkar, S.S.; Bova, G.S.; Abdallah, N.; Dhara, S.; Gardner, D.; Maitra, A.; Isaacs, J.T.; Berman, D.M.; Beachy, P.A. Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 2004, 431, 707–712. [Google Scholar] [CrossRef] [PubMed]
- Ruiz i Altaba, A. Therapeutic inhibition of Hedgehog-GLI signaling in cancer: Epithelial, stromal, or stem cell targets? Cancer Cell 2008, 14, 281–283. [Google Scholar] [CrossRef] [PubMed]
- Asaduzzaman Khan, M.; Tania, M.; Fu, S.; Fu, J. Thymoquinone, as an anticancer molecule: From basic research to clinical investigation. Oncotarget 2017, 8, 51907–51919. [Google Scholar] [CrossRef] [PubMed]
- Noel, B.; Singh, S.K.; Lillard, J.W., Jr.; Singh, R. Role of natural compounds in preventing and treating breast cancer. Front. Biosci. 2020, 12, 137–160. [Google Scholar]
- Anwanwan, D.; Singh, S.K.; Singh, S.; Saikam, V.; Singh, R. Challenges in liver cancer and possible treatment approaches. Biochim. Biophys. Acta Rev. Cancer 2020, 1873, 188314. [Google Scholar] [CrossRef]
- Imran, M.; Rauf, A.; Khan, I.A.; Shahbaz, M.; Qaisrani, T.B.; Fatmawati, S.; Abu-Izneid, T.; Imran, A.; Rahman, K.U.; Gondal, T.A. Thymoquinone: A novel strategy to combat cancer: A review. Biomed. Pharm. 2018, 106, 390–402. [Google Scholar] [CrossRef]
- Salim, L.Z.; Mohan, S.; Othman, R.; Abdelwahab, S.I.; Kamalidehghan, B.; Sheikh, B.Y.; Ibrahim, M.Y. Thymoquinone induces mitochondria-mediated apoptosis in acute lymphoblastic leukaemia in vitro. Molecules 2013, 18, 11219–11240. [Google Scholar] [CrossRef]
- Kou, B.; Liu, W.; Zhao, W.; Duan, P.; Yang, Y.; Yi, Q.; Guo, F.; Li, J.; Zhou, J.; Kou, Q. Thymoquinone inhibits epithelial-mesenchymal transition in prostate cancer cells by negatively regulating the TGF-beta/Smad2/3 signaling pathway. Oncol. Rep. 2017, 38, 3592–3598. [Google Scholar] [CrossRef] [PubMed]
- Koka, P.S.; Mondal, D.; Schultz, M.; Abdel-Mageed, A.B.; Agrawal, K.C. Studies on molecular mechanisms of growth inhibitory effects of thymoquinone against prostate cancer cells: Role of reactive oxygen species. Exp. Biol. Med. 2010, 235, 751–760. [Google Scholar] [CrossRef] [PubMed]
- Slusarz, A.; Shenouda, N.S.; Sakla, M.S.; Drenkhahn, S.K.; Narula, A.S.; MacDonald, R.S.; Besch-Williford, C.L.; Lubahn, D.B. Common botanical compounds inhibit the hedgehog signaling pathway in prostate cancer. Cancer Res. 2010, 70, 3382–3390. [Google Scholar] [CrossRef] [PubMed]
- Jabir, N.R.; Tabrez, S.; Ashraf, G.M.; Shakil, S.; Damanhouri, G.A.; Kamal, M.A. Nanotechnology-based approaches in anticancer research. Int. J. Nanomed. 2012, 7, 4391–4408. [Google Scholar] [CrossRef]
- Sun, T.; Zhang, Y.S.; Pang, B.; Hyun, D.C.; Yang, M.; Xia, Y. Engineered nanoparticles for drug delivery in cancer therapy. Angew Chem. Int. Ed. Engl. 2014, 53, 12320–12364. [Google Scholar] [CrossRef]
- Singh, S.K.; Singh, S.; Lillard, J.W., Jr.; Singh, R. Drug delivery approaches for breast cancer. Int. J. Nanomed. 2017, 12, 6205–6218. [Google Scholar] [CrossRef]
- Zununi Vahed, S.; Fathi, N.; Samiei, M.; Maleki Dizaj, S.; Sharifi, S. Targeted cancer drug delivery with aptamer-functionalized polymeric nanoparticles. J. Drug Target. 2019, 27, 292–299. [Google Scholar] [CrossRef]
- Singh, S.K.; Lillard, J.W., Jr.; Singh, R. Reversal of drug resistance by planetary ball milled (PBM) nanoparticle loaded with resveratrol and docetaxel in prostate cancer. Cancer Lett. 2018, 427, 49–62. [Google Scholar] [CrossRef]
- Singh, S.K.; Mishra, M.K.; Singh, R. Hypoxia-inducible factor-1alpha induces CX3CR1 expression and promotes the epithelial to mesenchymal transition (EMT) in ovarian cancer cells. J. Ovarian Res. 2019, 12, 42. [Google Scholar] [CrossRef]
- Singh, S.K.; Mishra, M.K.; Rivers, B.M.; Gordetsky, J.B.; Bae, S.; Singh, R. Biological and Clinical Significance of the CCR5/CCL5 Axis in Hepatocellular Carcinoma. Cancers 2020, 12, 883. [Google Scholar] [CrossRef]
- Albanese, A.; Tang, P.S.; Chan, W.C. The effect of nanoparticle size, shape, and surface chemistry on biological systems. Annu. Rev. Biomed. Eng. 2012, 14, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Dragovic, R.A.; Gardiner, C.; Brooks, A.S.; Tannetta, D.S.; Ferguson, D.J.; Hole, P.; Carr, B.; Redman, C.W.; Harris, A.L.; Dobson, P.J.; et al. Sizing and phenotyping of cellular vesicles using Nanoparticle Tracking Analysis. Nanomedicine 2011, 7, 780–788. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.; Yarger, J.L. Characterizing gold nanoparticles by NMR spectroscopy. Magn. Reason. Chem. 2018, 56, 1074–1082. [Google Scholar] [CrossRef] [PubMed]
- Behzadi, S.; Serpooshan, V.; Tao, W.; Hamaly, M.A.; Alkawareek, M.Y.; Dreaden, E.C.; Brown, D.; Alkilany, A.M.; Farokhzad, O.C.; Mahmoudi, M. Cellular uptake of nanoparticles: Journey inside the cell. Chem. Soc. Rev. 2017, 46, 4218–4244. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, H.H.; Park, J.; Kang, S.; Kim, M. Surface plasmon resonance: A versatile technique for biosensor applications. Sensors 2015, 15, 10481–10510. [Google Scholar] [CrossRef]
- Tang, Y.; Wu, S.; Lin, J.; Cheng, L.; Zhou, J.; Xie, J.; Huang, K.; Wang, X.; Yu, Y.; Chen, Z.; et al. Nanoparticles Targeted against Cryptococcal Pneumonia by Interactions between Chitosan and Its Peptide Ligand. Nano Lett. 2018, 18, 6207–6213. [Google Scholar] [CrossRef]
- Datta, S.; Datta, M.W. Sonic Hedgehog signaling in advanced prostate cancer. Cell Mol. Life Sci 2006, 63, 435–448. [Google Scholar] [CrossRef]
- Sims-Mourtada, J.; Izzo, J.G.; Ajani, J.; Chao, K.S. Sonic Hedgehog promotes multiple drug resistance by regulation of drug transport. Oncogene 2007, 26, 5674–5679. [Google Scholar] [CrossRef]
- Carballo, G.B.; Honorato, J.R.; de Lopes, G.P.F.; Spohr, T. A highlight on Sonic hedgehog pathway. Cell Commun. Signal. 2018, 16, 11. [Google Scholar] [CrossRef]
- Hahn, H.; Wicking, C.; Zaphiropoulous, P.G.; Gailani, M.R.; Shanley, S.; Chidambaram, A.; Vorechovsky, I.; Holmberg, E.; Unden, A.B.; Gillies, S.; et al. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 1996, 85, 841–851. [Google Scholar] [CrossRef]
- Johnson, R.L.; Rothman, A.L.; Xie, J.; Goodrich, L.V.; Bare, J.W.; Bonifas, J.M.; Quinn, A.G.; Myers, R.M.; Cox, D.R.; Epstein, E.H., Jr.; et al. Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 1996, 272, 1668–1671. [Google Scholar] [CrossRef] [PubMed]
- Dahmane, N.; Lee, J.; Robins, P.; Heller, P.; Ruiz i Altaba, A. Activation of the transcription factor Gli1 and the Sonic hedgehog signalling pathway in skin tumours. Nature 1997, 389, 876–881. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, P.; Clement, V.; Ruiz i Altaba, A. Therapeutic targeting of the Hedgehog-GLI pathway in prostate cancer. Cancer Res. 2005, 65, 2990–2992. [Google Scholar] [CrossRef]
- Bragina, O.; Njunkova, N.; Sergejeva, S.; Jarvekulg, L.; Kogerman, P. Sonic Hedgehog pathway activity in prostate cancer. Oncol. Lett. 2010, 1, 319–325. [Google Scholar] [CrossRef]
- Sanchez, P.; Hernandez, A.M.; Stecca, B.; Kahler, A.J.; DeGueme, A.M.; Barrett, A.; Beyna, M.; Datta, M.W.; Datta, S.; Ruiz i Altaba, A. Inhibition of prostate cancer proliferation by interference with SONIC HEDGEHOG-GLI1 signaling. Proc. Natl. Acad. Sci. USA 2004, 101, 12561–12566. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Pepicelli, C.V.; Dibble, C.C.; Catbagan, W.; Zarycki, J.L.; Laciak, R.; Gipp, J.; Shaw, A.; Lamm, M.L.; Munoz, A.; et al. Hedgehog signaling promotes prostate xenograft tumor growth. Endocrinology 2004, 145, 3961–3970. [Google Scholar] [CrossRef] [PubMed]
- Tzelepi, V.; Karlou, M.; Wen, S.; Hoang, A.; Logothetis, C.; Troncoso, P.; Efstathiou, E. Expression of hedgehog pathway components in prostate carcinoma microenvironment: Shifting the balance towards autocrine signalling. Histopathology 2011, 58, 1037–1047. [Google Scholar] [CrossRef]
- Janikova, M.; Skarda, J. Differentiation pathways in carcinogenesis and in chemo- and radioresistance. Neoplasma 2012, 59, 6–17. [Google Scholar] [CrossRef]
- Gonnissen, A.; Isebaert, S.; Haustermans, K. Hedgehog signaling in prostate cancer and its therapeutic implication. Int. J. Mol. Sci. 2013, 14, 13979–14007. [Google Scholar] [CrossRef]
- Singh, S.; Chitkara, D.; Mehrazin, R.; Behrman, S.W.; Wake, R.W.; Mahato, R.I. Chemoresistance in prostate cancer cells is regulated by miRNAs and Hedgehog pathway. PLoS ONE 2012, 7, e40021. [Google Scholar] [CrossRef]
- Singh, S.K.; Apata, T.; Gordetsky, J.B.; Singh, R. Docetaxel Combined with Thymoquinone Induces Apoptosis in Prostate Cancer Cells via Inhibition of the PI3K/AKT Signaling Pathway. Cancers 2019, 11, 1390. [Google Scholar] [CrossRef] [PubMed]
- Stecca, B.; Ruiz, I.A.A. Context-dependent regulation of the GLI code in cancer by HEDGEHOG and non-HEDGEHOG signals. J. Mol. Cell Biol. 2010, 2, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Teglund, S.; Toftgard, R. Hedgehog beyond medulloblastoma and basal cell carcinoma. Biochimica Biophysica Acta 2010, 1805, 181–208. [Google Scholar] [CrossRef] [PubMed]
- Kogerman, P.; Grimm, T.; Kogerman, L.; Krause, D.; Unden, A.B.; Sandstedt, B.; Toftgard, R.; Zaphiropoulos, P.G. Mammalian suppressor-of-fused modulates nuclear-cytoplasmic shuttling of Gli-1. Nat. Cell Biol. 1999, 1, 312–319. [Google Scholar] [CrossRef]
- Housman, G.; Byler, S.; Heerboth, S.; Lapinska, K.; Longacre, M.; Snyder, N.; Sarkar, S. Drug resistance in cancer: An overview. Cancers 2014, 6, 1769–1792. [Google Scholar] [CrossRef]
- Tsuruo, T.; Naito, M.; Tomida, A.; Fujita, N.; Mashima, T.; Sakamoto, H.; Haga, N. Molecular targeting therapy of cancer: Drug resistance, apoptosis and survival signal. Cancer Sci. 2003, 94, 15–21. [Google Scholar] [CrossRef]
- Wang, D.; Qiao, J.; Zhao, X.; Chen, T.; Guan, D. Thymoquinone Inhibits IL-1beta-Induced Inflammation in Human Osteoarthritis Chondrocytes by Suppressing NF-kappaB and MAPKs Signaling Pathway. Inflammation 2015, 38, 2235–2241. [Google Scholar] [CrossRef]
- Alexis, F.; Pridgen, E.; Molnar, L.K.; Farokhzad, O.C. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Mol. Pharm. 2008, 5, 505–515. [Google Scholar] [CrossRef]
Forward | Reverse | |
---|---|---|
18S | GGCCCTGTAATTGGAATGAGTC | CCAAGATCCAACTACGAGCTT |
ABCB1 | TGACATTTATTCAAAGTTAAAAGCA | TAGACACTTTATGCAAACATTTCAA |
PSMA | GCTTCCTCTTCGGGTGGTTT | TCCTGCTAAATGTGGTATCTGTGT |
SHH | TCT CCAGAAACTCCGAGCGA | ACTTGTCCTTACACCTCTGAGTC |
SMO | GCTACAACGTGTGCCTGGG | CATTCCGGAGGCCCGAC |
PTCH1 | TGAAATCCAAGCCCAGCGTC | CAGTAGCCTTCCCCATAGCC |
PTCH2 | CCGCCAGAGGTGATACAGAT | CCACGGTCATGGAGGTAGTC |
GLI1 | GCTGCCGTGGCCCTC | GTGTGGGGACACTCTGTCTG |
GLI2 | ACTTGATGTTCCCTGCGCTC | CTGCGGCACCAGCGT |
GLI3 | GCTCCACGACCACTGAAA AG | TGTCCAGGACTTTCATCCTCATTA |
SUFU | CCACACCTGCAAGAGAGAGT | TTGGCACTGACACCACTCAG |
KIF | GCGCCGCACTGGGGAT | CTCTGGGCCCTGCCTGG |
CK1 | TCTTCAAGTGGGCAGGGTCA | CTGCTCCGATCATCTCGTCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Singh, S.K.; Gordetsky, J.B.; Bae, S.; Acosta, E.P.; Lillard, J.W., Jr.; Singh, R. Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer. Cells 2020, 9, 1976. https://doi.org/10.3390/cells9091976
Singh SK, Gordetsky JB, Bae S, Acosta EP, Lillard JW Jr., Singh R. Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer. Cells. 2020; 9(9):1976. https://doi.org/10.3390/cells9091976
Chicago/Turabian StyleSingh, Santosh Kumar, Jennifer B. Gordetsky, Sejong Bae, Edward P. Acosta, James W. Lillard, Jr., and Rajesh Singh. 2020. "Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer" Cells 9, no. 9: 1976. https://doi.org/10.3390/cells9091976
APA StyleSingh, S. K., Gordetsky, J. B., Bae, S., Acosta, E. P., Lillard, J. W., Jr., & Singh, R. (2020). Selective Targeting of the Hedgehog Signaling Pathway by PBM Nanoparticles in Docetaxel-Resistant Prostate Cancer. Cells, 9(9), 1976. https://doi.org/10.3390/cells9091976