Epithelial-To-Mesenchymal Transition Markers and CD44 Isoforms Are Differently Expressed in 2D and 3D Cell Cultures of Prostate Cancer Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. 2D-Monolayer Cell Culture and 3D-Spheroid Preparation
2.2. Immunofluorescence and Confocal Microscopy
2.3. Real-Time PCR
2.4. Western Blot
2.5. Statistical Analysis
3. Results
3.1. 2D-Monolayer and 3D-Spheroid Morphology
3.2. E-Cadherin Expression
3.3. Expression of Mesenchymal Markers
3.4. CD44 Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Odero-Marah, V.; Hawsawi, O.; Henderson, V.; Sweeney, J. Epithelial-Mesenchymal Transition (EMT) and Prostate Cancer. Adv. Exp. Med. Biol. 2018, 1095, 101–110. [Google Scholar] [CrossRef]
- Deep, G.; Agarwal, R. Antimetastatic efficacy of silibinin: Molecular mechanisms and therapeutic potential against cancer. Cancer Metast. Rev. 2010, 29, 447–463. [Google Scholar] [CrossRef] [PubMed]
- Thiery, J.P. Epithelial-mesenchymal transitions in tumour progression. Nat. Rev. Cancer 2002, 2, 442–454. [Google Scholar] [CrossRef] [PubMed]
- Peinado, H.; Olmeda, D.; Cano, A. Snail, Zeb and bHLH factors in tumour progression: An alliance against the epithelial phenotype? Nat. Rev. Cancer 2007, 7, 415–428. [Google Scholar] [CrossRef]
- Nieto, M.A.; Cano, A. The epithelial mesenchymal transition under control: Global programs to regulate epithelial plasticity. Semin. Cancer Biol. 2012, 22, 361–368. [Google Scholar] [CrossRef] [PubMed]
- Drivalos, A.; Chrisofos, M.; Efstathiou, E.; Kapranou, A.; Kollaitis, G.; Koutlis, G.; Antoniou, N.; Karanastasis, D.; Dimopoulos, M.A.; Bamias, A. Expression of α5-integrin, α7-integrin, E-cadherin, and N-cadherin in localized prostate cancer. Urol. Oncol. 2016, 34, e11–e18. [Google Scholar] [CrossRef]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef]
- Hotz, B.; Arndt, M.; Dullat, S.; Bahrgava, S.; Buhr, H.J.; Hotz, H.G. Epithelial to Mesenchymal Transition: Expression of the regulators snail, slug, and twist in pancreatic cancer. Clin. Cancer Res. 2007, 13, 4769–4776. [Google Scholar] [CrossRef]
- Celesti, G.; Di Caro, G.; Bianchi, P.; Grizzi, F.; Basso, G.; Marchesi, F.; Doni, A.; Marra, G.; Roncalli, M.; Mantovani, A.; et al. Presence of Twist1-positive neoplastic cells in the stroma of chromosome-unstable colorectal tumors. Gastroenterology 2013, 145, 647–657. [Google Scholar] [CrossRef]
- Du, C.; Zhang, C.; Hassan, S.; Biswas, M.H.; Balaji, K.C. Protein kinase D1 suppresses epithelial-to-mesenchymal transition through phosphorylation of snail. Cancer Res. 2010, 70, 7810–7819. [Google Scholar] [CrossRef]
- Whiteland, H.; Spencer-Harty, S.; Thomas, D.H.; Davies, C.; Morgan, C.; Kynaston, H.; Bose, P.; Fenn, N.; Lewis, P.; Bodger, O.; et al. Putative prognostic epithelial-to- mesenchymal transition biomarkers for aggressive prostate cancer. Exp. Mol. Pathol. 2013, 95, 220–226. [Google Scholar] [CrossRef]
- van Roy, F.; Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol. Life Sci. 2008, 65, 3756–3788. [Google Scholar] [CrossRef] [PubMed]
- Putzke, A.P.; Ventura, A.P.; Bailey, A.M.; Akture, C.; Opoku-Ansah, J.; Celiktas, M.; Hwang, M.S.; Darling, D.S.; Coleman, I.M.; Nelson, P.S.; et al. Metastatic progression of prostate cancer and e-cadherin regulation by zeb1 and SRC family kinases. Am. J. Pathol. 2011, 179, 400–410. [Google Scholar] [CrossRef] [PubMed]
- Umbas, R.; Schalken, J.A.; Aalders, T.W.; Carter, B.S.; Karthaus, H.F.; Schaafsma, H.E.; Debruyne, F.M.; Isaacs, W.B. Expression of the cellular adhesion molecule E-cadherin is reduced or absent in high-grade prostate cancer. Cancer Res. 1992, 52, 5104–5109. [Google Scholar] [PubMed]
- Cheng, L.; Nagabhushan, M.; Pretlow, T.P.; Amini, S.B.; Pretlow, T.G. Expression of E-cadherin in primary and metastatic prostate cancer. Am. J. Pathol. 1996, 148, 1375–1380. [Google Scholar] [PubMed]
- Saha, B.; Arase, A.; Imam, S.S.; Tsao-Wei, D.; Naritoku, W.Y.; Groshen, S.; Jones, L.W.; Imam, S.A. Overexpression of E-cadherin and beta-catenin proteins in metastatic prostate cancer cells in bone. Prostate 2008, 68, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Pontes, J., Jr.; Srougi, M.; Borra, P.M.; Dall’Oglio, M.F.; Ribeiro-Filho, L.A.; Leite, K.R. Ecadherin and beta-catenin loss of expression related to bone metastasis in prostate cancer. Appl. Immunohistochem. Mol. Morphol. 2010, 18, 179–184. [Google Scholar] [CrossRef]
- Rubin, M.A.; Mucci, N.R.; Figurski, J.; Fecko, A.; Pienta, K.J.; Day, M.L. E-cadherin expression in prostate cancer: A broad survey using high-density tissue microarray technology. Hum. Pathol. 2001, 32, 690–697. [Google Scholar] [CrossRef]
- De Marzo, A.M.; Knudsen, B.; Chan-Tack, K.; Epstein, J.I. E-cadherin expression as a marker of tumor aggressiveness in routinely processed radical prostatectomy specimens. Urology 1999, 53, 707–713. [Google Scholar] [CrossRef]
- Mani, S.A.; Guo, W.; Liao, M.J.; Eaton, E.N.; Ayyanan, A.; Zhou, A.Y.; Brooks, M.; Reinhard, F.; Zhang, C.C.; Shipitsin, M.; et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008, 133, 704–715. [Google Scholar] [CrossRef] [PubMed]
- Celià-Terrassa, T.; Meca-Cortés, O.; Mateo, F.; Martínez de Paz, A.; Rubio, N.; Arnal-Estapé, A.; Ell, B.J.; Bermudo, R.; Díaz, A.; Guerra-Rebollo, M.; et al. Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells. J. Clin. Investig. 2012, 122, 1849–1868. [Google Scholar] [CrossRef]
- Xu, H.; Tian, Y.; Yuan, X.; Wu, H.; Liu, Q.; Pestell, R.G.; Wu, K. The role of CD44 in epithelial–mesenchymal transition and cancer development. Onco Targets Ther. 2015, 8, 3783–3792. [Google Scholar] [CrossRef] [PubMed]
- Shang, Z.; Cai, Q.; Zhang, M.; Zhu, S.; Ma, Y.; Sun, L.; Jiang, N.; Tian, J.; Niu, X.; Chen, J.; et al. A switch from CD44+ cell to EMT cell drives the metastasis of prostate cancer. Oncotarget 2015, 6, 1202–1216. [Google Scholar] [CrossRef] [PubMed]
- Lau, W.M.; Teng, E.; Chong, H.S.; Lopez, K.A.; Tay, A.Y.; Salto-Tellez, M.; Shabbir, A.; So, J.B.; Chan, S.L. CD44v8-10 is a cancer-specific marker for gastric cancer stem cells. Cancer Res. 2014, 74, 2630–2641. [Google Scholar] [CrossRef] [PubMed]
- Olsson, E.; Honeth, G.; Bendahl, P.O.; Saal, L.H.; Gruvberger-Saal, S.; Ringner, M.; Vallon-Christersson, J.; Jönsson, G.; Holm, K.; Lövgren, K.; et al. CD44 isoforms are heterogeneously expressed in breast cancer and correlate with tumor subtypes and cancer stem cell markers. BMC Cancer 2011, 11, 418. [Google Scholar] [CrossRef] [PubMed]
- Bissell, M.J. Architecture is the Message: The role of extracellular matrix and 3-D structure in tissue-specific gene expression and breast cancer. Pezcoller Found. J. 2007, 16, 2–17. [Google Scholar]
- Eritja, N.; Dolcet, X.; Matias-Guiu, X. Three-dimensional epithelial cultures: A tool to model cancer development and progression. Histol. Histopathol. 2013, 28, 1245–1256. [Google Scholar] [CrossRef]
- Lovitt, C.J.; Shelper, T.B.; Avery, V.M. Advanced cell culture techniques for cancer drug discovery. Biology 2014, 3, 345–367. [Google Scholar] [CrossRef]
- Kunz-Schughart, L.A. Multicellular tumor spheroids: Intermediates between monolayer culture and in vivo tumor. Cell Biol. Int. 1999, 23, 157–161. [Google Scholar] [CrossRef]
- Gagliano, N.; Celesti, G.; Tacchini, L.; Pluchino, S.; Sforza, C.; Rasile, M.; Valerio, V.; Laghi, L.; Conte, V.; Procacci, P. Epithelial-to-mesenchymal transition in pancreatic ductal adenocarcinoma: Characterization in a 3D-cell culture model. World J. Gastroenterol. 2016, 22, 4466–4483. [Google Scholar] [CrossRef] [PubMed]
- Gagliano, N.; Sforza, C.; Sommariva, M.; Menon, A.; Conte, V.; Sartori, P.; Procacci, P. 3D-spheroids: What can they tell us about pancreatic ductal adenocarcinoma cell phenotype? Exp. Cell Res. 2017, 357, 299–309. [Google Scholar] [CrossRef] [PubMed]
- Haq, S.; Samuel, V.; Haxho, F.; Akasov, R.; Leko, M.; Burov, S.V.; Markvicheva, E.; Szewczuk, M.R. Sialylation facilitates self-assembly of 3D multicellular prostaspheres by using cyclo-RGDfK(TPP) peptide. Onco Targets Ther. 2017, 10, 2427–2447. [Google Scholar] [CrossRef] [PubMed]
- Härmä, V.; Virtanen, J.; Mäkelä, R.; Happonen, A.; Mpindi, J.P.; Knuuttila, M.; Kohonen, P.; Lötjönen, J.; Kallioniemi, O.; Nees, M. A comprehensive panel of three-dimensional models for studies of prostate cancer growth, invasion and drug responses. PLoS ONE 2010, 5, e10431. [Google Scholar] [CrossRef] [PubMed]
- Brabletz, T.; Jung, A.; Spaderna, S.; Hlubek, F.; Kirchner, T. Opinion: Migrating cancer stem cells—An integrated concept of malignant tumour progression. Nat. Rev. Cancer 2005, 5, 744–749. [Google Scholar] [CrossRef] [PubMed]
- Dalerba, P.; Cho, R.W.; Clarke, M.F. Cancer stem cells: Models and concepts. Annu. Rev. Med. 2007, 58, 267–284. [Google Scholar] [CrossRef]
- Scholzen, T.; Gerdes, J. The Ki-67 protein: From the known and the unknown. J. Cell Physiol. 2000, 182, 311–322. [Google Scholar] [CrossRef]
- Christiansen, J.J.; Rajasekaran, A.K. Reassessing epithelial to mesenchymal transition as a prerequisite for carcinoma invasion and metastasis. Cancer Res. 2006, 66, 8319–8326. [Google Scholar] [CrossRef]
- Cates, J.M.; Byrd, R.H.; Fohn, L.E.; Tatsas, A.D.; Washington, M.K.; Black, C.C. Epithelial-mesenchymal transition markers in pancreatic ductal adenocarcinoma. Pancreas 2009, 38, e1–e6. [Google Scholar] [CrossRef]
- Giroldi, L.A.; Schalken, J.A. Decreased expression of the intercellular adhesion molecule E-cadherin in prostate cancer: Biological significance and clinical implications. Cancer Metast. Rev. 1993, 12, 29–37. [Google Scholar] [CrossRef]
- Rios-Doria, J.; Day, K.C.; Kuefer, R.; Rashid, M.G.; Day, M.L. Calpain-mediated inactivation of E-cadherin in prostate and mammary epithelial cells. J. Biol. Chem. 2003, 278, 1372–1379. [Google Scholar] [CrossRef] [PubMed]
- Kuefer, R.; Hofer, M.D.; Gschwend, J.E.; Pienta, K.J.; Sanda, M.G.; Chinnaiyan, A.M.; Rubin, M.A.; Day, M.L. The role of an 80 kDa fragment of E-cadherin in the metastatic progression of prostate cancer. Clin. Cancer Res. 2003, 9, 6447–6452. [Google Scholar] [PubMed]
- Wheelock, M.J.; Buck, C.A.; Bechtol, K.B.; Damsky, C.H. Soluble 80-kd fragment of cell-CAM 120/80 disrupts cell-cell adhesion. J. Cell Biochem. 1987, 34, 187–202. [Google Scholar] [CrossRef] [PubMed]
- David, J.M.; Rajasekaran, A.K. Dishonorable Discharge: The Oncogenic Roles of Cleaved E-Cadherin Fragments. Cancer Res. 2012, 72, 2917–2923. [Google Scholar] [CrossRef] [PubMed]
- De Wever, O.; Derycke, L.; Hendrix, A.; De Meerleer, G.; Godeau, F.; Depypere, H.; Bracke, M. Soluble cadherins as cancer biomarkers. Clin. Exp. Metast. 2007, 24, 685–697. [Google Scholar] [CrossRef]
- Noe, V.; Fingleton, B.; Jacobs, K.; Crawford, H.C.; Vermeulen, S.; Steelant, W.; Bruyneel, E.; Matrisian, L.M.; Mareel, M. Release of an invasion promoter E-cadherin fragment by matrilysin and stromelysin-1. J. Cell Sci. 2001, 114, 111–118. [Google Scholar]
- Lochter, A.; Galosy, S.; Muschler, J.; Freedman, N.; Werb, Z.; Bissell, M.J. Matrix metalloproteinase stromelysin-1 triggers a cascade of molecular alterations that leads to stable epithelial-to-mesenchymal conversion and a premalignant phenotype in mammary epithelial cells. J. Cell Biol. 1997, 139, 1861–1872. [Google Scholar] [CrossRef]
- Yilmaz, M.; Christofori, G. Mechanisms of motility in metastasizing cells. Mol. Cancer Res. 2010, 8, 629–642. [Google Scholar] [CrossRef]
- Bronsert, P.; Enderle-Ammour, K.; Bader, M.; Timme, S.; Kuehs, M.; Csanadi, A.; Kayser, G.; Kohler, I.; Bausch, D.; Hoeppner, J.; et al. Cancer cell invasion and EMT marker expression—A three-dimensional study of the human cancer-host interface. J. Pathol. 2014, 234, 410–422. [Google Scholar] [CrossRef]
- Guarino, M.; Rubino, B.; Ballabio, G. The role of epithelial-mesenchymal transition in cancer pathology. Pathology 2007, 39, 305–318. [Google Scholar] [CrossRef]
- Emadi Baygi, M.; Soheili, Z.S.; Schmitz, I.; Sameie, S.; Schulz, W.A. Snail regulates cell survival and inhibits cellular senescence in human metastatic prostate cancer cell lines. Cell Biol. Toxicol. 2010, 26, 553–567. [Google Scholar] [CrossRef] [PubMed]
- McKeithen, D.; Graham, T.; Chung, L.W.; Odero-Marah, V. Snail transcription factor regulates neuroendocrine differentiation in LNCaP prostate cancer cells. Prostate 2010, 70, 982–992. [Google Scholar] [CrossRef] [PubMed]
- Mak, P.; Leav, I.; Pursell, B.; Bae, D.; Yang, X.; Taglienti, C.A.; Gouvin, L.M.; Sharma, V.M.; Mercurio, A.M. ERbeta impedes prostate cancer EMT by destabilizing HIF-1alpha and inhibiting VEGF-mediated snail nuclear localization: Implications for Gleason grading. Cancer Cell 2010, 17, 319–332. [Google Scholar] [CrossRef] [PubMed]
- Hwang, W.L.; Yang, M.H.; Tsai, M.L.; Lan, H.Y.; Su, S.H.; Chang, S.C.; Teng, H.W.; Yang, S.H.; Lan, Y.T.; Chiou, S.H.; et al. SNAIL regulates interleukin-8 expression, stem cell-like activity, and tumorigenicity of human colorectal carcinoma cells. Gastroenterology 2011, 141, 279–291.e5. [Google Scholar] [CrossRef] [PubMed]
- Heeboll, S.; Borre, M.; Ottosen, P.D.; Dyrskjot, L.; Orntoft, T.F.; Torring, N. Snail1 is over-expressed in prostate cancer. APMIS 2009, 117, 196–204. [Google Scholar] [CrossRef] [PubMed]
- Figiel, S.; Vasseur, C.; Bruyere, F.; Rozet, F.; Maheo, K.; Fromont, G. Clinical significance of epithelial-mesenchymal transition markers in prostate cancer. Hum. Pathol. 2017, 61, 26–32. [Google Scholar] [CrossRef] [PubMed]
- Friedl, P.; Locker, J.; Sahai, E.; Segall, J.E. Classifying collective cancer cell invasion. Nat. Cell Biol. 2012, 14, 777–783. [Google Scholar] [CrossRef]
- Das, R.; Gregory, P.A.; Hollier, B.G.; Tilley, W.D.; Selth, L.A. Epithelial plasticity in prostate cancer: Principles and clinical perspectives. Trends Mol. Med. 2014, 20, 643–651. [Google Scholar] [CrossRef]
- Ponta, H.; Sherman, L.; Herrlich, P.A. CD44: From adhesion molecules to signalling regulators. Nat. Rev. Mol. Cell Biol. 2003, 4, 33–45. [Google Scholar] [CrossRef]
- Zoller, M. CD44: Can a cancer-initiating cell profit from an abundantly expressed molecule? Nat. Rev. Cancer 2011, 11, 254–267. [Google Scholar] [CrossRef]
- Keysar, S.B.; Jimeno, A. More than markers: Biological significance of cancer stem cell-defining molecules. Mol. Cancer Ther. 2010, 9, 2450–2457. [Google Scholar] [CrossRef]
- Brown, R.L.; Reinke, L.M.; Damerow, M.S.; Perez, D.; Chodosh, L.A.; Yang, J.; Cheng, C. CD44 splice isoform switching in human and mouse epithelium is essential for epithelial-mesenchymal transition and breast cancer progression. J. Clin. Investig. 2011, 121, 1064–1074. [Google Scholar] [CrossRef] [PubMed]
- Preca, B.T.; Bajdak, K.; Mock, K.; Sundararajan, V.; Pfannstiel, J.; Maurer, J.; Wellner, U.; Hopt, U.T.; Brummer, T.; Brabletz, S.; et al. A self-enforcing CD44s/ZEB1 feedback loop maintains EMT and stemness properties in cancer cells. Int. J. Cancer 2015, 137, 2566–2577. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.J.; Yin, B.; Christudass, C.S.; Terada, N.; Rajagopalan, K.; Fabry, B.; Lee, D.Y.; Shiraishi, T.; Getzenberg, R.H.; Veltri, R.W.; et al. Acquisition of paclitaxel resistance is associated with a more aggressive and invasive phenotype in prostate cancer. J. Cell Biochem. 2013, 114, 1286–1293. [Google Scholar] [CrossRef] [PubMed]
- Moura, C.M.; Pontes, J., Jr.; Reis, S.T.; Viana, N.I.; Morais, D.R.; Dip, N.; Katz, B.; Srougi, M.; Leite, K.R. Expression profile of standard and variants forms of CD44 related to prostate cancer behavior. Int. J. Biol. Markers 2015, 30, e49–e55. [Google Scholar] [CrossRef] [PubMed]
- Iczkowski, K.A. Cell adhesion molecule CD44: Its functional roles in prostate cancer. Am. J. Transl. Res. 2010, 3, 1–7. [Google Scholar] [PubMed]
- Vega, S.; Morales, A.V.; Ocaña, O.H.; Valdés, F.; Fabregat, I.; Nieto, M.A. Snail blocks the cell cycle and confers resistance to cell death. Genes Dev. 2004, 18, 1131–1143. [Google Scholar] [CrossRef]
- Morel, A.P.; Lièvre, M.; Thomas, C.; Hinkal, G.; Ansieau, S.; Puisieux, A. Generation of breast cancer stem cells through epithelial-mesenchymal transition. PLoS ONE 2008, 3, e2888. [Google Scholar] [CrossRef]
- Wang, M.; Ren, D.; Guo, W.; Huang, S.; Wang, Z.; Li, Q.; Du, H.; Song, L.; Peng, X. N-cadherin promotes epithelial-mesenchymal transition and cancer stem cell-like traits via ErbB signaling in prostate cancer cells. Int. J. Oncol. 2016, 48, 595–606. [Google Scholar] [CrossRef]
- Ni, J.; Cozzi, P.J.; Hao, J.L.; Beretov, J.; Chang, L.; Duan, W.; Shigdar, S.; Delprado, W.J.; Graham, P.H.; Bucci, J.; et al. CD44 variant 6 is associated with prostate cancer metastasis and chemo-/radioresistance. Prostate 2014, 74, 602–617. [Google Scholar] [CrossRef]
- Zhao, S.; He, J.L.; Qiu, Z.X.; Chen, N.Y.; Luo, Z.; Chen, B.J.; Li, W.M. Prognostic value of CD44 variant exon 6 expression in non-small cell lung cancer: A meta-analysis. Asian Pac. J. Cancer Prev. 2014, 15, 6761–6776. [Google Scholar] [CrossRef] [PubMed]
- Todaro, M.; Gaggianesi, M.; Catalano, V.; Benfante, A.; Iovino, F.; Biffoni, M.; Apuzzo, T.; Sperduti, I.; Volpe, S.; Cocorullo, G.; et al. CD44v6 is a marker of constitutive and reprogrammed cancer stem cells driving colon cancer metastasis. Cell Stem Cell 2014, 14, 342–356. [Google Scholar] [CrossRef]
- Yu, P.; Zhou, L.; Ke, W.; Li, K. Clinical significance of pAKT and CD44v6 overexpression with breast cancer. J. Cancer Res. Clin. Oncol. 2010, 136, 1283–1292. [Google Scholar] [CrossRef] [PubMed]
- Erb, H.H.H.; Guggenberger, F.; Santer, F.R.; Culig, Z. Interleukin-4 induces a CD44high /CD49bhigh PC3 subpopulation with tumor-initiating characteristics. J. Cell Biochem. 2018, 119, 4103–4112. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Forward | Primer Reverse |
---|---|---|
GAPDH | CCCTTCATTGACCTCAACTACATG | TGGGATTTCCATTGATGACAAGC |
E-cadherin | GAACGCATTGCCACATACAC | GAATTCGGGCTTGTTGTCAT |
N-cadherin | CCTGAGGGATCAAAGCCTGGAAC | TTGGAGCCTGAGACACGATTCTG |
Snail | CTTCCAGCAGCCCTACGAC | CGGTGGGGTTGAGGATCT |
Slug | TGTTTGCAAGATCTGCGGC | TGCAGTCAGGGCAAGAAAAA |
Twist | AGCAAGATTCAGACCCTCAAGCT | CCTGGTAGAGGAAGTCGATGTACCT |
Zeb1 | GAAAGTCATCCAGCCAAATGG | ACTTGGTTCTCAGCTTGGGGAATCA |
CD44s | GGAGCAGCACTTCAGGAGGTTAC | GGAATGTGTCTTGGTCTCTGGTAGC |
CD44v2 | ATCACCGACAGCACAGACAGAAT | AACCATGAAAACCAATCCCAGG |
CD44v6 | CCAGGCAACTCCTAGTAGTACAACG | CGAATGGGAGTCTTCTTTGGGT |
CD44v7 | GCCTCAGCTCATACCAGCCATC | TCCTTCTTCCTGCTTGATGACCT |
CD44v9 | AGCAGAGTAATTCTCAGAGC | TGATGTCAGAGTAGAAGTTGTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fontana, F.; Raimondi, M.; Marzagalli, M.; Sommariva, M.; Limonta, P.; Gagliano, N. Epithelial-To-Mesenchymal Transition Markers and CD44 Isoforms Are Differently Expressed in 2D and 3D Cell Cultures of Prostate Cancer Cells. Cells 2019, 8, 143. https://doi.org/10.3390/cells8020143
Fontana F, Raimondi M, Marzagalli M, Sommariva M, Limonta P, Gagliano N. Epithelial-To-Mesenchymal Transition Markers and CD44 Isoforms Are Differently Expressed in 2D and 3D Cell Cultures of Prostate Cancer Cells. Cells. 2019; 8(2):143. https://doi.org/10.3390/cells8020143
Chicago/Turabian StyleFontana, Fabrizio, Michela Raimondi, Monica Marzagalli, Michele Sommariva, Patrizia Limonta, and Nicoletta Gagliano. 2019. "Epithelial-To-Mesenchymal Transition Markers and CD44 Isoforms Are Differently Expressed in 2D and 3D Cell Cultures of Prostate Cancer Cells" Cells 8, no. 2: 143. https://doi.org/10.3390/cells8020143