Characterization of Hspb8 in Zebrafish
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Animal Maintenance and Handling
2.3. Heat Shock Assay
2.4. RNA Isolation, Reverse Transcription, and Real-Time Quantitative PCR (RT-qPCR)
2.5. In Situ Hybridization
2.6. SDS-PAGE and Western Blot
2.7. Co-Immunoprecipitation Assay
2.8. LC-MS Analysis
2.9. MO Microinjection
2.10. Phenotypic Analysis
2.11. Birefringence Assay
2.12. Fluorescent Immunohistochemistry
2.13. Transmission Electron Microscopy
2.14. Touch-Evoked Response Assay
2.15. Statistical Analysis
3. Results
3.1. Zebrafish Hspb8 Expression, Localization, and Interactions
3.1.1. Tissue-specific and Subcellular Localization of Hspb8 during Zebrafish Development under Normal and Heat Shock Conditions
3.1.2. Protein Partners of Zebrafish Hspb8
3.2. Effects of Morpholino-Mediated Knockdown of Zebrafish Hspb8
3.2.1. Morphological Analysis of Zebrafish Embryos with Decreased Hspb8 Level
3.2.2. Decreased hspb8 Level Alters Swimming Behavior of Zebrafish Embryos
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
Bag3 | Bcl2-associated athanogene 3 |
BF | birefringence |
β-actin | gene of beta actin |
CASA | chaperone-assisted selective autophagy |
CHIP | carboxyl terminus of HSC70-interacting protein |
CMT2L | Charcot-Marie-Tooth disease type 2L |
co-IP | co-immunoprecipitation |
Dd×20 | DEAD box protein |
dHMN | distal hereditary motor neuropathy (type IIA) |
dpf | days post fertilization |
eef1a1l1 | gene of Danio rerio eukaryotic translation elongation factor 1 alpha 1, like 1 |
fps | frames per second |
hpf | hours post fertilization |
Hsp70 | heat shock protein 70 |
Hspb | heat shock protein B |
hspb8 β-actin | mRNA of Hspb8 normalized to mRNA of beta actin |
hspb8eef1a1l1 | mRNA of Hspb8 normalized to mRNA of eef1a1l1 |
hspb8 rpl13a | mRNA of Hspb8 normalized to mRNA of rpl13a |
KI | knock-in |
KO | knock-out |
LC-MS | liquid chromatography-mass spectrometry |
MO | morpholino oligonucleotides |
PBS | phosphate-buffered saline |
PBST | phosphate-buffered saline with 1% (v/v) Tween-20 |
PFA | paraformaldehyde |
rpl13a | gene of Danio rerio ribosomal protein L13a |
RT qPCR | real-time quantitative polymerase chain reaction |
RVM | rimmed vacuolar myopathy |
sHSP | small heat shock protein |
SMN | survival of motor neuron |
TER | touch-evoked response |
WB | Western blot |
WT | wild type |
References
- Janowska, M.K.; Baughman, H.E.R.; Woods, C.N.; Klevit, R.E. Mechanisms of Small Heat Shock Proteins. Cold Spring Harb. Perspect. Biol. 2019, 11, a034025. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Fontaine, J.-M.; Rest, J.S.; Shelden, E.A.; Welsh, M.J.; Benndorf, R. Interaction of Human HSP22 (HSPB8) with Other Small Heat Shock Proteins. J. Biol. Chem. 2004, 279, 2394–2402. [Google Scholar] [CrossRef] [Green Version]
- Carra, S.; Alberti, S.; Benesch, J.L.P.; Boelens, W.; Buchner, J.; Carver, J.A.; Cecconi, C.; Ecroyd, H.; Gusev, N.; Hightower, L.E.; et al. Small heat shock proteins: Multifaceted proteins with important implications for life. Cell Stress Chaperones 2019, 27, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Dubińska-Magiera, M.; Jab\lońska, J.; Saczko, J.; Kulbacka, J.; Jagla, T.; Daczewska, M. Contribution of small heat shock proteins to muscle development and function. FEBS Lett. 2014, 588, 517–530. [Google Scholar] [CrossRef] [Green Version]
- Vicart, P.; Caron, A.; Guicheney, P.; Li, Z.; Prévost, M.-C.; Faure, A.; Chateau, D.; Chapon, F.; Tomé, F.; Dupret, J.-M.; et al. A missense mutation in the αB-crystallin chaperone gene causes a desmin-related myopathy. Nat. Genet. 1998, 20, 92–95. [Google Scholar] [CrossRef] [PubMed]
- Scarlato, M.; Viganò, F.; Carrera, P.; Previtali, S.C.; Bolino, A. A novel heat shock protein 27 homozygous mutation: Widening of the continuum between MND/dHMN/CMT2. J. Peripher. Nerv. Syst. 2015, 20, 419–421. [Google Scholar] [CrossRef] [PubMed]
- Mitzelfelt, K.A.; Limphong, P.; Choi, M.J.; Kondrat, F.D.L.; Lai, S.; Kolander, K.D.; Kwok, W.-M.; Dai, Q.; Grzybowski, M.N.; Zhang, H.; et al. The Human 343delT HSPB5 Chaperone Associated with Early-onset Skeletal Myopathy Causes Defects in Protein Solubility. J. Biol. Chem. 2016, 291, 14939–14953. [Google Scholar] [CrossRef] [Green Version]
- Echaniz-Laguna, A.; Lornage, X.; Lannes, B.; Schneider, R.; Bierry, G.; Dondaine, N.; Boland, A.; Deleuze, J.-F.; Böhm, J.; Thompson, J.; et al. HSPB8 haploinsufficiency causes dominant adult-onset axial and distal myopathy. Acta Neuropathol. (Berl.) 2017, 134, 163–165. [Google Scholar] [CrossRef]
- Carra, S.; Seguin, S.J.; Landry, J. HspB8 and Bag3: A new chaperone complex targeting misfolded proteins to macroautophagy. Autophagy 2008, 4, 237–239. [Google Scholar] [CrossRef] [Green Version]
- Arndt, V.; Dick, N.; Tawo, R.; Dreiseidler, M.; Wenzel, D.; Hesse, M.; Fürst, D.O.; Saftig, P.; Saint, R.; Fleischmann, B.K.; et al. Chaperone-Assisted Selective Autophagy Is Essential for Muscle Maintenance. Curr. Biol. 2010, 20, 143–148. [Google Scholar] [CrossRef]
- Crippa, V.; Sau, D.; Rusmini, P.; Boncoraglio, A.; Onesto, E.; Bolzoni, E.; Galbiati, M.; Fontana, E.; Marino, M.; Carra, S.; et al. The small heat shock protein B8 (HspB8) promotes autophagic removal of misfolded proteins involved in amyotrophic lateral sclerosis (ALS). Hum. Mol. Genet. 2010, 19, 3440–3456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cristofani, R.; Crippa, V.; Vezzoli, G.; Rusmini, P.; Galbiati, M.; Cicardi, M.E.; Meroni, M.; Ferrari, V.; Tedesco, B.; Piccolella, M.; et al. The small heat shock protein B8 (HSPB8) efficiently removes aggregating species of dipeptides produced in C9ORF72-related neurodegenerative diseases. Cell Stress Chaperones 2018, 23, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gamerdinger, M.; Kaya, A.M.; Wolfrum, U.; Clement, A.M.; Behl, C. BAG3 mediates chaperone-based aggresome-targeting and selective autophagy of misfolded proteins. EMBO Rep. 2011, 12, 149–156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwok, A.S.; Phadwal, K.; Turner, B.J.; Oliver, P.L.; Raw, A.; Simon, A.K.; Talbot, K.; Agashe, V.R. HspB8 mutation causing hereditary distal motor neuropathy impairs lysosomal delivery of autophagosomes. J. Neurochem. 2011, 119, 1155–1161. [Google Scholar] [CrossRef]
- Rauch, J.N.; Tse, E.; Freilich, R.; Mok, S.A.; Makley, L.N.; Southworth, D.R.; Gestwicki, J.E. BAG3 Is a Modular, Scaffolding Protein that physically Links Heat Shock Protein 70 (Hsp70) to the Small Heat Shock Proteins. J. Mol. Biol. 2017, 429, 128–141. [Google Scholar] [CrossRef] [Green Version]
- Haidar, M.; Asselbergh, B.; Adriaenssens, E.; De Winter, V.; Timmermans, J.P.; Auer-Grumbach, M.; Juneja, M.; Timmerman, V. Neuropathy-causing mutations in HSPB1 impair autophagy by disturbing the formation of SQSTM1/p62 bodies. Autophagy 2019, 15, 1051–1068. [Google Scholar] [CrossRef]
- Fuchs, M.; Luthold, C.; Guilbert, S.M.; Varlet, A.A.; Lambert, H.; Jetté, A.; Elowe, S.; Landry, J.; Lavoie, J.N. A Role for the Chaperone Complex BAG3-HSPB8 in Actin Dynamics, Spindle Orientation and Proper Chromosome Segregation during Mitosis. PLOS Genet. 2015, 11, e1005582. [Google Scholar] [CrossRef]
- Varlet, A.A.; Fuchs, M.; Luthold, C.; Lambert, H.; Landry, J.; Lavoie, J.N. Fine-tuning of actin dynamics by the HSPB8-BAG3 chaperone complex facilitates cytokinesis and contributes to its impact on cell division. Cell Stress Chaperones 2017, 22, 553–567. [Google Scholar] [CrossRef] [Green Version]
- Irobi, J.; Holmgren, A.; Winter, V.D.; Asselbergh, B.; Gettemans, J.; Adriaensen, D.; Groote, C.C.; Coster, R.V.; Jonghe, P.D.; Timmerman, V. Mutant HSPB8 causes protein aggregates and a reduced mitochondrial membrane potential in dermal fibroblasts from distal hereditary motor neuropathy patients. Neuromuscul. Disord. 2012, 22, 699–711. [Google Scholar] [CrossRef]
- Rashed, E.; Lizano, P.; Dai, H.; Thomas, A.; Suzuki, C.K.; Depre, C.; Qiu, H. Heat Shock Protein 22 (Hsp22) Regulates Oxidative Phosphorylation upon Its Mitochondrial Translocation with the Inducible Nitric Oxide Synthase in Mammalian Heart. PLOS ONE 2015, 10, e0119537. [Google Scholar] [CrossRef]
- Sun, X.; Fontaine, J.-M.; Hoppe, A.D.; Carra, S.; DeGuzman, C.; Martin, J.L.; Simon, S.; Vicart, P.; Welsh, M.J.; Landry, J.; et al. Abnormal interaction of motor neuropathy-associated mutant HspB8 (Hsp22) forms with the RNA helicase Dd×20 (gemin3). Cell Stress Chaperones 2010, 15, 567–582. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Charroux, B.; Pellizzoni, L.; Perkinson, R.A.; Shevchenko, A.; Mann, M.; Dreyfuss, G. Gemin3. J. Cell Biol. 1999, 147, 1181–1194. [Google Scholar] [CrossRef]
- Mouillet, J.-F.; Yan, X.; Ou, Q.; Jin, L.; Muglia, L.J.; Crawford, P.A.; Sadovsky, Y. DEAD-Box Protein-103 (DP103, Dd×20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function. Endocrinology 2008, 149, 2168–2175. [Google Scholar] [CrossRef] [Green Version]
- Tang, B.; Zhao, G.; Luo, W.; Xia, K.; Cai, F.; Pan, Q.; Zhang, R.; Zhang, F.; Liu, X.; Chen, B.; et al. Small heat-shock protein 22 mutated in autosomal dominant Charcot-Marie-Tooth disease type 2L. Hum. Genet. 2005, 116, 222–224. [Google Scholar] [CrossRef] [PubMed]
- Irobi, J.; Impe, K.V.; Seeman, P.; Jordanova, A.; Dierick, I.; Verpoorten, N.; Michalik, A.; Vriendt, E.D.; Jacobs, A.; Gerwen, V.V.; et al. Hot-spot residue in small heat-shock protein 22 causes distal motor neuropathy. Nat. Genet. 2004, 36, 597–601. [Google Scholar] [CrossRef] [Green Version]
- Ghaoui, R.; Palmio, J.; Brewer, J.; Lek, M.; Needham, M.; Evilä, A.; Hackman, P.; Jonson, P.-H.; Penttilä, S.; Vihola, A.; et al. Mutations in HSPB8 causing a new phenotype of distal myopathy and motor neuropathy. Neurology 2016, 86, 391–398. [Google Scholar] [CrossRef] [Green Version]
- Al-Tahan, S.; Weiss, L.; Yu, H.; Tang, S.; Saporta, M.; Vihola, A.; Mozaffar, T.; Udd, B.; Kimonis, V. New family with HSPB 8-associated autosomal dominant rimmed vacuolar myopathy. Neurol. Genet. 2019, 5, e349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carra, S.; Boncoraglio, A.; Kanon, B.; Brunsting, J.F.; Minoia, M.; Rana, A.; Vos, M.J.; Seidel, K.; Sibon, O.C.M.; Kampinga, H.H. Identification of the Drosophila Ortholog of HSPB8. J. Biol. Chem. 2010, 285, 37811–37822. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Selcen, D.; Muntoni, F.; Burton, B.K.; Pegoraro, E.; Sewry, C.; Bite, A.V.; Engel, A.G. Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Ann. Neurol. 2008, 65, 83–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruparelia, A.A.; Oorschot, V.; Vaz, R.; Ramm, G.; Bryson, R.J. Zebrafish models of BAG3 myofibrillar myopathy suggest a toxic gain of function leading to BAG3 insufficiency. Acta Neuropathol. 2014, 821–833. [Google Scholar] [CrossRef]
- Depre, C.; Hase, M.; Gaussin, V.; Zajac, A.; Wang, L.; Hittinger, L.; Ghaleh, B.; Yu, X.; Kudej, R.K.; Wagner, T.; et al. H11 Kinase Is a Novel Mediator of Myocardial Hypertrophy In Vivo. Circ. Res. 2002, 91, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
- Qiu, H.; Lizano, P.; Laure, L.; Sui, X.; Rashed, E.; Park, J.Y.; Hong, C.; Gao, S.; Holle, E.; Morin, D.; et al. H11 Kinase/Heat Shock Protein 22 Deletion Impairs Both Nuclear and Mitochondrial Functions of STAT3 and Accelerates the Transition Into Heart Failure on Cardiac Overload. Circulation 2011, 124, 406–415. [Google Scholar] [CrossRef]
- Sanbe, A.; Marunouchi, T.; Abe, T.; Tezuka, Y.; Okada, M.; Aoki, S.; Tsumura, H.; Yamauchi, J.; Tanonaka, K.; Nishigori, H.; et al. Phenotype of Cardiomyopathy in Cardiac-specific Heat Shock Protein B8 K141N Transgenic Mouse. J. Biol. Chem. 2013, 288, 8910–8921. [Google Scholar] [CrossRef] [Green Version]
- Zhang, R.; Zhang, F.; Li, X.; Huang, S.; Zi, X.; Liu, T.; Liu, S.; Li, X.; Xia, K.; Pan, Q.; et al. A novel transgenic mouse model of Chinese Charcot-Marie-Tooth disease type 2L. Neural Regen. Res. 2014, 9, 413. [Google Scholar] [CrossRef]
- Bouhy, D.; Juneja, M.; Katona, I.; Holmgren, A.; Asselbergh, B.; De Winter, V.; Hochepied, T.; Goossens, S.; Haigh, J.J.; Libert, C.; et al. A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8. Acta Neuropathol. (Berl.) 2018, 135, 131–148. [Google Scholar] [CrossRef] [PubMed]
- Ulbricht, A.; Gehlert, S.; Leciejewski, B.; Schiffer, T.; Bloch, W.; Höhfeld, J. Induction and adaptation of chaperone-assisted selective autophagy CASA in response to resistance exercise in human skeletal muscle. Autophagy 2015, 11, 538–546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Plantié, E.; Migocka-Patrza\lek, M.; Daczewska, M.; Jagla, K. Model organisms in the fight against muscular dystrophy: Lessons from Drosophila and zebrafish. Molecules 2015, 20, 6237–6253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dubińska-Magiera, M.; Daczewska, M.; Lewicka, A.; Migocka-Patrza\lek, M.; Niedbalska-Tarnowska, J.; Jagla, K. Zebrafish: A Model for the Study of Toxicants Affecting Muscle Development and Function. Int. J. Mol. Sci. 2016, 17, 1941. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of Embryonic Development of the Zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Westerfield, M. The Zebrafish Book, 5th ed.; University of Oregon Press: Eugene, OR, USA, 2007. [Google Scholar]
- Thisse, C.; Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 2008, 3, 59–69. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Orlowska, K.P.; Klosowska, K.; Szczesny, R.J.; Cysewski, D.; Krawczyk, P.S.; Dziembowski, A. A new strategy for gene targeting and functional proteomics using the DT40 cell line. Nucleic Acids Res. 2013, 41, e167. [Google Scholar] [CrossRef] [PubMed]
- Bill, B.R.; Petzold, A.M.; Clark, K.J.; Schimmenti, L.A.; Ekker, S.C. A Primer for Morpholino Use in Zebrafish. Zebrafish 2009, 6, 69–77. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, J.N.; Sweeney, M.F.; Mably, J.D. Microinjection of Zebrafish Embryos to Analyze Gene Function. J. Vis. Exp. 2009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, L.L.; Beggs, A.H.; Gupta, V.A. Analysis of Skeletal Muscle Defects in Larval Zebrafish by Birefringence and Touch-evoke Escape Response Assays. J. Vis. Exp. 2013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- REYNOLDS, E.S. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J. Cell Biol. 1963, 17, 208–212. [Google Scholar] [CrossRef] [Green Version]
- Granato, M.; van Eeden, F.J.; Schach, U.; Trowe, T.; Brand, M.; Furutani-Seiki, M.; Haffter, P.; Hammerschmidt, M.; Heisenberg, C.P.; Jiang, Y.J.; et al. Genes controlling and mediating locomotion behavior of the zebrafish embryo and larva. Dev. Camb. Engl. 1996, 123, 399–413. [Google Scholar]
- Crippa, V.; Cicardi, M.E.; Ramesh, N.; Seguin, S.J.; Ganassi, M.; Bigi, I.; Diacci, C.; Zelotti, E.; Baratashvili, M.; Gregory, J.M.; et al. The chaperone HSPB8 reduces the accumulation of truncated TDP-43 species in cells and protects against TDP-43-mediated toxicity. Hum. Mol. Genet. 2016, 25, 3908–3924. [Google Scholar] [CrossRef]
- Elicker, K.S.; Hutson, L.D. Genome-wide analysis and expression profiling of the small heat shock proteins in zebrafish. Gene 2007, 403, 60–69. [Google Scholar] [CrossRef] [Green Version]
- Marvin, M.; O’Rourke, D.; Kurihara, T.; Juliano, C.E.; Harrison, K.L.; Hutson, L.D. Developmental expression patterns of the zebrafish small heat shock proteins. Dev. Dyn. 2008, 237, 454–463. [Google Scholar] [CrossRef]
- Bryson-Richardson, R.J.; Daggett, D.F.; Cortes, F.; Neyt, C.; Keenan, D.G.; Currie, P.D. Myosin heavy chain expression in zebrafish and slow muscle composition. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2005, 233, 1018–1022. [Google Scholar] [CrossRef]
- Devoto, S.H.; Melançon, E.; Eisen, J.S.; Westerfield, M. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Dev. Camb. Engl. 1996, 122, 3371–3380. [Google Scholar]
- Yan, X.; Mouillet, J.-F.; Ou, Q.; Sadovsky, Y. A Novel Domain within the DEAD-Box Protein DP103 Is Essential for Transcriptional Repression and Helicase Activity. Mol. Cell. Biol. 2003, 23, 414–423. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jesse, C.M.; Bushuven, E.; Tripathi, P.; Chandrasekar, A.; Simon, C.M.; Drepper, C.; Yamoah, A.; Dreser, A.; Katona, I.; Johann, S.; et al. ALS-Associated Endoplasmic Reticulum Proteins in Denervated Skeletal Muscle: Implications for Motor Neuron Disease Pathology. Brain Pathol. 2017, 27, 781–794. [Google Scholar] [CrossRef] [PubMed]
- Kammoun, M.; Picard, B.; Astruc, T.; Gagaoua, M.; Aubert, D.; Bonnet, M.; Blanquet, V.; Cassar-Malek, I. The Invalidation of HspB1 Gene in Mouse Alters the Ultrastructural Phenotype of Muscles. PLoS ONE 2016, 11, e0158644. [Google Scholar] [CrossRef]
- Middleton, R.C.; Shelden, E.A. Small heat shock protein HSPB1 regulates growth of embryonic zebrafish craniofacial muscles. Exp. Cell Res. 2013, 319, 860–874. [Google Scholar] [CrossRef]
Target Gene | Seq F (Forward Primer) | Seq R (Reverse Primer) |
---|---|---|
Danio rerio ribosomal protein L13a (rpl13a) | CGCTATTGTGGCCAAGCAAG | TCTTGCGGAGGAAAGCCAAA |
Danio rerio actin, beta 1 (actb1) | CGAGCTGTCTTCCCATCCA | TCACCAACGTAGCTGTCTTTCTG |
Danio rerio eukaryotic translation elongation factor 1 alpha 1, like 1 (eef1a1l1) | CTGGAGGCCAGCTCAAACAT | ATCAAGAAGAGTAGTACCGCTAGCATTAC |
hspb8 | CAGCATGACTTCAACCACAAC | CACGGGCTTGGAACAAATAAG |
Name | Sequence | Concentration |
---|---|---|
Morpholino 1 (M1) | 5ʹ-TATAATAATCCCCCTCTGCCATTGT-3ʹ | 0.2 mM |
Morpholino 2 (M2) | 5ʹ-AAACTCTGGATAAAGTGTGTTTGGC-3ʹ | 0.3 mM |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dubińska-Magiera, M.; Niedbalska-Tarnowska, J.; Migocka-Patrzałek, M.; Posyniak, E.; Daczewska, M. Characterization of Hspb8 in Zebrafish. Cells 2020, 9, 1562. https://doi.org/10.3390/cells9061562
Dubińska-Magiera M, Niedbalska-Tarnowska J, Migocka-Patrzałek M, Posyniak E, Daczewska M. Characterization of Hspb8 in Zebrafish. Cells. 2020; 9(6):1562. https://doi.org/10.3390/cells9061562
Chicago/Turabian StyleDubińska-Magiera, Magda, Joanna Niedbalska-Tarnowska, Marta Migocka-Patrzałek, Ewelina Posyniak, and Małgorzata Daczewska. 2020. "Characterization of Hspb8 in Zebrafish" Cells 9, no. 6: 1562. https://doi.org/10.3390/cells9061562
APA StyleDubińska-Magiera, M., Niedbalska-Tarnowska, J., Migocka-Patrzałek, M., Posyniak, E., & Daczewska, M. (2020). Characterization of Hspb8 in Zebrafish. Cells, 9(6), 1562. https://doi.org/10.3390/cells9061562