Next Article in Journal
Stefin B and Cystatin C Deficiency Suppresses Tumor Growth and Alters Tumor Microenvironment in a Breast Cancer Model
Previous Article in Journal
Metabolic Syndrome Predisposes Ossabaw Minipig Retina to an Early Neurodegenerative Milieu
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 15
Issue 4
10.3390/cells15040359
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Wnt5a Regulates Embryonic Müllerian Duct Development Through the Non-Canonical Wnt PCP Pathway

by
Isaac Kyei-Barffour
1,†,
Sarah Williams
2,†,
Bhawna Kushawaha
3 and
Emanuele Pelosi
3,4,*
1
Institute for Molecular Bioscience, The University of Queensland, Brisbane, QLD 4072, Australia
2
Queensland Cyber Infrastructure Foundation, The University of Queensland, Brisbane, QLD 4072, Australia
3
Department of Biochemistry, Molecular Biology, and Pharmacology, Indiana University School of Medicine, Indianapolis, IN 46202, USA
4
Centre for Clinical Research, The University of Queensland, Brisbane, QLD 4029, Australia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cells 2026, 15(4), 359; https://doi.org/10.3390/cells15040359
Submission received: 5 January 2026 / Revised: 5 February 2026 / Accepted: 14 February 2026 / Published: 17 February 2026
Browse Figures
Versions Notes

Abstract

Müllerian anomalies are anatomical variations of the female reproductive tract resulting from the incomplete development of the embryonic Müllerian ducts. The molecular mechanisms driving Müllerian duct development are complex and poorly understood, resulting in the largely unexplained aetiology of these conditions. WNT5A is a critical regulator of key developmental processes, including patterning, cell proliferation, and migration. Mutations of WNT5A have been associated with Robinow syndrome, a congenital condition characterized by skeletal and genital anomalies. In the mouse, WNT5A is necessary for the posterior development of the Müllerian duct, and ablation of Wnt5a results in vaginal agenesis. However, Wnt5a-/- uterine horns are hypoplastic and over 60% shorter than the wild type, suggesting specific functions in anterior Müllerian duct development. To better understand the role of Wnt5a, we performed single-cell RNA sequencing of developing Müllerian ducts. We found that the non-canonical Wnt PCP pathway was dysregulated in Wnt5a-/- mice. In addition, Wnt5a-/- Müllerian ducts were enriched in oviductal mesenchymal cells due to the transformation of the anterior uterine horns into oviducts. Our results indicate additional roles for Wnt5a during Müllerian duct development, prompting further investigations into uterine functions and anatomy in complex clinical cases of Müllerian anomalies including Robinow syndrome.

1. Introduction

In mammals, the female reproductive tract consists of the oviducts, uterus, and cervix, as well as the upper part of the vagina, and provides the site for oocyte fertilization, implantation, and embryo development. The female reproductive tract rises from the Müllerian ducts, a pair of primordial genital ducts that form in the intermediate mesoderm during early embryogenesis. Müllerian duct development is complex and involves the coordination of several molecular and cellular events. In the mouse, this process occurs between 11.5 and 13.5 days post coitum (dpc) and is typically divided into three main phases [1,2]. First, cells within the anterior coelomic epithelium of the mesonephros become Müllerian progenitor cells and proliferate to form a placode thickening [3]. Although the specific molecular mechanisms involved remain unclear, critical pathways for the specification of progenitor cells include BMP and FGF signalling [4]. These progenitors will form the Müllerian epithelium and—together with progenitors delaminating from the coelomic mesonephric epithelium and following epithelial–mesenchymal transition (EMT)—the Müllerian mesenchyme [5]. Subsequently, Müllerian progenitor cells start invading the mesonephric mesenchyme towards the neighbouring Wolffian ducts. Critical factors regulating this invagination process include LHX1 and WNT4, which are expressed in the epithelial and mesenchymal precursors, respectively [3,6]. In the third phase, the nascent ducts elongate posteriorly through cell proliferation and migration, using the Wolffian duct as a guide [3,7]. Müllerian duct elongation is regulated by inductive signals, including WNT9B and GATA3 from the Wolffian ducts, WNT4 from the mesonephric mesenchyme, and the PI3K pathway [2,5,8]. At 13.5 dpc, the two Müllerian ducts reach the urogenital sinus and fuse to form the utero-vaginal duct, which will give rise to the posterior portion of the uterus, cervix and upper vagina [3].
Subsequent to this stage of development, the Müllerian ducts start a differentiation process that will lead to the establishment of specialized cell populations and functionally distinct regions [9,10,11]. HOX, retinoic acid (RA), and WNT signalling are critical for the differentiation of the Müllerian ducts. Differential expression of Hox genes, which are expressed as early as 14.5–15.5 dpc, controls the segmentation of the Müllerian ducts [12,13,14]. Hoxa9/d9 are predominantly expressed in the anterior region that will form the oviducts. Hoxa10/d10 and Hoxa11/d11 are expressed in the middle sections of the uterine horns, and Hoxa13/d13 in the caudal region that will develop into the cervix and vagina [15]. In a similar way, starting from 14.5dpc, a concentration gradient of RA along the ducts induces oviduct, uterine, and vaginal differentiation [16]. Additionally, both the canonical and non-canonical Wnt pathways play critical roles throughout the formation, development, and differentiation of the Müllerian duct, regulating cell polarity, proliferation, migration, and EMT. Ablation of Ctnnb1 in the Müllerian mesenchyme results in uterine hypoplasia, uncoiled oviducts, and a reduced number of uterine glands [17]. Conversely, constitutive stabilization of CTNNB1 leads to an increased number of glands, although uterine length is significantly reduced, suggesting a defect in Müllerian duct elongation [18]. In addition to Müllerian duct formation, Wnt4 is involved in the differentiation of the Müllerian luminal epithelium and the development of uterine glands, as demonstrated by conditional ablation studies [6,19]. Ablation of Wnt7a also leads to uterine hypoplasia, uncoiled oviducts, and a lack of glands [20,21]. Interestingly, Hoxa10 and Hoxa11 are downregulated in Wnt7a-/- uteri, which show a posterior homeotic transformation, with oviducts becoming uterus and the uterus differentiating to the vagina [20].
WNT5A is a critical factor regulating tissue morphogenesis, primarily through the non-canonical planar cell polarity (PCP) pathway [22]. Ablation of Wnt5a in the mouse causes the absence of a vagina and shorter uterine horns [23]. In kidney capsule graft experiments, Wnt5a was found to be postnatally necessary for uterine glandular genesis, independent of canonical factor Lef1. Wnt5a was also found to be required for the estrogen-directed regulation of Wnt7a, Hoxa10, and Hoxa11, which failed to be downregulated compared to controls [23]. In addition, conditional ablation of both Wnt4 and Wnt5a in the Müllerian ducts resulted in variable phenotypes, including uterine aplasia, a reduced number of glands, and cervicovaginal agenesis [24]. In humans, WNT5A variants are associated with autosomal dominant Robinow syndrome, a condition characterized by skeletal, renal, and reproductive tract anomalies (OMIM #180700) [25,26,27]. Affected females display hypoplasia of the clitoris and labia minora, consistent with the abnormality of the posterior reproductive tract observed in Wnt5a-/- mice [25,26,28].
However, the role that WNT5A plays in the development of the anterior reproductive tract remains largely uncharacterized. Given that WNT5A regulates several processes that are fundamental during embryogenesis, we sought to explore its involvement in Müllerian duct development. We found that in Wnt5a-/- Müllerian ducts, cell proliferation was significantly reduced due to inhibition of the PCP pathway. In addition, ablation of Wnt5a resulted in the anteriorization of the uterine horns, with downregulation of Hoxa10 and upregulation of oviduct markers Hoxa7 and Foxl2. These results suggest that WNT5A and the PCP pathway are necessary for proper anterior female reproductive tract development by regulating cell-fate decisions and patterning.

2. Materials and Methods

2.1. Mouse Strains

Wnt5a+/- mice were obtained from Dr. Benjamin Hogan at the Institute for Molecular Biosciences of the University of Queensland and maintained on a C57BL/6 genetic background [29]. Wnt5a-/- embryos were generated by crossing Wnt5a+/- breeders. Genotyping was done according to the provider’s protocol. Samples were collected at 18.5 days post coitum (dpc). All animal procedures were approved by the University of Queensland Animal Ethics Committee.

2.2. RNA Expression Analyses

Samples were stored in RNAlater (Invitrogen, Carlsbad, CA, USA), and total RNA was extracted using an RNAeasy mini kit (Qiagen, Hilden, Germany). For real-time PCR of the Wnt pathway, an RT2 Profiler PCR Array (Qiagen, Hilden, Germany) was used, following manufacturer’s protocol. Real-time PCR of additional genes was done using a SYBR Green PCR master mix (Applied Biosystems, Waltham, MA, USA) on cDNA generated by a high-capacity cDNA reverse transcription kit (Applied Biosystems). Expression was normalised to Tbp. Primers for the following genes were used: Ror2 Fw: GGGAACCGGACTATTTATGTGG, Ror2 Rev: AAGACGAAGTGGCAGAAGG; Vangl2 Fw: GTGTGCTTTGGACAGGGAGC, Vangl2 Rev: CACCTCCTTCAGCACAGGCT; Rac1 Fw: TGCTTTTCCCTTGTGAGTCC, Rac1 Rev: TCAGCTTCTCAATGGTGTCC; Fos Fw: TCCTTACGGACTCCCCAC, Fos Rev: CTCCGTTTCTCTTCCTCTTCAG; Tbp Fw: ACGGACAACTGCGTTGATTTT, Tbp Rev: ACTTAGCTGGGAAGCCCAAC. Three biological replicates were used for all real-time PCR assays, which were run on a QuantStudio3 system (Applied Biosystems, Waltham, MA, USA).

2.3. Histology and Immunofluorescence

Müllerian duct samples were fixed overnight in 4% paraformaldehyde phosphate-buffered saline (PBS), embedded in paraffin and sectioned at 5 μm. Müllerian duct sections were deparaffinized in xylene and rehydrated using decreasing alcohol concentrations. Heat-mediated antigen retrieval was performed in Tris-based buffer (Vector, Newark, CA, USA). Immunofluorescence was done as previously described [11] using the following primary antibodies: CDH1 (1:100, BD Biosciences, Franklin Lakes, NJ, USA, #610182), PH3 (1:100, Abcam, Cambridge, UK, #5176), LAMA (1:100, Sigma, St. Louis, MO, USA, #L9393), PAX2 (1:100, BioLegend, San Diego, CA, USA, #901001), SMA (1:100, Sigma #A2547), CTNBB1 (1:100, Millipore, Burlington, MA, USA, #05-665), VIM (1:200, Abcam #92547), JUN (1:100, Cell Signaling, Danvers, MA, USA, #9165), FOS (1:100, Novus Biologicals, Centennial, CO, USA, NBP1-89065), Phospho-JUN (1:100, Abcam ab32385), FOXL2 (1:100, Novus Biologicals, Centennial, CO, USA, #NB100–1277), and H2AX (1:200, Abcam ab26350). Images were taken on an LSM710 confocal microscope (Zeiss, Jena, Germany) and processed using Adobe Photoshop. Quantification of fluorescence intensity was done using ImageJ (version 1.53t).

2.4. Single-Cell RNA Sequencing

Uterine horns were dissected and incubated in DMEM/F12/Collagenase/Hyaluronidase/FBS (Stemcell) for 60 min at 37 °C. Tissues were subsequently centrifuged at 300× g for 5 min, and cells were resuspended in 0.25% Trypsin–EDTA before being incubated for 5 min in Modified Hanks’ Balanced Salt Solution (HBSS, Stemcell) supplemented with 10% FBS. After centrifugation, cells were resuspended in 1 mg/mL DNaseI (Stemcell), washed three times in HBSS, resuspended in PBS, and counted to evaluate viability and concentration. The single-cell suspension was partitioned and barcoded using a 10X Genomics Chromium Controller (10X Genomics, Pleasanton, CA, USA) and the Single Cell3′ Library and Gel BeadKit v3.1(V3.1; 10X Genomics; Pleasanton, CA, USA, PN-1000121). Cells were loaded onto a Chromium Single Cell ChipG (10X Genomics; Pleasanton, CA, USA, PN-1000120) to target 10,000 cells. GEM generation and barcoding, cDNA amplification and library construction were performed according to the 10X Genomics Chromium User Guide. The resulting single-cell transcriptome libraries contained unique sample indices for each sample. The libraries were quantified on an Agilent BioAnalyzer 2100 using a High Sensitivity DNA Kit (Agilent, Santa Clara, CA, USA, 5067–4626). Libraries were pooled in equimolar ratios, and the pool was quantified by qRT-PCR using a KAPA Library Quantification Kit, (KAPA Biosystems, Wilmington, MA, USA, KK4824) in combination with a Life Technologies ViiA 7 real-time PCR instrument. Denatured libraries were loaded onto an Illumina NextSeq-500 (Illumina, San Diego, CA, USA) and sequenced over 2 runs using a 150-cycle High-Output Kit as follows: 28bp (Read1), 8bp (i7index) and 111bp (Read2). For additional sequencing, denatured libraries were loaded onto an Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) and sequenced using one SP100 cycle flow cell and one S1100 cycle flow cell as follows: 28bp (Read1), 8bp (i7index) and 91bp (Read2). Read1 supplies the cell barcode and UMI, i7 corresponds to the sample index, and Read2 sequences the 3′ sequence of the transcript. Data preprocessing was performed using CellRanger 3.0.2 (10x Genomics, Pleasanton, CA, USA) and a mouse GRCm38 reference. The final read depth was ∼18,000–26,000 reads per cell across all samples. Library preparation and NextSeq sequencing were performed at the Institute for Molecular Bioscience Sequencing Facility (University of Queensland). NovaSeq sequencing was performed at Microba (Translational Research Institute).

2.5. Analysis of Single-Cell RNA Sequencing

After data processing using CellRanger (v3.02), count matrices were loaded into R and analysed in a bioconductor/SingleCellExperiment environment using the scran (v1.20.1) [30] and scater (v1.20.0) packages [31] for QC and initial processing. Normalised log-scale counts were calculated with the deconvolution method described in [32]. Cells with fewer than 1500 UMIs or more than 10% of hemoglobin gene content were removed. Potential doublets were identified with scrublet (v0.2.3) [33] and removed (having a scrublet score over a manually defined threshold of 0.3). Cell-cycle phases were annotated with the cyclone method [34].
To create a reduced-dimensionality UMAP representation, first the 1000 most biologically variable genes were estimated with the modelGeneVar function in the scran package. To minimise the influence of the cell cycle on the layout, the log-count genes were ‘corrected’ for the cell-cycle stage with (regressBatches) before calculation of principal components. The first 20 principal components were used to create the UMAP layout.
Cell clusters were defined from these same corrected principal components using the louvain method (k = 20) [35] from the igraph packages (v1.2.6) [36]. Cluster marker genes were identified by looking for enriched genes in each cluster when contrasted with an average of all other clusters using a pseudobulk approach with voom, limma (v3.48.0) [37] and topconfects (p = 0.05, v1.8.0) [38]. Only genes expressed in at least 3 clusters/sample groups with at least 20 total UMIs were considered. Cell types were manually determined. Clusterwise differential expression between Wnt5a knockout samples and the WT was calculated based on normalised counts of individual cells with limma, with sample and condition included in the model (v3.48.0) [37]. Each cluster was tested independently, and only genes with an average of 0.02 (1 per 50) reads per cell within the cluster were considered. For the analysis of differentially expressed genes, the fold change was set to ±1.5, and the false discovery rate was set to ≤0.05. Pathway and bioinformatic analyses were done using DAVID Bioinformatics Resources, Ingenuity Pathway Analysis (IPA, Qiagen), and Enrichr [39,40].

2.6. Statistical Analyses

For gene expression using real-time PCR, statistical analysis was performed using an unpaired t-test (GraphPad). Data were represented as mean expression levels, along with the standard error of the mean.

3. Results

3.1. Loss of Wnt5a Disrupts Elongation and Differentiation of the Developing Müllerian Duct

By the end of embryonic development at 18.5 dpc, Wnt5a-/- female reproductive tracts completely lacked a vagina, as previously reported (Figure 1A) [23]. Wnt5a-/- uterine horns were over 60% shorter than wild-type controls, suggesting that Müllerian duct elongation was impaired, in addition to a posterior defect at the Müllerian tubercle, the site of vaginal formation (Figure 1A,B) [41]. To further characterize this process and assess if the defect in Müllerian duct development was due to reduced proliferation or increased apoptosis, we performed immunofluorescence staining using antibodies against proliferative marker PH3, and apoptotic markers cleaved CASP3 and H2AX at 13.5 dpc and 18.5 dpc. At both stages, PH3 expression was significantly reduced in Wnt5a-/- samples, with a decrease in PH3-positive cells by 75% and 72% compared to the wild type, respectively (Figure 1C–E). Conversely, no differences in CASP3 and H2AX were detected (Supplementary Figure S1). At 18.5 dpc, when Müllerian duct development was completed, staining of epithelial marker CDH1 and basement membrane component LAMA1 did not show significant differences between Wnt5a-/- and controls (Figure 2A). However, staining of epithelial marker PAX2 showed a more cuboidal than columnar epithelium in Wnt5a-/- ducts (Figure 2B). This feature, in combination with reduced cell proliferation, was reminiscent of some phenotypic aspects of CTNNB1 stabilization [10]. In addition, staining of SMA showed a thicker smooth muscle layer in Wnt5a-/- uterus horns, suggesting dysregulation of mesenchymal differentiation (Figure 2B). Further immunofluorescence analyses revealed that CTNNB1 was expressed in both epithelial and mesenchymal cells in Wnt5a-/- uteri instead of only in the epithelium as in wild-type samples (Figure 2C), suggesting the dysregulation of Ctnnb1 expression. Mesenchymal marker VIM was dramatically upregulated in Wnt5a-/- compared controls, supporting dysregulated differentiation of the mesenchymal compartment or altered tissue remodelling, consistent with the observed increased in SMA expression (Figure 2C). Overall, these results suggest that WNT5A is necessary for the posterior elongation of the Müllerian ducts while maintaining the coordinated differentiation of epithelial and mesenchymal cells. Therefore, in addition to failure of vaginal formation as previously reported, loss of Wnt5a results in shorter uterine horns due to reduced cell proliferation and disorganized tissue architecture.

3.2. Wnt5a Regulates Müllerian Duct Morphogenesis Through the Non-Canonical PCP Pathway

To investigate the predominant signalling pathway regulated by WNT5A in Müllerian duct development, we used the WNT signalling pathway RT2 Profiler PCR Array. At 13.5 dpc, the PCP gene Jun was significantly downregulated, as well as Wnt5a, as expected (Figure 3A). Upregulated genes included WNT inhibitor Wif1, as well as canonical factors Wnt3a, Wnt7b, Wnt8a, and Wnt8b (Figure 3A). These results suggest the activation of the canonical Wnt pathway, likely due to loss of WNT5A-inhibitory effects [42,43]. Given the complexity of signals regulated by WNT5A, we examined the expression of additional representative genes of the PCP Wnt pathway that were not represented in the PCR array. We found that Fos was also downregulated in Wnt5a-/- samples, whereas Ror2, Vangl2, and Rac1 did not show significant differences compared to wild types (Figure 3B). At 18.5 dpc, JUN and phospho-JUN localized in the Müllerian duct epithelium of wild-type controls, whereas FOS was expressed mostly in mesenchymal cells (Figure 3C,D). In Wnt5a-/- samples, immunofluorescence confirmed the downregulation of JUN, FOS, and phospho-JUN (Figure 3C,D). These results are consistent with a morphogenic role of WNT5A during Müllerian duct development through the Wnt non-canonical PCP pathway.

3.3. Single-Cell Transcriptomics of the Developing Müllerian Ducts

To further understand the specific mechanisms involved in the disruption of Müllerian duct development following the loss of Wnt5a, we performed single-cell RNA-Seq analysis at 18.5 dpc, when elongation of the Müllerian ducts was complete. Single-cell profiling identified thirteen cell populations in wild-type and Wnt5a-/- samples (Figure 4A). Cell identity was assigned to each cluster based on the expression of specific markers using the Mouse Cell Atlas database, as well as previous reports (Table 1 and Supplementary Table S1) [11,44,45,46]. Cluster C1 represents proliferative or progenitor cells that expressed mitotic genes Cdc20, Cenpa, Cenpf, Kif20a, Ckap2, Ccnb1, and Ccnb2, as well as stem cell markers Sapcd2 and Dlgap5. Consistently, C1 was the most enriched in cells in the G2/M phase (Figure 4B). Cluster C2 expressed typical markers of the Müllerian mesenchyme, including Amhr2 and Hand2. The expression of markers such as Nkd2, Vcan, and Plac8 suggested cells form the inner mesenchyme, and Hoxa10/11 and Hoxd10/11 revealed localization in the uterine portion of the Müllerian ducts [45,47]. Cluster C3 represents smooth muscle cells, which expressed markers such as Acta2, Tagln, Myocd, and Synpr. These cells expressed Hoxa10/11 and Hoxd11, localizing in the uterine portion of the Müllerian ducts. Cluster C4 represents mesothelial cells, expressing the typical Upk1b, Upk3b, Tm4sf5, Msln, Muc16, and Lrp2 markers. Similar to C1, cluster C5 is representative of Müllerian mesenchyme cells positive for Amhr2 and Hoxa11. The expression of replication and cell-division markers including Cdc6, Top2a, Ccne1/2, Rrm2, Esco2, and E2f2 suggests cells undergoing active proliferation (Figure 4B, Supplementary Table S1). Cluster C6 is similar to C2 and also represents cells of the inner uterine mesenchyme, expressing genes such as Amhr2, Nkd2, Vcan, Plac8, Hoxa10/11, and Hoxd10/11. However, C6 uniquely expressed Wnt factors Wnt4 and Wnt6, mesenchymal genes Osr2 and Pdgfra, and ECM markers Col6a2 and Col13a1, likely representing a subcluster with a different function or developmental state. Genes in cluster C7 include Dpt, Lum, Postn, Slc26a7, Tbx18, Gata6, and Nr2f1, indicating cells from the outer mesenchyme of the Müllerian ducts [45]. Cluster C8 represents epithelial cells that expressed Wnt7a, Cdh1, Pax2, Pax8, and Hnf1b. Cluster C9 is made up of myeloid cells, with characteristic expression of Lyz2, Ms4a7, Ccl3, Ccl4, Tyrobp, and several complement components. Cluster C10 expressed key endothelial markers including Cdh5, Pecam1, Cldn5, and Icam2. Cluster C11 is also representative of epithelial cells, although with a different expression profile compared to C8. Genes in C11 include Wfdc2, Cldn3, Cldn7, Pax2, Elf3, and Ehf. C8 and C11 may represent cell types at different stages of differentiation, with C8 showing a typical epithelial signature while C11 represents a seemingly transitional state with increased enrichment in genes involved in epithelial–mesenchymal transition, such as Msx1, Msx2, Dlx5, Dlx6, and Ovol1. Alternatively, these clusters may be located in different regions along the Müllerian ducts. Cluster C12 showed expression of pericytes markers, including Rgs5, Heyl, Apold1, Cspg4, and Mcam. Cluster C13 represents mesenchymal cells expressing genes such as Dcn, Dpt, and Wfikkn2. However, this cluster showed enrichment in factors that are expressed in the oviducts, including Foxl2, Hoxa7/9, and Hoxc5/6/8/9 [48,49]. Interestingly, C13 is largely made up of cells coming from Wnt5a-/- samples, suggesting that these cells are more abundant in Müllerian ducts lacking Wnt5a (Figure 4C).
Gene expression analyses of scRNA-Seq datasets revealed interesting insights into the cell-specific molecular mechanisms regulated by Wnt5a in the developing reproductive tract. When stringency was set to a fold change ±1.5 and false discovery rate ≤ 0.05, few but critical genes were found to be differentially expressed in several clusters, including C1 (proliferative cells), C3 (smooth muscle cells), C5 (proliferative mesenchyme), C6 (inner mesenchyme #2), and C7 (outer mesenchyme) (Figure 5 and Supplementary Table S2). The clusters with the largest numbers of differentially expressed genes were clusters C4 (mesothelium), C8 (epithelium #1), C11 (epithelium #2), and C13 (oviduct mesenchyme). Negligible changes were observed for clusters C2 (inner mesenchyme #1), C10 (endothelium), and C12 (pericytes), while C9 (myeloid cells) displayed no differentially expressed genes (Figure 5 and Supplementary Table S2). Functional annotation analysis for proliferative (C1), epithelial (C8 and C9), and mesenchymal (C5, C6, and C7) cells, which are the major cell types of the embryonic reproductive tract, revealed that the main biological processes affected by loss of Wnt5a were apoptosis for proliferative cells and differentiation, migration, and metabolic events for different subclusters of the epithelial and mesenchymal lineage (Table 2). These processes are regulated by master genes including Fos and Jun, as well as Socs3, Gadd45g, Btg1, and Hspa1a (Figure 5) [50,51,52,53,54]. We then interrogated Ingenuity Pathway Analysis (IPA) to identify the developmental and pathological processes that were associated with the observed changes in gene expression. The most represented molecular and cellular functions were cellular development, growth and proliferation, and cell death and survival, confirming previous results (Table 3). Connective tissue development and function, as well as organismal, tissue and embryonic development, were the most enriched developmental categories (Table 3). Finally, the top three diseases and disorders were organismal injury and abnormalities, cancer, and reproductive system disease (Table 3).

3.4. Wnt5a Regulates Cell Fate of the Anterior Müllerian Ducts

One of the most striking differences between Wnt5a-/- and control reproductive tracts is the C13 cluster. This cluster is made up of mesenchymal cells of the oviducts and was greatly enriched in the Wnt5a-/- tracts. Therefore, we focused on the C13 cluster to obtain more insights into the underlying cellular and molecular mechanisms. Gene Ontology analysis identified apoptosis, proliferation, and transcription as top enriched categories for genes that were downregulated in C13, whereas endothelial cell migration, protein polymerization, and cell motility were associated with the upregulated genes (Table 4). Wnt signalling was the top pathway associated with the downregulated genes, as expected, followed by IL6 signalling and embryonic stem cell (ESC) pluripotency, whereas adipogenesis, myometrial contraction, and focal adhesion were associated with the upregulated genes (Table 5). The genes that were most upregulated included factors with critical roles in developmental patterning, cell migration, and adhesion, such as Itm2a, Ier3, and Id1, supporting the critical role of Wnt5a signalling in Müllerian duct elongation (Figure 6A) [55,56,57]. Like other clusters, key downregulated genes included Jun and Socs3. These factors, together with Wnt5a, are critical for cell-fate decisions, in addition to regulating developmental processes such as cell proliferation, differentiation, and apoptosis (Figure 6A) [11,58,59]. Strikingly, Hoxa10 and Hoxc10, which are expressed in the portion of the Müllerian duct that will become the uterus, were downregulated in the Wnt5a-/- cluster C13, whereas Hoxa7, a factor expressed in the oviduct, was significantly upregulated (Figure 6B) [60]. These results suggest that the C13 cluster of Wnt5a-/- samples comprises cells that differentiated into mesenchymal cells of the oviducts rather than the uterus. Morphologically, Wnt5a-/- reproductive tracts did not show an increase in the length of the oviducts (Figure 1A). This raises the hypothesis of a possible transformation of the anterior uterus to oviducts in Wnt5a-/- mice. Therefore, we performed immunofluorescence on the anterior portion of the uterus and stained for FOXL2, which, at this developmental stage, is a marker of the oviducts but not the uterus [61]. As expected, the oviducts of both control and Wnt5a-/- mice were positive for FOXL2 (Figure 6C). However, only the Wnt5a-/- anterior uterine horns expressed FOXL2, confirming that these cells had transformed into oviductal cells (Figure 6C). Overall, these results suggest that Wnt5a is involved not only in the elongation and directional patterning of the Müllerian ducts but also in regulating fate decisions of mesenchymal cells of the anterior reproductive tract to differentiate into oviducts vs. uteri.

4. Discussion

WNT5A plays critical roles in reproductive development. It is required for the formation of the posterior portion of the female reproductive tract, as well as the development of uterine glands and endometrial crypts [23,62]. WNT5A primarily signals through the non-canonical Wnt PCP pathway, which regulates both planar-cell and apical–basal polarity and is necessary for patterning, tissue outgrowth, and cell proliferation [63,64,65]. WNT5A binds to ROR2 and activates JNK, which, in turn, phosphorylates JUN, leading to the transcription of downstream targets including Fos and Jun itself [29,66,67,68]. Disruption of the PCP pathway through mutation of its members, including Wnt5a, results in a shortened apical–basal body axis and reduced elongation during organ development [69]. Although acting primarily through the non-canonical pathway, WNT5A can also modulate the Wnt canonical pathway, depending on receptor availability [43]. Activation of the PCP pathway by WNT5A binding to ROR2 has been reported to inhibit the canonical WNT pathway [22,43]. However, WNT5A can also activate the canonical pathway and lead to stabilization of b-catenin through binding of FZDs and RYK receptors [43,70]. Studies on zebrafish have shown that JUN and FOS could regulate the canonical pathway by physically interacting with b-catenin [71,72]. Moreover, Schambony et al. have shown that in Xenopus, WNT5A/ROR2 can activate PI3K and CDC42, in addition to JNK, leading to the transcription of Papc independent of the PCP pathway [73]. As such, the authors proposed WNT5A/ROR2 as an alternative, separate branch of the non-canonical Wnt pathway [73]. Overall, this body of work highlights the complexity of WNT5A signalling, capable of operating through different networks and depending on specific microenvironments.
This evidence could, at least in part, explain the heterogeneity observed in Robinow syndrome, which presents as autosomal dominant when associated with mutations in WNT5A and its mediators, DVL1 and DVL3, and autosomal recessive if caused by biallelic mutations in ROR2 [74]. A critical step in the activation of the Wnt PCP pathway by WNT5/ROR2 is signal transduction through DVL1/3, which phosphorylate JUN via RAC [74,75]. Additional candidate genes include FZD2, a WNT5A co-receptor; RAC3, which activates JNK/JUN phosphorylation; NXN, an interacting partner of DVL1; and GPC4—all factors involved in the Wnt PCP pathway [75]. Given the complexity of these networks and their dependency on combinations of ligands, receptors, and intracellular components, it is reasonable to assume that the pathogenesis of Robinow syndrome does not depend solely on the inactivation of one particular branch of the Wnt pathway but, rather, on the disruption of a delicate and environment-specific balance between canonical and non-canonical Wnt factors [75].
In this study, we showed that ablation of Wnt5a impaired murine Müllerian duct development during embryogenesis. Müllerian duct elongation was affected by a reduction in cell proliferation rather than increased apoptosis (Figure 1D,E, Supplementary Figure S1). GO analyses showed the downregulation of “regulators of apoptosis processes”, which include cell-cycle and stress–response modulators, suggesting a generally reduced engagement of upstream survival and stress-associated signalling rather than activation of apoptotic execution pathways, consistent with the absence of detectable histological changes in apoptosis. Notably, reduced proliferation was observed in both the epithelium and the mesenchyme, indicating disruption of the paracrine cross-talk between these compartments, which is necessary for proper cell proliferation [17]. Several Wnt ligands exhibit distinct epithelial or mesenchymal expression patterns and functions. Thus, alterations in mesenchymal signalling can indirectly affect epithelial proliferation through paracrine mechanisms. We found that the Müllerian duct epithelium displayed cells of cuboidal instead of the typical columnar morphology, with increased production of mesenchymal markers VIM and SMA (Figure 2B,C). We also noted a change in the pattern of expression of CTNBB1, which, instead of remaining restricted to the epithelium like in wild-type mice, was expressed in both the mesenchymal and epithelial compartments of Wnt5a-/- samples (Figure 2A) [10]. The coordinated interaction between mesenchymal and epithelial compartments is critical for the correct specification and differentiation of the reproductive tract [76]. Several inductive signals are exchanged between these cell types, including Wnt and Hox factors, and their inactivation results in a variety of Müllerian anomalies, from agenesis to homeotic transformation [1,76]. Using renal capsule grafting, Wnt5a was shown to be postnatally required in the Müllerian ducts for the estrogen-mediated inhibition of Wnt7a, Hoxa10, and Hoxa11 [23]. It is possible that WNT5A could also be involved in the regulation of Wnt and Hox genes during embryonic development. Real-time PCR analysis revealed the upregulation of several canonical Wnt factors in Wnt5a-/- mice, including Wnt3a, Wnt8a, and Wnt8b, as well as Wnt inhibitor Wif1, whose product can modulate the non-canonical pathway by binding to WNT5A (Figure 3A) [77]. Conversely, non-canonical PCP pathway effectors Fos and Jun were significantly downregulated at both the RNA and protein levels in Wnt5a-/- Müllerian ducts (Figure 3). Adding to its ability to activate either the canonical or non-canonical pathways depending on receptor context, WNT5A was shown to compete with WNT3A, thereby inhibiting the b-catenin pathway [42]. In addition, reverse sections of Wnt5a-/- Müllerian ducts revealed a rounded morphology that resembled the shape of reproductive tracts that are mutant for Vangl2, another PCP gene (Figure 2 and Figure 3C,D) [78]. Wnt5a and Vangl2 are transcriptionally independent, and Vangl2 expression was unchanged in Wnt5a−/− embryos (Figure 3B). In addition, WNT5A interacts with VANGL2 at the protein level, leading to the phosphorylation of the latter, which, in turn, regulates WNT5A activity [79]. Therefore, the rounded ductal morphology likely results from loss of planar-cell polarity and impaired tissue organization rather than altered Vangl2 expression. Overall, these results suggest that during Müllerian duct development, WNT5A acts primarily through the PCP pathway while inhibiting the canonical WNT pathway and that its loss leads to the downregulation of Fos and Jun and ectopic expression of CTNBB1 in the mesenchyme, likely through post-translational regulations.
While Wnt5a-/- mice lack the posterior portion of the reproductive tract, scRNA-Seq analysis revealed the presence of all other major Müllerian duct cell types, including mesenchymal, epithelial, smooth muscle, endothelial, and proliferative cells. Ablation of Wnt5a was found to impair critical developmental processes, including migration, differentiation, and apoptosis (Table 2 and Table 3). A common denominator of gene expression changes in several of these clusters was the downregulation of PCP factors Fos and Jun, as well as the Socs3 gene (Figure 5). Proper regulation of Socs3 is necessary for the correct development of several organs, including the reproductive tract, kidneys, and bones [11,80]. Notably, FOS and JUN directly regulate Socs3 expression by binding to its promoter, highlighting Socs3 involvement in the PCP-directed establishment of Müllerian duct patterning [81]. Compared to controls, Wnt5a-/- Müllerian ducts showed a significant enrichment in oviductal cells (i.e., cluster C13) (Figure 4). The role of the PCP pathway in regulating oviduct differentiation is not well understood, and like other clusters, C13 showed reduced expression of Jun and Socs3, consistent with specific inhibition of the PCP pathway (Figure 6A) [5,17,21]. Because the length of the oviducts was not increased in Wnt5a-/- mice, we hypothesized this phenotype could be explained by a transformation of the anterior portion of the uterus to oviducts rather than oviduct expansion. Hox genes play critical functions in regulating the segmentation of the female reproductive tract. In the chromosomes, these genes are physically clustered together, with Hoxa7/9/10/11/13 arranged sequentially from the 3′ to the 5′ end. Their expression becomes localized in specific regions of the Müllerian ducts, with Hoxa7/9 marking the oviducts, Hoxa10 marking the uterine horns, Hoxa11 marking the lower horns and endocervix, and Hoxa13 marking the cervix and vagina [82]. In the Wnt5a-/- C13 cluster, Hoxa7 was upregulated compared to controls (Figure 6B). Ectopic expression of Hoxa7 in Skov3 cells has been shown to induce tumours with oviduct-like structures [82]. Conversely, uterine markers Hoxa10 and Hoxc10, which have similar expression patters, were downregulated (Figure 6B) [14,60,83]. Finally, immunofluorescence of oviductal marker FOXL2 showed positive staining of the anterior Wnt5a-/- Müllerian ducts, whereas controls remained negative (Figure 6C). There is currently no evidence that FOS and JUN directly regulate transcription of Hox genes during Müllerian duct development. Therefore, this phenotype could, again, arise from disruption of tissue polarity and architecture rather than a direct transcriptional effect mediated by FOS/JUN signalling, a mechanism observed in other systems [79]. In addition to Hox factors, another pathway that could account for the anteriorization of Wnt5a-/- Müllerian ducts is the retinoic acid (RA) pathway. A fine-tuned gradient of RA is involved in the spatial determination of the oviduct–uterus borders [16,84]. When differential expression thresholds were relaxed to include differentially expressed factors with log2FC = 0.40 (fold change = 1.32), RA activation was the top dysregulated canonical pathway (Supplementary Figure S2A). Predictive pathway analysis of cluster C13 in IPA showed a possible mechanism where Wnt5a ablation leads to the downregulation of Jun and Socs3, as well as other factors, including Fn1, which is involved in cell migration; Nr2f2, which regulates self-renewal, differentiation, and proliferation; and Enpp2, which is highly expressed in oviductal mesenchymal cells. These changes would result in loss of planar polarity; disruption of RA signalling gradients; and, ultimately, Müllerian anomaly (Supplementary Figure S2B) [85,86,87]. Overall, our findings are consistent with the transformation of the anterior Wnt5a-/- Müllerian horns into oviducts. More specifically, proximal oviduct marker Cepbp was upregulated in cluster C13, whereas distal oviduct marker Wt1 was downregulated, supporting the transformation of the anterior uterus to proximal rather than distal oviducts [46].
Although Robinow syndrome is believed to mostly affect the lower reproductive tract, this condition is also well known for its complex and highly variable presentations and a pathogenesis that remains only partly understood [74]. WNT5A variants have also been found in patients with Robinow syndrome but normal height, in cases with possible recessive transmission, and in Müllerian anomalies not associated with Robinow syndrome [27,74,88]. We have uncovered an additional function of Wnt5a, which seems to be involved not only in vaginal development but in the patterning and specification of the anterior reproductive tract. These insights may prompt further investigations when mutations of WNT5A are found or suspected, either in Robinow syndrome or other Müllerian anomalies, especially when associated with complex presentations affecting reproductive functions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells15040359/s1, Supplementary Figure S1. Apoptosis in embryonic Müllerian ducts. Immunofluorescence staining of H2AX and cleaved CASP3 in wild-type and Wnt5a-/- samples at 13.5 and 18.5 dpc. Scale bar = 40 μm. Supplementary Figure S2. Mechanism of Müllerian anomaly in cluster C13. (A) Canonical pathway analysis of cluster C13. (B) Network representation of Wnt5a loss of function in cluster C13, resulting in the downregulation of key factors modulating cell polarity, RA signalling, and Müllerian duct morphogenesis. Supplementary Figure S3. Expression of representative markers. Quantification of fluorescence intensity for key markers as described in the main text. Data are represented as mean values normalised to the wild type ± SEM. (*) p < 0.05, (**) p < 0.01. Supplementary Table S1. Top 100 most enriched genes in each cell cluster. Supplementary Table S2. Differentially expressed genes in each cell cluster.

Author Contributions

Conceptualization, E.P.; investigation and methodology, I.K.-B., B.K. and E.P.; coding, S.W.; data analysis, S.W., B.K. and E.P.; writing—original draft preparation and revision, E.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Health and Medical Research Council of Australia.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of the University of Queensland (protocol AE000225; date of approval: 6 July 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank the staff of the University of Queensland animal facility for assistance in managing mouse colonies.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Mullen, R.D.; Behringer, R.R. Molecular genetics of Müllerian duct formation, regression and differentiation. Sex Dev. 2014, 8, 281–296. [Google Scholar] [CrossRef]
  2. Kyei-Barffour, I.; Margetts, M.; Vash-Margita, A.; Pelosi, E. The embryological landscape of Mayer-Rokitansky-Kuster-Hauser syndrome: Genetics and environmental factors. Yale J. Biol. Med. 2021, 94, 657–672. [Google Scholar] [PubMed]
  3. Orvis, G.D.; Behringer, R.R. Cellular mechanisms of Müllerian duct formation in the mouse. Dev. Biol. 2007, 306, 493–504. [Google Scholar] [CrossRef] [PubMed]
  4. Atsuta, Y.; Takahashi, Y. Early formation of the Müllerian duct is regulated by sequential actions of BMP/Pax2 and FGF/Lim1 signaling. Development 2016, 143, 3549–3559. [Google Scholar] [CrossRef] [PubMed]
  5. Prunskaite-Hyyryläinen, R.; Skovorodkin, I.; Xu, Q.; Miinalainen, I.; Shan, J.; Vainio, S.J. Wnt4 coordinates directional cell migration and extension of the Müllerian duct essential for ontogenesis of the female reproductive tract. Hum. Mol. Genet. 2016, 25, 1059–1073. [Google Scholar] [CrossRef]
  6. Vainio, S.; Heikkilä, M.; Kispert, A.; Chin, N.; McMahon, A.P. Female development in mammals is regulated by Wnt-4 signalling. Nature 1999, 397, 405–409. [Google Scholar] [CrossRef]
  7. Kobayashi, A.; Kwan, K.M.; Carroll, T.J.; McMahon, A.P.; Mendelsohn, C.L.; Behringer, R.R. Distinct and sequential tissue-specific activities of the LIM-class homeobox gene Lim1 for tubular morphogenesis during kidney development. Development 2005, 132, 2809–2823. [Google Scholar] [CrossRef]
  8. Fujino, A.; Arango, N.A.; Zhan, Y.; Manganaro, T.F.; Li, X.; MacLaughlin, D.T.; Donahoe, P.K. Cell migration and activated PI3K/AKT-directed elongation in the developing rat Mullerian duct. Dev. Biol. 2009, 325, 351–362. [Google Scholar] [CrossRef]
  9. Kurita, T.; Cooke, P.S.; Cunha, G.R. Epithelial-stromal tissue interaction in paramesonephric (Mullerian) epithelial differentiation. Dev. Biol. 2001, 240, 194–211. [Google Scholar] [CrossRef]
  10. Stewart, C.A.; Wang, Y.; Bonilla-Claudio, M.; Martin, J.F.; Gonzalez, G.; Taketo, M.M.; Behringer, R.R. CTNNB1 in mesenchyme regulates epithelial cell differentiation during Mullerian duct and postnatal uterine development. Mol. Endocrinol. 2013, 27, 1442–1454. [Google Scholar] [CrossRef]
  11. Thomson, E.; Tran, M.; Robevska, G.; Ayers, K.; van der Bergen, J.; Gopalakrishnan Bhaskaran, P.; Haan, E.; Cereghini, S.; Vash-Margita, A.; Margetts, M.; et al. Functional genomics analysis identifies loss of HNF1B function as a cause of Mayer-Rokitansky-Küster-Hauser syndrome. Hum. Mol. Genet. 2023, 32, 1032–1047. [Google Scholar] [CrossRef] [PubMed]
  12. Taylor, H.S.; Vanden Heuvel, G.B.; Igarashi, P. A conserved Hox axis in the mouse and human female reproductive system: Late establishment and persistent adult expression of the Hoxa cluster genes. Biol. Reprod. 1997, 57, 1338–1345. [Google Scholar] [CrossRef] [PubMed]
  13. Ma, L.; Benson, G.V.; Lim, H.; Dey, S.K.; Maas, R.L. Abdominal B (AbdB) Hoxa genes: Regulation in adult uterus by estrogen and progesterone and repression in müllerian duct by the synthetic estrogen diethylstilbestrol (DES). Dev. Biol. 1998, 197, 141–154. [Google Scholar] [CrossRef] [PubMed]
  14. Dollé, P.; Izpisúa-Belmonte, J.C.; Brown, J.M.; Tickle, C.; Duboule, D. HOX-4 genes and the morphogenesis of mammalian genitalia. Genes Dev. 1991, 5, 1767–1776. [Google Scholar] [CrossRef]
  15. Du, H.; Taylor, H.S. The Role of Hox Genes in Female Reproductive Tract Development, Adult Function, and Fertility. Cold Spring Harb. Perspect. Med. 2015, 6, a023002. [Google Scholar] [CrossRef]
  16. Nakajima, T.; Yamanaka, R.; Tomooka, Y. Elongation of Mullerian ducts and connection to urogenital sinus determine the borderline of uterine and vaginal development. Biochem. Biophys. Rep. 2019, 17, 44–50. [Google Scholar] [CrossRef]
  17. Deutscher, E.; Yao, H.H.C. Essential roles of mesenchyme-derived beta-catenin in mouse Mullerian duct morphogenesis. Dev. Biol. 2007, 307, 227–236. [Google Scholar] [CrossRef]
  18. Jeong, J.W.; Lee, H.S.; Franco, H.L.; Broaddus, R.R.; Taketo, M.M.; Tsai, S.Y.; Lydon, J.P.; DeMayo, F.J. beta-catenin mediates glandular formation and dysregulation of beta-catenin induces hyperplasia formation in the murine uterus. Oncogene 2009, 28, 31–40. [Google Scholar] [CrossRef]
  19. Franco, H.L.; Dai, D.; Lee, K.Y.; Rubel, C.A.; Roop, D.; Boerboom, D.; Jeong, J.W.; Lydon, J.P.; Bagchi, I.C.; Bagchi, M.K.; et al. WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB J. 2011, 25, 1176–1187. [Google Scholar] [CrossRef]
  20. Miller, C.; Sassoon, D.A. Wnt-7a maintains appropriate uterine patterning during the development of the mouse female reproductive tract. Development 1998, 125, 3201–3211. [Google Scholar] [CrossRef]
  21. Parr, B.A.; McMahon, A.P. Sexually dimorphic development of the mammalian reproductive tract requires Wnt-7a. Nature 1998, 395, 707–710. [Google Scholar] [CrossRef] [PubMed]
  22. Oishi, I.; Suzuki, H.; Onishi, N.; Takada, R.; Kani, S.; Ohkawara, B.; Koshida, I.; Suzuki, K.; Yamada, G.; Schwabe, G.C.; et al. The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells 2003, 8, 645–654. [Google Scholar] [CrossRef] [PubMed]
  23. Mericskay, M.; Kitajewski, J.; Sassoon, D. Wnt5a is required for proper epithelial-mesenchymal interactions in the uterus. Development 2004, 131, 2061–2072. [Google Scholar] [CrossRef] [PubMed]
  24. St-Jean, G.; Boyer, A.; Zamberlam, G.; Godin, P.; Paquet, M.; Boerboom, D. Targeted ablation of Wnt4 and Wnt5a in Müllerian duct mesenchyme impedes endometrial gland development and causes partial Müllerian agenesis. Biol. Reprod. 2019, 100, 49–60. [Google Scholar] [CrossRef]
  25. Person, A.D.; Beiraghi, S.; Sieben, C.M.; Hermanson, S.; Neumann, A.N.; Robu, M.E.; Schleiffarth, J.R.; Billington, C.J., Jr.; van Bokhoven, H.; Hoogeboom, J.M.; et al. WNT5A mutations in patients with autosomal dominant Robinow syndrome. Dev. Dyn. 2010, 239, 327–337. [Google Scholar] [CrossRef]
  26. Roifman, R.; Marcelis, C.L.M.; Paton, T.; Marshall, C.; Silver, R.; Lohr, J.L.; Yntema, H.G.; Venselaar, H.; Kayserili, H.; van Bon, B.; et al. De novo WNT5A-associated autosomal dominant Robinow syndrome suggests specificity of genotype and phenotype. Clin. Genet. 2015, 87, 34–41. [Google Scholar] [CrossRef]
  27. Xiong, S.; Chitayat, D.; Wei, X.; Zhu, J.; Lu, W.; Ming Sun, L.; Chopra, M. A novel de-novo WNT5A mutation in a Chinese patient with Robinow syndrome. Clin. Dysmorphol. 2016, 25, 186–189. [Google Scholar] [CrossRef]
  28. Robinow, M. The Robinow (fetal face) syndrome: A continuing puzzle. Clin. Dysmorphol. 1993, 2, 189–198. [Google Scholar] [CrossRef]
  29. Yamaguchi, T.P.; Bradley, A.; McMahon, A.P.; Jones, S. A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development 1999, 126, 1211–1223. [Google Scholar] [CrossRef]
  30. Lun, A.T.L.; McCarthy, D.J.; Marioni, J.C. A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor. F1000Research 2016, 5, 2122. [Google Scholar] [CrossRef]
  31. McCarthy, D.J.; Campbell, K.R.; Lun, A.T.L.; Wills, Q.F. Scater: Pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics 2017, 33, 1179–1186. [Google Scholar] [CrossRef] [PubMed]
  32. Lun, A.T.L.; Bach, K.; Marioni, J.C. Pooling across cells to normalize single-cell RNA sequencing data with many zero counts. Genome Biol. 2016, 17, 75. [Google Scholar] [CrossRef] [PubMed]
  33. Wolock, S.L.; Lopez, R.; Klein, A.M. Scrublet: Computational Identification of Cell Doublets in Single-Cell Transcriptomic Data. Cell Syst. 2019, 8, 281–291.e9. [Google Scholar] [CrossRef] [PubMed]
  34. Scialdone, A.; Natarajan, K.N.; Saraiva, L.R.; Proserpio, V.; Teichmann, S.A.; Stegle, O.; Marioni, J.C.; Buettner, F. Computational assignment of cell-cycle stage from single-cell transcriptome data. Methods 2015, 85, 54–61. [Google Scholar] [CrossRef]
  35. Blondel, V.D.; Guillaume, J.-L.; Lambiotte, R.; Lefebvre, E. Fast unfolding of communities in large networks. J. Stat. Mech. Theory Exp. 2008, P10008. [Google Scholar] [CrossRef]
  36. Csárdi, G.; Nepusz, T. The igraph software package for complex network research. InterJournal Complex Syst. 2006, 1695, 1–9. [Google Scholar]
  37. Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef]
  38. Harrison, P.F.; Pattison, A.D.; Powell, D.R.; Beilharz, T.H. Topconfects: A package for confident effect sizes in differential expression analysis provides a more biologically useful ranked gene list. Genome Biol. 2019, 20, 67. [Google Scholar] [CrossRef]
  39. Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID Bioinformatics Resources. Nature Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
  40. Xie, Z.; Bailey, A.; Kuleshov, M.V.; Clarke, D.J.B.; Evangelista, J.E.; Jenkins, S.L.; Lachmann, A.; Wojciechowicz, M.L.; Kropiwnicki, E.; Jagodnik, K.M.; et al. Gene set knowledge discovery with Enrichr. Curr. Protocols 2021, 1, e90. [Google Scholar] [CrossRef]
  41. Bhamidipaty-Pelosi, S.; Kyei-Barffour, I.; Volpert, M.; O’Neill, N.; Grimshaw, A.; Eriksson, L.; Vash-Margita, A.; Pelosi, E. Mullerian anomalies and endometriosis: Associations and phenotypic variations. Reprod. Biol. Endocrinol. 2024, 22, 157. [Google Scholar] [CrossRef] [PubMed]
  42. Sato, A.; Yamamoto, H.; Sakane, H.; Koyama, H.; Kikuchi, A. Wnt5a regulates distinct signalling pathways by binding to Frizzled2. EMBO J. 2010, 29, 41–54. [Google Scholar] [CrossRef] [PubMed]
  43. Mikels, A.J.; Nusse, R. Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling depending on receptor context. PLoS Biol. 2006, 4, e115. [Google Scholar] [CrossRef] [PubMed]
  44. Han, X.; Wang, R.; Zhou, Y.; Fei, L.; Sun, H.; Lai, S.; Saadatpour, A.; Zhou, Z.; Chen, H.; Ye, F.; et al. Mapping the mouse cell atlas by microwell-Seq. Cell 2018, 172, 1091–1107.e17. [Google Scholar] [CrossRef]
  45. Saatcioglu, H.D.; Kano, M.; Horn, H.; Zhang, L.; Samore, W.; Nagykery, N.; Meinsohn, M.C.; Hyun, M.; Suliman, R.; Poulo, J.; et al. Single-cell sequencing of neonatal uterus reveals an Misr2+ endometrial progenitor indispensable for fertility. Elife 2019, 8, e46349. [Google Scholar] [CrossRef]
  46. Ford, M.J.; Harwalkar, K.; Pacis, A.S.; Maunsell, H.; Wang, Y.C.; Badescu, D.; Teng, K.; Yamanaka, N.; Bouchard, M.; Ragoussis, J.; et al. Oviduct epithelial cells constitute two developmentally distinct lineages that are spatially separated along the distal-proximal axis. Cell Rep. 2021, 36, 109677. [Google Scholar] [CrossRef]
  47. Hollenbach, L.; Pelosi, E.; Margetts, M.; Vash-Margita, A. Vulvovaginal and Müllerian Anomalies. In Nelson Textbook of Pediatrics, 22nd ed.; Kliegman, R.M., St. Geme, J.W., Eds.; Elsevier: Philadelphia, PA, USA, 2024; Volume 2, pp. 3347–3354. [Google Scholar]
  48. Naora, H.; Montz, F.J.; Chai, C.Y.; Roden, R.B.S. Aberrant expression of homeobox gene HOXA7 is associated with müllerian-like differentiation of epithelial ovarian tumors and the generation of a specific autologous antibody response. Proc. Natl. Acad. Sci. USA 2001, 98, 15209–15214. [Google Scholar] [CrossRef]
  49. Karlsson, M.; Zhang, C.; Méar, L.; Zhong, W.; Digre, A.; Katona, B.; Sjöstedt, E.; Butler, L.; Odeberg, J.; Dusart, P.; et al. A single-cell type transcriptomics map of human tissues. Sci. Adv. 2021, 7, eabh2169. [Google Scholar] [CrossRef]
  50. Zhang, Y.; Chu, M.; Ye, M.; Yin, Y.; Chen, H. SOCS3, An Immunological Biomarker Offering Potential Therapeutic Targets for Malignant Tumors. Biol. Proced. Online 2025, 27, 36. [Google Scholar] [CrossRef]
  51. Zhao, X.; Yang, Y.; Xie, Q.; Qiu, J.; Sun, X. Identification of Biomarkers and Mechanisms Associated with Apoptosis in Recurrent Pregnancy Loss. Biochem. Genet. 2025, 63, 4401–4423. [Google Scholar] [CrossRef]
  52. Kots, E.; Mlynarczyk, C.; Melnick, A.; Khelashvili, G. Conformational transitions in BTG1 antiproliferative protein and their modulation by disease mutants. Biophys. J. 2022, 121, 3753–3764. [Google Scholar] [CrossRef] [PubMed]
  53. Thievessen, I.; Fakhri, N.; Steinwachs, J.; Kraus, V.; McIsaac, R.S.; Gao, L.; Chen, B.C.; Baird, M.A.; Davidson, M.W.; Betzig, E.; et al. Vinculin is required for cell polarization, migration, and extracellular matrix remodeling in 3D collagen. FASEB J. 2015, 29, 4555–4567. [Google Scholar] [CrossRef] [PubMed]
  54. Beere, H.M.; Wolf, B.B.; Cain, K.; Mosser, D.D.; Mahboubi, A.; Kuwana, T.; Tailor, P.; Morimoto, R.I.; Cohen, G.M.; Green, D.R. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat. Cell Biol. 2000, 2, 469–475. [Google Scholar] [CrossRef]
  55. Jiang, J.; Xu, J.; Ou, L.; Yin, C.; Wang, Y.; Shi, B. ITM2A inhibits the progression of bladder cancer by downregulating the phosphorylation of STAT3. Am. J. Cancer Res. 2024, 14, 2202–2215. [Google Scholar] [CrossRef] [PubMed]
  56. Kanduri, M.; Subhash, S.; Putino, R.; Mahale, S.; Kanduri, C. IER3, exploring its dual function as an oncogene and tumor suppressor. Cancer Gene Ther. 2025, 32, 450–463. [Google Scholar] [CrossRef]
  57. Tan, R.; Lee, Y.J.; Chen, X. Id-1 plays a key role in cell adhesion in neural stem cells through the preservation of RAP1 signaling. Cell Adh. Migr. 2012, 6, 1–3. [Google Scholar] [CrossRef]
  58. Xue, C.; Chu, Q.; Shi, Q.; Zeng, Y.; Lu, J.; Li, L. Wnt signaling pathways in biology and disease: Mechanisms and therapeutic advances. Signal Transduct Target Ther. 2025, 10, 106. [Google Scholar] [CrossRef]
  59. Luo, Y.; Guo, J.; Zhang, P.; Cheuk, Y.C.; Jiang, Y.; Wang, J.; Xu, S.; Rong, R. Mesenchymal Stem Cell Protects Injured Renal Tubular Epithelial Cells by Regulating mTOR-Mediated Th17/Treg Axis. Front. Immunol. 2021, 12, 684197. [Google Scholar] [CrossRef]
  60. Akbas, G.E.; Taylor, H.S. HOXC and HOXD gene expression in human endometrium: Lack of redundancy with HOXA paralogs. Biol. Reprod. 2004, 70, 39–45. [Google Scholar] [CrossRef]
  61. Bellessort, B.; Bachelot, A.; Heude, E.; Alfama, G.; Fontaine, A.; Le Cardinal, M.; Treier, M.; Levi, G. Role of Foxl2 in uterine maturation and function. Hum. Mol. Genet. 2015, 24, 3092–3103. [Google Scholar] [CrossRef]
  62. Cha, J.; Bartos, A.; Park, C.; Sun, X.; Li, Y.; Cha, S.W.; Ajima, R.; Ho, H.Y.H.; Yamaguchi, T.P.; Dey, S.K. Appropriate crypt formation in the uterus for embryo homing and implantation requires Wnt5a-ROR signaling. Cell Rep. 2014, 8, 382–392. [Google Scholar] [CrossRef]
  63. Wu, J.; Mlodzik, M. A quest for the mechanism regulating global planar cell polarity of tissues. Trends Cell Biol. 2009, 19, 295–305. [Google Scholar] [CrossRef] [PubMed]
  64. Liu, J.; Lin, A. Role of JNK activation in apoptosis: A double-edged sword. Cell Res. 2005, 15, 36–42. [Google Scholar] [CrossRef] [PubMed]
  65. Whitmarsh, A.J.; Davis, R.J. Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways. J. Mol. Med. 1996, 74, 589–607. [Google Scholar] [CrossRef] [PubMed]
  66. Minami, Y.; Oishi, I.; Endo, M.; Nishita, M. Ror-family receptor tyrosine kinases in noncanonical Wnt signaling: Their implications in developmental morphogenesis and human diseases. Dev. Dyn. 2010, 239, 1–15. [Google Scholar] [CrossRef]
  67. Saadeddin, A.; Babaei-Jadidi, R.; Spencer-Dene, B.; Nateri, A.S. The links between transcription, beta-catenin/JNK signaling, and carcinogenesis. Mol. Cancer Res. 2009, 7, 1189–1196. [Google Scholar] [CrossRef]
  68. Semenov, M.V.; Habas, R.; Macdonald, B.T.; He, X. SnapShot: Noncanonical Wnt Signaling Pathways. Cell 2007, 131, 1378. [Google Scholar] [CrossRef]
  69. Nishita, M.; Enomoto, M.; Yamagata, K.; Minami, Y. Cell/tissue-tropic functions of Wnt5a signaling in normal and cancer cells. Trends Cell Biol. 2010, 20, 346–354. [Google Scholar] [CrossRef]
  70. Angers, S.; Moon, R.T. Proximal events in Wnt signal transduction. Nat. Rev. Mol. Cell Biol. 2009, 10, 468–477. [Google Scholar] [CrossRef]
  71. Gan, X.Q.; Wang, J.Y.; Xi, Y.; Wu, Z.L.; Li, Y.P.; Li, L. Nuclear Dvl, c-Jun, beta-catenin, and TCF form a complex leading to stabilization of beta-catenin-TCF interaction. J. Cell Biol. 2008, 180, 1087–1100. [Google Scholar] [CrossRef]
  72. Toualbi, K.; Guller, M.C.; Mauriz, J.L.; Labalette, C.; Buendia, M.A.; Mauviel, A.; Bernuau, D. Physical and functional cooperation between AP-1 and beta-catenin for the regulation of TCF-dependent genes. Oncogene 2007, 26, 3492–3502. [Google Scholar] [CrossRef] [PubMed]
  73. Schambony, A.; Wedlich, D. Wnt-5A/Ror2 regulate expression of XPAPC through an alternative noncanonical signaling pathway. Dev. Cell 2007, 12, 779–792. [Google Scholar] [CrossRef] [PubMed]
  74. Birgmeier, J.; Esplin, E.D.; Jagadeesh, K.A.; Guturu, H.; Wenger, A.M.; Chaib, H.; Buckingham, J.A.; Bejerano, G.; Bernstein, J.A. Biallelic loss-of-function WNT5A mutations in an infant with severe and atypical manifestations of Robinow syndrome. Am. J. Med. Genet. A 2018, 176, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
  75. White, J.J.; Mazzeu, J.F.; Coban-Akdemir, Z.; Bayram, Y.; Bahrambeigi, V.; Hoischen, A.; van Bon, B.W.M.; Gezdirici, A.; Gulec, E.Y.; Ramond, F.; et al. WNT Signaling Perturbations Underlie the Genetic Heterogeneity of Robinow Syndrome. Am. J. Hum. Genet. 2018, 102, 27–43. [Google Scholar] [CrossRef]
  76. Kobayashi, A.; Shawlot, W.; Kania, A.; Behringer, R.R. Requirement of Lim1 for female reproductive tract development. Development 2004, 131, 539–549. [Google Scholar] [CrossRef]
  77. Poggi, L.; Casarosa, S.; Carl, M. An Eye on the Wnt Inhibitory Factor Wif1. Front. Cell Dev. Biol. 2018, 6, 167. [Google Scholar] [CrossRef]
  78. Vandenberg, A.L.; Sassoon, D.A. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via van gogh-like 2. Development 2009, 136, 1559–1570. [Google Scholar] [CrossRef]
  79. Kumawat, K.; Gosens, R. WNT-5A: Signaling and functions in health and disease. Cell Mol. Life Sci. 2016, 73, 567–587. [Google Scholar] [CrossRef]
  80. Matsushita, K.; Itoh, S.; Ikeda, S.; Yamamoto, Y.; Yamauchi, Y.; Hayashi, M. LIF/STAT3/SOCS3 signaling pathway in murine bone marrow stromal cells suppresses osteoblast differentiation. J. Cell Biochem. 2014, 115, 1262–1268. [Google Scholar] [CrossRef]
  81. Pagin, M.; Pernebrink, M.; Giubbolini, S.; Barone, C.; Sambruni, G.; Zhu, Y.; Chiara, M.; Ottolenghi, S.; Pavesi, G.; Wei, C.L. Id-1 plays a key role in cell adhesion in neural stem cells through the preservation of RAP1 signalingSox2 controls neural stem cell self-renewal through a Fos-centered gene regulatory network. Stem Cells 2021, 39, 1107–1119. [Google Scholar] [CrossRef]
  82. Cheng, W.; Liu, J.; Yoshida, H.; Rosen, D.; Naora, H. Lineage infidelity of epithelial ovarian cancers is controlled by HOX genes that specify regional identity in the reproductive tract. Nat. Med. 2005, 11, 531–537. [Google Scholar] [CrossRef]
  83. Mucenski, M.L.; Mahoney, R.; Adam, M.; Potter, A.S.; Potter, S.S. Single cell RNA-seq study of wild type and Hox9,10,11 mutant developing uterus. Sci. Rep. 2019, 9, 4557. [Google Scholar] [CrossRef]
  84. Nakajima, T.; Iguchi, T.; Sato, T. Retinoic acid signaling determines the fate of uterine stroma in the mouse Müllerian duct. Proc. Natl. Acad. Sci. USA 2016, 113, 14354–14359. [Google Scholar] [CrossRef]
  85. Buren, B.; Han, C.; Yang, C.; Li, F.; Fan, D.; Wang, X.; Hou, X.; Liu, X.; Jing, S. The role of FN1 gene interference in neural differentiation of human bone marrow mesenchymal stem cells. Am. J. Stem Cells. 2025, 14, 201–216. [Google Scholar] [CrossRef]
  86. Chen, X.; Qin, J.; Cheng, C.M.; Tsai, M.J.; Tsai, S.Y. COUP-TFII is a major regulator of cell cycle and Notch signaling pathways. Mol. Endocrinol. 2012, 26, 1268–1277. [Google Scholar] [CrossRef]
  87. Jia, S.; Zhao, F. Single-cell transcriptomic profiling of the neonatal oviduct and uterus reveals new insights into upper Müllerian duct regionalization. FASEB J. 2024, 38, e23632. [Google Scholar] [CrossRef]
  88. Wu, K.; Chang, X.; Wei, D.; Xu, C.; Qin, Y.; Chen, Z.J. Lack of association of WNT5A mutations with Mullerian duct abnormalities. Reprod. Biomed. Online 2013, 26, 164–167. [Google Scholar] [CrossRef]
Cells 15 00359 g001
Figure 1. Phenotype of the Wnt5a-/- reproductive tract. (A) Gross morphology of reproductive tracts shows reduced length of uterine horns and vaginal agenesis in Wnt5a-/- mice compared to controls. (B) Measurement of the uterine horn length at 18.5 dpc. n = 5. (C) Immunofluorescence staining of proliferation marker PH3 (red) in samples at 13.5 and 18.5 dpc. At 13.5 dpc, epithelial marker CDH1 (green) stains the Wolffian ducts only; the Müllerian ducts are delineated with dashed lines. At 18.5 dpc, only the Müllerian ducts are present and are positive for CDH1. (D,E) Quantification of PH3-positive cells in 13.5 (D) and 18.5 dpc (E) samples. n = 3. Scale bars = 2mm (A) and 40mm (C). ** p < 0.01.
Figure 1. Phenotype of the Wnt5a-/- reproductive tract. (A) Gross morphology of reproductive tracts shows reduced length of uterine horns and vaginal agenesis in Wnt5a-/- mice compared to controls. (B) Measurement of the uterine horn length at 18.5 dpc. n = 5. (C) Immunofluorescence staining of proliferation marker PH3 (red) in samples at 13.5 and 18.5 dpc. At 13.5 dpc, epithelial marker CDH1 (green) stains the Wolffian ducts only; the Müllerian ducts are delineated with dashed lines. At 18.5 dpc, only the Müllerian ducts are present and are positive for CDH1. (D,E) Quantification of PH3-positive cells in 13.5 (D) and 18.5 dpc (E) samples. n = 3. Scale bars = 2mm (A) and 40mm (C). ** p < 0.01.
Cells 15 00359 g001
Cells 15 00359 g002
Figure 2. Dysregulation of mesenchymal markers in Wnt5a-/- Müllerian ducts. (A) Immunofluorescence staining of LAMA1 (red) and CDH1 (green) at 18.5 dpc. The Müllerian duct had an unusual, rounded shape in Wnt5a-/- mice. Expression of LAMA1 was normal in Wnt5a-/- samples. (B) Immunofluorescence staining of PAX2 (green) and SMA (red) at 18.5 dpc. PAX2 staining revealed that the Müllerian epithelium of Wnt5a-/- samples displayed a cuboidal morphology instead of the columnar morphology typical of wild-type ducts. In addition, SMA staining was stronger in Wnt5a-/- samples. (C) Immunofluorescence staining of CTNNB1 (green) and VIM (red) at 18.5 dpc. While only the epithelium was positive for CTNBB1 in wild-type mice, Wnt5a-/- samples expressed CTNBB1 in both the epithelial and mesenchymal compartments. In addition, mesenchymal marker VIM was upregulated in Wnt5a-/- ducts. Scale bar = 40 μm.
Figure 2. Dysregulation of mesenchymal markers in Wnt5a-/- Müllerian ducts. (A) Immunofluorescence staining of LAMA1 (red) and CDH1 (green) at 18.5 dpc. The Müllerian duct had an unusual, rounded shape in Wnt5a-/- mice. Expression of LAMA1 was normal in Wnt5a-/- samples. (B) Immunofluorescence staining of PAX2 (green) and SMA (red) at 18.5 dpc. PAX2 staining revealed that the Müllerian epithelium of Wnt5a-/- samples displayed a cuboidal morphology instead of the columnar morphology typical of wild-type ducts. In addition, SMA staining was stronger in Wnt5a-/- samples. (C) Immunofluorescence staining of CTNNB1 (green) and VIM (red) at 18.5 dpc. While only the epithelium was positive for CTNBB1 in wild-type mice, Wnt5a-/- samples expressed CTNBB1 in both the epithelial and mesenchymal compartments. In addition, mesenchymal marker VIM was upregulated in Wnt5a-/- ducts. Scale bar = 40 μm.
Cells 15 00359 g002
Cells 15 00359 g003
Figure 3. Downregulation of the PCP pathway in Wnt5a-/- Müllerian ducts. (A) Volcano plot of the Wnt pathway RT2 Profiler PCR Array. Significantly upregulated genes are represented in red and downregulated genes in green. n = 3. (B) Expression profile of selected PCP genes. n = 3; * p < 0.05, n.s. not significant. (C) Immunofluorescence staining of JUN at 18.5 dpc, showing reduced expression in Wnt5a-/- mice. (D) Immunofluorescence staining of FOS and P-JUN at 18.5 dpc. Both markers were downregulated in Wnt5a-/- ducts. Scale bar = 40 μm.
Figure 3. Downregulation of the PCP pathway in Wnt5a-/- Müllerian ducts. (A) Volcano plot of the Wnt pathway RT2 Profiler PCR Array. Significantly upregulated genes are represented in red and downregulated genes in green. n = 3. (B) Expression profile of selected PCP genes. n = 3; * p < 0.05, n.s. not significant. (C) Immunofluorescence staining of JUN at 18.5 dpc, showing reduced expression in Wnt5a-/- mice. (D) Immunofluorescence staining of FOS and P-JUN at 18.5 dpc. Both markers were downregulated in Wnt5a-/- ducts. Scale bar = 40 μm.
Cells 15 00359 g003
Cells 15 00359 g004
Figure 4. Cell cluster composition of 18.5 dpc Müllerian ducts. (A) UMAP plot from scRNA-Seq analysis of Müllerian duct samples at 18.5 dpc revealed 13 cell clusters (C1–C13). (B) Cell-cycle phases in each cluster. (C) Sample composition in each cell cluster.
Figure 4. Cell cluster composition of 18.5 dpc Müllerian ducts. (A) UMAP plot from scRNA-Seq analysis of Müllerian duct samples at 18.5 dpc revealed 13 cell clusters (C1–C13). (B) Cell-cycle phases in each cluster. (C) Sample composition in each cell cluster.
Cells 15 00359 g004
Cells 15 00359 g005
Figure 5. Cluster-specific differentially expressed genes. MA plots of gene expression in each cluster following scRNA-Seq. Dotted lines = fold-change cutoffs. Red = genes significantly different in expression, Black = genes not significantly different.
Figure 5. Cluster-specific differentially expressed genes. MA plots of gene expression in each cluster following scRNA-Seq. Dotted lines = fold-change cutoffs. Red = genes significantly different in expression, Black = genes not significantly different.
Cells 15 00359 g005
Cells 15 00359 g006
Figure 6. Anterior transformation of Wnt5a-/- uterine horns. (A) Violin plots of dysregulated genes in cluster C13 of Wnt5a-/- and wild-type ducts. (B) Violin plots of key Hox markers in cluster C13. For all genes in (A,B), p < 0.001. (C) Immunofluorescence staining of FOXL2 (red) in the anterior uterine horns, showing expression in Wnt5a-/- samples. Inset: oviduct staining positive for FOXL2 in both wild-type and Wnt5a-/- mice. CDH1 (green) was used as epithelial marker. Scale bar = 40 μm.
Figure 6. Anterior transformation of Wnt5a-/- uterine horns. (A) Violin plots of dysregulated genes in cluster C13 of Wnt5a-/- and wild-type ducts. (B) Violin plots of key Hox markers in cluster C13. For all genes in (A,B), p < 0.001. (C) Immunofluorescence staining of FOXL2 (red) in the anterior uterine horns, showing expression in Wnt5a-/- samples. Inset: oviduct staining positive for FOXL2 in both wild-type and Wnt5a-/- mice. CDH1 (green) was used as epithelial marker. Scale bar = 40 μm.
Cells 15 00359 g006
Table 1. Top 15 most enriched genes in each cell cluster.
Table 1. Top 15 most enriched genes in each cell cluster.
c1c2c3c4c5c6c7c8c9c10c11c12c13
ProliferativeInner Mesenchyme #1Smooth MuscleMesotheliumProliferative MesenchymeInner Mesenchyme #2Outer MesenchymeEpithelium #1MyeloidEndotheliumEpithelium #2PericytesOviduct Mesenchyme
CenpaCnr1Acta2Upk3bHist1h2apCnr1LumRmstC1qaGpihbp1Wfdc2Higd1bFoxl2
C330021F23RikAmhr2Ldoc1Tm4sf5Hist1h2aeCpxm2Cxcl13Cdh16Cpa3Cldn5Prap1Rgs54833424O15Rik
Cdc20Jakmip1Cxcl14Lrrn4Hist1h1bTfap2cSgczCldn6C1qbAplnrCldn3Ndufa4l2Sostdc1
Psrc1Tmem178bOlfml3Upk1bHist1h1aGm13659Cntn4St14Cma1Cdh51600029D21RikCpa1Enpp2
CenpfTfap2cSynprMuc162810417H13RikPrlrGm26691Atp2b2C1qcPecam1UrahAspnWnt16
Fam64aNkd2Asic2MslnHist1h2abTex15Rxfp2Esrp1Tpsb2Icam2Tacstd2Ccl11Dsc3
Kif20aTex15TaglnKrt14AunipVcanSpon2Slc1a1Ccl4Cd93Rab25Kcnj8Aldh1a1
Ccnb1Phactr3PenkLrp2Rrm2CckSntg1Myh14TyrobpRobo4Cldn7VipFoxl2os
Sapcd2Cpxm2Tac2MyrfHist1h2aoAmhr2PostnCldn7Ccl3PlvapElf3Gm13889Hmgcs2
Ccnb2C030034L19RikPtger3PodxlEsco2Tmem100Pcdh10Cdh1Lyz2Eltd1Cdh16HeylD3Bwg0562e
Cdkn39330154J02Rik2610028E06RikBnc1Rad51ap1Hoxa11Cntn6Wnt7aMs4a7Fam167bPdzk1ip1Fam162bPpp1r14c
RP23-45G16.5Frem1Npy2rKrt7Mybl2Tulp2DptSlc14a1F13a1Myct1Dlx5Ebf1Fgf10
Dlgap5Tulp2Mamdc2A730046J19RikTk1Scube1Cpa6Wfdc2Pf4MfngEhfRelnOsr1
Ckap2Hoxa11Zfp185Fam180aE2f2Car14Tbx18Cldn3CtssPtprbPax2Ace2Hoxc8
Kif2cCckTcf21Ildr2Tcf19Rxfp1Csmd3ChdhFcer1gEsm1Crb3Fabp7Atp1a2
Table 2. Top Gene Ontology (GO) classes for proliferative, mesenchymal, and epithelial cell clusters.
Table 2. Top Gene Ontology (GO) classes for proliferative, mesenchymal, and epithelial cell clusters.
ClusterGO ClassFDR
C1—ProliferativesRegulation of apoptotic process1.17 × 10−3
C5—Proliferative mesenchymeRegulation of apoptotic process3.11 × 10−3
C6—Inner mesenchyme #2Positive regulation of cell differentiation1.00 × 10−2
C7—Outer mesenchymeNegative regulation of transcription by RNA polymerase II2.82 × 10−2
C8—Epithelium #1Response to interferon beta1.90 × 10−4
C9—Epithelium #2Regulation of cell migration8.84 × 10−3
C2—inner mesenchyme #1 was excluded due to a small number of differentially expressed genes. FDR = false discovery rate.
Table 3. Pathway analysis of differentially expressed genes. Most enriched “Molecular and cell functions”, “System development” and “Diseases and disorders” categories.
Table 3. Pathway analysis of differentially expressed genes. Most enriched “Molecular and cell functions”, “System development” and “Diseases and disorders” categories.
Molecular and Cell FunctionsCell Clusterp-value range
Cellular development C1, C3, C4, C5, C6, C7, C8, C11, C138.92 × 10−3–2.86 × 10−15
Cellular growth and proliferation C1, C3, C4, C5, C6, C7, C8, C11, C138.78 × 10−3–2.86 × 10−15
Cell death and survival C1, C3, C4, C5, C6, C8, C119.19 × 10−3–1.81 × 10−17
Cellular movement C3, C4, C5, C7, C8, C11, C135.43 × 10−3–5.77 × 10−18
Cell cycle C1, C6, C7, C11, C137.89 x 10−3–2.35 × 10−16
System developmentCell clusterp-value range
Connective tissue development and function C1, C3, C4, C5, C6, C7, C8, C11, C137.89 × 10−3–1.75 × 10−13
Organismal development C4, C6, C7, C8, C11, C139.19 × 10−3–5.98 × 10−17
Tissue development C3, C4, C6, C7, C8, C11, C138.92 × 10−3–6.63 × 10−16
Embryonic development C1, C7, C11 7.23 × 10−3–5.98 × 10−17
Organismal survival C3, C51.81 × 10−3–9.75 × 10−10
Diseases and disordersCell clusterp-value range
Organismal injury and abnormalities C1, C3, C4, C5, C6, C7, C8, C11, C139.19 × 10−3–1.11 × 10−17
Cancer C3, C4, C5, C7, C8, C11, C135.44 × 10−3–1.01 × 10−16
Reproductive system diseaseC7, C11, C13 5.46 × 10−3–8.45 × 10−15
Table 4. Top three Gene Ontology (GO) classes for downregulated and upregulated genes in cluster C13.
Table 4. Top three Gene Ontology (GO) classes for downregulated and upregulated genes in cluster C13.
Gene ExpressionGO Classp-Value
DownregulatedRegulation of apoptotic process9.94 × 10−4
Regulation of cell population proliferation 2.10 × 10−3
Positive regulation of transcription by RNA polymerase II3.90 × 10−3
UpregulatedBlood-vessel endothelial cell migration3.36 × 10−3
Negative regulation of protein polymerization3.90 × 10−3
Regulation of cell motility7.88 × 10−3
Table 5. Top three pathways for downregulated and upregulated genes in cluster C13.
Table 5. Top three pathways for downregulated and upregulated genes in cluster C13.
Gene ExpressionPathwayp-Value
DownregulatedWnt signalling2.04 × 10−2
IL6 signalling2.06 × 10−2
ESC pluripotency2.90 × 10−2
UpregulatedAdipogenesis3.58 × 10−2
Myometrial relaxation and contraction3.80 × 10−2
Focal adhesion3.70 × 10−2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kyei-Barffour, I.; Williams, S.; Kushawaha, B.; Pelosi, E. Wnt5a Regulates Embryonic Müllerian Duct Development Through the Non-Canonical Wnt PCP Pathway. Cells 2026, 15, 359. https://doi.org/10.3390/cells15040359

AMA Style

Kyei-Barffour I, Williams S, Kushawaha B, Pelosi E. Wnt5a Regulates Embryonic Müllerian Duct Development Through the Non-Canonical Wnt PCP Pathway. Cells. 2026; 15(4):359. https://doi.org/10.3390/cells15040359

Chicago/Turabian Style

Kyei-Barffour, Isaac, Sarah Williams, Bhawna Kushawaha, and Emanuele Pelosi. 2026. "Wnt5a Regulates Embryonic Müllerian Duct Development Through the Non-Canonical Wnt PCP Pathway" Cells 15, no. 4: 359. https://doi.org/10.3390/cells15040359

APA Style

Kyei-Barffour, I., Williams, S., Kushawaha, B., & Pelosi, E. (2026). Wnt5a Regulates Embryonic Müllerian Duct Development Through the Non-Canonical Wnt PCP Pathway. Cells, 15(4), 359. https://doi.org/10.3390/cells15040359

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop