Generation of a Double Reporter mES Cell Line to Simultaneously Trace the Generation of Retinal Progenitors and Photoreceptors
Abstract
1. Introduction
2. Materials and Methods
2.1. Mouse ES Cell Culture
2.2. Organoid Production
2.3. Immunohistochemistry
2.4. Rax Gene Editing Preparation
2.5. Production of Crx-GFP;Rax-mCherry Line
2.6. Isolation and Seeding of mCherry-Positive Cells
2.7. RNA Sequencing and Analysis
2.8. Proteomics Analysis: Digestion of Protein Samples
2.9. Liquid Chromatography–Tandem Mass Spectrometry (LC-MS/MS)
2.10. Analysis of LC-MS/MS Data
2.11. Embryoid Body Differentiation Assay
3. Results
3.1. Knock-In of mCherry Sequence After the Rax Gene
3.2. mCherry Is Expressed During Early Retinal Organoid Development
3.3. Cell Type Composition of the Crx-GFP;Rax-mCherry Retinal Organoids
3.4. Rax-mCherry-Positive Cells Have Characteristics of Retinal Progenitors
3.4.1. Isolated Cells Proliferate in the Presence of EGF and FGF2
3.4.2. Transcriptomic Analysis Implies Retinal Progenitor Cell Fate Commitment of Isolated mCherry-Positive Cells
3.4.3. Protein Content Corroborates Retinal Progenitor Identity
4. Discussion
4.1. Eye Field Transcription Factor Gene Reporter Lines in Retina Research
4.2. Rax Gene Reporter with Biallelic Editing
4.3. In Vitro Development in Crx-GFP;Rax-mCherry Retinal Organoids
4.4. Transcriptomic Analysis
4.5. Possible Applications
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maeda, T.; Mandai, M.; Sugita, S.; Kime, C.; Takahashi, M. Strategies of Pluripotent Stem Cell-Based Therapy for Retinal Degeneration: Update and Challenges. Trends Mol. Med. 2022, 28, 388–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schnichels, S.; Paquet-Durand, F.; Löscher, M.; Tsai, T.; Hurst, J.; Joachim, S.C.; Klettner, A. Retina in a Dish: Cell Cultures, Retinal Explants and Animal Models for Common Diseases of the Retina. Prog. Retin. Eye Res. 2021, 81, 100880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afanasyeva, T.A.V.; Corral-Serrano, J.C.; Garanto, A.; Roepman, R.; Cheetham, M.E.; Collin, R.W.J. A Look into Retinal Organoids: Methods, Analytical Techniques, and Applications. Cell. Mol. Life Sci. 2021, 78, 6505–6532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corsini, N.S.; Knoblich, J.A. Human Organoids: New Strategies and Methods for Analyzing Human Development and Disease. Cell 2022, 185, 2756–2769. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Z.; Chen, X.; Dowbaj, A.M.; Sljukic, A.; Bratlie, K.; Lin, L.; Fong, E.L.S.; Balachander, G.M.; Chen, Z.; Soragni, A.; et al. Organoids. Nat. Rev. Methods Primers 2022, 2, 94. [Google Scholar] [CrossRef] [Scilit]
- Eiraku, M.; Takata, N.; Ishibashi, H.; Kawada, M.; Sakakura, E.; Okuda, S.; Sekiguchi, K.; Adachi, T.; Sasai, Y. Self-Organizing Optic-Cup Morphogenesis in Three-Dimensional Culture. Nature 2011, 472, 51–58. [Google Scholar] [CrossRef] [Scilit]
- O’Hara-Wright, M.; Gonzalez-Cordero, A. Retinal Organoids: A Window into Human Retinal Development. Development 2020, 147, dev189746. [Google Scholar] [CrossRef] [Scilit]
- Nakano, T.; Ando, S.; Takata, N.; Kawada, M.; Muguruma, K.; Sekiguchi, K.; Saito, K.; Yonemura, S.; Eiraku, M.; Sasai, Y. Self-Formation of Optic Cups and Storable Stratified Neural Retina from Human ESCs. Cell Stem Cell 2012, 10, 771–785. [Google Scholar] [CrossRef] [Scilit]
- Llonch, S.; Carido, M.; Ader, M. Organoid Technology for Retinal Repair. Dev. Biol. 2018, 433, 132–143. [Google Scholar] [CrossRef] [Scilit]
- Wahle, P.; Brancati, G.; Harmel, C.; He, Z.; Gut, G.; del Castillo, J.S.; da Silveira dos Santos, A.X.; Yu, Q.; Noser, P.; Fleck, J.S.; et al. Multimodal Spatiotemporal Phenotyping of Human Retinal Organoid Development. Nat. Biotechnol. 2023, 41, 1765–1775. [Google Scholar] [CrossRef] [Scilit]
- Capowski, E.E.; Samimi, K.; Mayerl, S.J.; Phillips, M.J.; Pinilla, I.; Howden, S.E.; Saha, J.; Jansen, A.D.; Edwards, K.L.; Jager, L.D.; et al. Reproducibility and Staging of 3D Human Retinal Organoids across Multiple Pluripotent Stem Cell Lines. Development 2019, 146, dev171686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cowan, C.S.; Renner, M.; Gennaro, M.D.; Gross-Scherf, B.; Goldblum, D.; Hou, Y.; Munz, M.; Rodrigues, T.M.; Krol, J.; Szikra, T.; et al. Cell Types of the Human Retina and Its Organoids at Single-Cell Resolution. Cell 2020, 182, 1623–1640.e34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hallam, D.; Hilgen, G.; Dorgau, B.; Zhu, L.; Yu, M.; Bojic, S.; Hewitt, P.; Schmitt, M.; Uteng, M.; Kustermann, S.; et al. Human-Induced Pluripotent Stem Cells Generate Light Responsive Retinal Organoids with Variable and Nutrient-Dependent Efficiency. Stem Cells 2018, 36, 1535–1551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dorgau, B.; Felemban, M.; Hilgen, G.; Kiening, M.; Zerti, D.; Hunt, N.C.; Doherty, M.; Whitfield, P.; Hallam, D.; White, K.; et al. Decellularised Extracellular Matrix-Derived Peptides from Neural Retina and Retinal Pigment Epithelium Enhance the Expression of Synaptic Markers and Light Responsiveness of Human Pluripotent Stem Cell Derived Retinal Organoids. Biomaterials 2019, 199, 63–75. [Google Scholar] [CrossRef] [Scilit]
- Saha, A.; Capowski, E.; Zepeda, M.A.F.; Nelson, E.C.; Gamm, D.M.; Sinha, R. Cone Photoreceptors in Human Stem Cell-Derived Retinal Organoids Demonstrate Intrinsic Light Responses That Mimic Those of Primate Fovea. Cell Stem Cell 2022, 29, 460–471.e3. [Google Scholar] [CrossRef] [Scilit]
- Mellough, C.B.; Collin, J.; Queen, R.; Hilgen, G.; Dorgau, B.; Zerti, D.; Felemban, M.; White, K.; Sernagor, E.; Lako, M. Systematic Comparison of Retinal Organoid Differentiation from Human Pluripotent Stem Cells Reveals Stage Specific, Cell Line, and Methodological Differences. Stem Cells Transl. Med. 2019, 8, 694–706. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Wang, W.; Jin, Z.-B. Retinal Organoids as Models for Development and Diseases. Cell Regen. 2021, 10, 33. [Google Scholar] [CrossRef] [Scilit]
- Zhong, X.; Gutierrez, C.; Xue, T.; Hampton, C.; Vergara, M.N.; Cao, L.H.; Peters, A.; Park, T.S.; Zambidis, E.T.; Meyer, J.S.; et al. Generation of Three-Dimensional Retinal Tissue with Functional Photoreceptors from Human iPSCs. Nat. Commun. 2014, 5, 4047. [Google Scholar] [CrossRef] [Scilit]
- Kaya, K.D.; Chen, H.Y.; Brooks, M.J.; Kelley, R.A.; Shimada, H.; Nagashima, K.; de Val, N.; Drinnan, C.T.; Gieser, L.; Kruczek, K.; et al. Transcriptome-Based Molecular Staging of Human Stem Cell- Derived Retinal Organoids Uncovers Accelerated Photoreceptor Differentiation by 9-Cis Retinal. Mol. Vis. 2019, 25, 663–678. [Google Scholar]
- Kruczek, K.; Swaroop, A. Pluripotent Stem Cell-Derived Retinal Organoids for Disease Modeling and Development of Therapies. Stem Cells 2020, 38, 1206–1215. [Google Scholar] [CrossRef] [Scilit]
- Cepko, C. Intrinsically Different Retinal Progenitor Cells Produce Specific Types of Progeny. Nat. Rev. Neurosci. 2014, 15, 615–627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gozlan, S.; Batoumeni, V.; Fournier, T.; Nanteau, C.; Potey, A.; Clémençon, M.; Orieux, G.; Sahel, J.A.; Goureau, O.; Roger, J.E.; et al. Bankable Human iPSC-Derived Retinal Progenitors Represent a Valuable Source of Multipotent Cells. Commun. Biol. 2023, 6, 762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Decembrini, S.; Koch, U.; Radtke, F.; Moulin, A.; Arsenijevic, Y. Derivation of Traceable and Transplantable Photoreceptors from Mouse Embryonic Stem Cells. Stem Cell Rep. 2014, 2, 853–865. [Google Scholar] [CrossRef] [Scilit]
- Muranishi, Y.; Terada, K.; Furukawa, T. An Essential Role for Rax in Retina and Neuroendocrine System Development. Dev. Growth Differ. 2012, 54, 341–348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Decembrini, S.; Hoehnel, S.; Brandenberg, N.; Arsenijevic, Y.; Lutolf, M.P. Hydrogel-Based Milliwell Arrays for Standardized and Scalable Retinal Organoid Cultures. Sci. Rep. 2020, 10, 10275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fadl, B.R.; Brodie, S.A.; Malasky, M.; Boland, J.F.; Kelly, M.C.; Kelley, M.W.; Boger, E.; Fariss, R.; Swaroop, A.; Campello, L. An Optimized Protocol for Retina Single-Cell RNA Sequencing. Mol. Vis. 2020, 26, 705–717. [Google Scholar]
- Zibetti, C.; Liu, S.; Wan, J.; Qian, J.; Blackshaw, S. Epigenomic Profiling of Retinal Progenitors Reveals LHX2 Is Required for Developmental Regulation of Open Chromatin. Commun. Biol. 2019, 2, 142. [Google Scholar] [CrossRef] [Scilit]
- Jolliffe, I.T.; Cadima, J. Principal Component Analysis: A Review and Recent Developments. Phil. Trans. R. Soc. A. 2016, 374, 20150202. [Google Scholar] [CrossRef] [Scilit]
- Kulak, N.A.; Pichler, G.; Paron, I.; Nagaraj, N.; Mann, M. Minimal, Encapsulated Proteomic-Sample Processing Applied to Copy-Number Estimation in Eukaryotic Cells. Nat. Methods 2014, 11, 319–324. [Google Scholar] [CrossRef] [Scilit]
- Meier, F.; Brunner, A.D.; Koch, S.; Koch, H.; Lubeck, M.; Krause, M.; Goedecke, N.; Decker, J.; Kosinski, T.; Park, M.A.; et al. Online Parallel Accumulation–Serial Fragmentation (PASEF) with a Novel Trapped Ion Mobility Mass Spectrometer. Mol. Cell. Proteom. 2018, 17, 2534–2545. [Google Scholar] [CrossRef] [Scilit]
- Cox, J.; Mann, M. MaxQuant Enables High Peptide Identification Rates, Individualized p.p.b.-Range Mass Accuracies and Proteome-Wide Protein Quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R.A.; Olsen, J.V.; Mann, M. Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment. J. Proteome Res. 2011, 10, 1794–1805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus Computational Platform for Comprehensive Analysis of (Prote)Omics Data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef] [Scilit]
- Cox, J.; Hein, M.Y.; Luber, C.A.; Paron, I.; Nagaraj, N.; Mann, M. Accurate Proteome-Wide Label-Free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ* □ S Technological Innovation and Resources. Mol. Cell. Proteom. 2014, 13, 2513–2526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Scilit]
- Mathers, P.H.; Grinberg, A.; Mahon, K.A.; Jamrich, M. The Rx Homeobox Gene Is Essential for Vertebrate Eye Development. Nature 1997, 387, 603–607. [Google Scholar] [CrossRef] [Scilit]
- Furukawa, T.; Kozak, C.A.; Cepko, C.L. Rax, a Novel Paired-Type Homeobox Gene, Shows Expression in the Anterior Neural Fold and Developing Retina. Hum. Mol. Genet. 1997, 94, 1471–1488. [Google Scholar] [CrossRef] [Scilit]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [Scilit]
- Ran, F.A.; Hsu, P.D.; Lin, C.Y.; Gootenberg, J.S.; Konermann, S.; Trevino, A.E.; Scott, D.A.; Inoue, A.; Matoba, S.; Zhang, Y.; et al. Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Cell 2013, 154, 1380–1389. [Google Scholar] [CrossRef] [Scilit]
- Shaner, N.C.; Campbell, R.E.; Steinbach, P.A.; Giepmans, B.N.G.; Palmer, A.E.; Tsien, R.Y. Improved Monomeric Red, Orange and Yellow Fluorescent Proteins Derived from Discosoma Sp. Red Fluorescent Protein. Nat. Biotechnol. 2004, 22, 1567–1572. [Google Scholar] [CrossRef] [Scilit]
- Labun, K.; Montague, T.G.; Gagnon, J.A.; Thyme, S.B.; Valen, E. CHOPCHOP v2: A Web Tool for the next Generation of CRISPR Genome Engineering. Nucleic Acids Res. 2016, 44, W272–W276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, B.; Zhang, W.; Zhang, J.; Zhou, J.; Wang, J.; Chen, L.; Wang, L.; Hodgkins, A.; Iyer, V.; Huang, X.; et al. Efficient Genome Modification by CRISPR-Cas9 Nickase with Minimal off-Target Effects. Nat. Methods 2014, 11, 399–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brinkman, E.K.; Chen, T.; Amendola, M.; Steensel, B.V. Easy Quantitative Assessment of Genome Editing by Sequence Trace Decomposition. Nucleic Acids Res. 2014, 42, e168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baldarelli, R.M.; Smith, C.M.; Finger, J.H.; Hayamizu, T.F.; McCright, I.J.; Xu, J.; Shaw, D.R.; Beal, J.S.; Blodgett, O.; Campbell, J.; et al. The Mouse Gene Expression Database (GXD): 2021 Update. Nucleic Acids Res. 2021, 49, D924–D931. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Leavey, P.; Appel, H.; Makrides, N.; Blackshaw, S. Molecular Mechanisms Controlling Vertebrate Retinal Patterning, Neurogenesis, and Cell Fate Specification. Trends Genet. 2023, 39, 736–757. [Google Scholar] [CrossRef] [Scilit]
- Bonezzi, P.J.; Stabio, M.E.; Renna, J.M. The Development of Mid-Wavelength Photoresponsivity in the Mouse Retina. Curr. Eye Res. 2018, 43, 666–673. [Google Scholar] [CrossRef] [Scilit]
- Blackshaw, S.; Harpavat, S.; Trimarchi, J.; Cai, L.; Huang, H.; Kuo, W.P.; Weber, G.; Lee, K.; Fraioli, R.E.; Cho, S.H.; et al. Genomic Analysis of Mouse Retinal Development. PLoS Biol. 2004, 2, e247. [Google Scholar] [CrossRef] [Scilit]
- Merhi-Soussi, F.; Angénieux, B.; Canola, K.; Kostic, C.; Tekaya, M.; Hornfeld, D.; Arsenijevic, Y. High Yield of Cells Committed to the Photoreceptor Fate from Expanded Mouse Retinal Stem Cells. Stem Cells 2006, 24, 2060–2070. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, M.; Ong, A.L.C.; Shinozuka, T.; Sasai, N. The Rx Transcription Factor Is Required for Determination of the Retinal Lineage and Regulates the Timing of Neuronal Differentiation. Dev. Growth Differ. 2022, 64, 318–324. [Google Scholar] [CrossRef] [Scilit]
- Bertacchi, M.; Parisot, J.; Studer, M. The Pleiotropic Transcriptional Regulator COUP-TFI Plays Multiple Roles in Neural Development and Disease. Brain Res. 2019, 1705, 75–94. [Google Scholar] [CrossRef] [Scilit]
- Diacou, R.; Nandigrami, P.; Fiser, A.; Liu, W.; Ashery-Padan, R.; Cvekl, A. Cell Fate Decisions, Transcription Factors and Signaling during Early Retinal Development. Prog. Retin. Eye Res. 2022, 91, 101093. [Google Scholar] [CrossRef] [Scilit]
- Fujimura, N. WNT/β-Catenin Signaling in Vertebrate Eye Development. Front. Cell Dev. Biol. 2016, 4, 138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, H.; Kon, T.; Omori, Y.; Furukawa, T. Functional and Evolutionary Diversification of Otx2 and Crx in Vertebrate Retinal Photoreceptor and Bipolar Cell Development. Cell Rep. 2020, 30, 658–671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, X.; Teotia, P.; Ahmad, I. Lin28a Regulates Neurogliogenesis in Mammalian Retina through the Igf Signaling. Dev. Biol. 2018, 440, 113–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atefi, A.; Kojouri, P.S.; Karamali, F.; Irani, S.; Nasr-Esfahani, M.H. Construction and Characterization of EGFP Reporter Plasmid Harboring Putative Human RAX Promoter for in Vitro Monitoring of Retinal Progenitor Cells Identity. BMC Mol. Cell Biol. 2021, 22, 55. [Google Scholar] [CrossRef] [Scilit]
- Wahlin, K.J.; Cheng, J.; Jurlina, S.L.; Jones, M.K.; Dash, N.R.; Ogata, A.; Kibria, N.; Ray, S.; Eldred, K.C.; Kim, C.; et al. CRISPR Generated SIX6 and POU4F2 Reporters Allow Identification of Brain and Optic Transcriptional Differences in Human PSC-Derived Organoids. Front. Cell Dev. Biol. 2021, 9, 764725. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, D.; Kuhns, R.; Dimitriou, C.N.; Barlow, E.; Wahlin, K.J.; Enke, R.A. Bulk RNA sequencing analysis of developing human induced pluripotent cell-derived retinal organoids. Sci. Data. 2022, 9, 759. [Google Scholar] [CrossRef] [Scilit]
- Anchan, R.M.; Lachke, S.A.; Gerami-Naini, B.; Lindsey, J.; Ng, N.; Naber, C.; Nickerson, M.; Cavallesco, R.; Rowan, S.; Eaton, J.L.; et al. Pax6- And Six3-Mediated Induction of Lens Cell Fate in Mouse and Human ES Cells. PLoS ONE 2014, 9, e115106. [Google Scholar] [CrossRef] [Scilit]
- Wu, W.; Liu, J.; Su, Z.; Li, Z.; Ma, N.; Huang, K.; Zhou, T.; Wang, L. Generation of H1 PAX6WT/EGFP Reporter Cells to Purify PAX6 Positive Neural Stem/Progenitor Cells. Biochem. Biophys. Res. Commun. 2018, 502, 442–449. [Google Scholar] [CrossRef] [Scilit]
- Völkner, M.; Zschätzsch, M.; Rostovskaya, M.; Overall, R.W.; Busskamp, V.; Anastassiadis, K.; Karl, M.O. Retinal Organoids from Pluripotent Stem Cells Efficiently Recapitulate Retinogenesis. Stem Cell Rep. 2016, 6, 525–538. [Google Scholar] [CrossRef] [Scilit]
- Fossat, N.; Greneur, C.L.; Béby, F.; Vincent, S.; Godement, P.; Chatelain, G.; Lamonerie, T. A New GFP-Tagged Line Reveals Unexpected Otx2 Protein Localization in Retinal Photoreceptors. BMC Dev. Biol. 2007, 7, 121. [Google Scholar] [CrossRef] [Scilit]
- Tegla, M.G.G.; Buenaventura, D.F.; Kim, D.Y.; Thakurdin, C.; Gonzalez, K.C.; Emerson, M.M. OTX2 Represses Sister Cell Fate Choices in the Developing Retina to Promote Photoreceptor Specification. eLife 2020, 9, e54279. [Google Scholar] [CrossRef] [Scilit]
- Yao, Z.; Mich, J.K.; Ku, S.; Menon, V.; Krostag, A.R.; Martinez, R.A.; Furchtgott, L.; Mulholland, H.; Bort, S.; Fuqua, M.A.; et al. A Single-Cell Roadmap of Lineage Bifurcation in Human ESC Models of Embryonic Brain Development. Cell Stem Cell 2017, 20, 120–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halliwell, J.; Barbaric, I.; Andrews, P.W. Acquired Genetic Changes in Human Pluripotent Stem Cells: Origins and Consequences. Nat. Rev. Mol. Cell Biol. 2020, 21, 715–728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Werbowetski-Ogilvie, T.E.; Bossé, M.; Stewart, M.; Schnerch, A.; Ramos-Mejia, V.; Rouleau, A.; Wynder, T.; Smith, M.J.; Dingwall, S.; Carter, T.; et al. Characterization of Human Embryonic Stem Cells with Features of Neoplastic Progression. Nat. Biotechnol. 2009, 27, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Fan, W.J.; Li, X.; Yao, H.L.; Deng, J.X.; Liu, H.L.; Cui, Z.J.; Wang, Q.; Wu, P.; Deng, J.B. Neural Differentiation and Synaptogenesis in Retinal Development. Neural Regen. Res. 2016, 11, 312–318. [Google Scholar] [CrossRef] [Scilit]
- Martins, R.A.P.; Pearson, R.A. Control of Cell Proliferation by Neurotransmitters in the Developing Vertebrate Retina. Brain Res. 2008, 1192, 37–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sholl-Franco, A.; Fragel-Madeira, L.; Macama, A.d.C.C.; Linden, R.; Ventura, A.L.M. ATP Controls Cell Cycle and Induces Proliferation in the Mouse Developing Retina. Int. J. Dev. Neurosci. 2010, 28, 63–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Decembrini, S.; Martin, C.; Sennlaub, F.; Chemtob, S.; Biel, M.; Samardzija, M.; Moulin, A.; Behar-Cohen, F.; Arsenijevic, Y. Cone Genesis Tracing by the Chrnb4-EGFP Mouse Line: Evidences of Cellular Material Fusion after Cone Precursor Transplantation. Mol. Ther. 2017, 25, 634–653. [Google Scholar] [CrossRef] [Scilit]
- Petridou, E.; Godinho, L. Cellular and molecular determinants of retinal cell fate. Cell. Mol. Determ. Retin. Cell Fate. 2022, 8, 79–99. [Google Scholar] [CrossRef] [Scilit]
- Daghsni, M.; Aldiri, I. Building a Mammalian Retina: An Eye on Chromatin Structure. Front. Genet. 2021, 12, 775205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tam, P.P.L.; Rossant, J. Mouse Embryonic Chimeras: Tools for Studying Mammalian Development. Development 2003, 130, 6155–6163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwama, Y.; Nomaru, H.; Masuda, T.; Kawamura, Y.; Matsumura, M.; Murata, Y.; Teranishi, K.; Nishida, K.; Ota, S.; Mandai, M.; et al. Label-Free Enrichment of Human Pluripotent Stem Cell-Derived Early Retinal Progenitor Cells for Cell-Based Regenerative Therapies. Stem Cell Rep. 2024, 19, 254–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez-Riverol, Y.; Bai, J.; Bandla, C.; García-Seisdedos, D.; Hewapathirana, S.; Kamatchinathan, S.; Kundu, D.J.; Prakash, A.; Frericks-Zipper, A.; Eisenacher, M.; et al. The PRIDE database resources in 2022: A hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 2022, 50, D543–D552. [Google Scholar] [CrossRef] [Scilit]








| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| GMEM | 439.5 mL | Not applicable | 21710-082, Gibco, Thermo Fisher Scientific, Waltham, MA, USA |
| Non-essential amino acid (100X) | 5 mL | 1% | M7145, Sigma-Aldrich, Saint Louis, MO, USA |
| Sodium Pyruvate (100X) | 5 mL | 1% | S8636, Sigma-Aldrich, Saint Louis, MO, USA |
| FBS | 50 mL | 10% | F7524, Sigma-Aldrich, Saint Louis, MO, USA |
| 2-mercaptoethanol | 0.5 mL | 0.1% | 21985-023, Gibco, Thermo Fisher Scientific, Waltham, MA, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| GMEM | 434.5 mL | Not applicable | 21710-082, Gibco, Thermo Fisher Scientific, Waltham, MA, USA |
| Non-essential amino acid (100X) | 5 mL | 1% | M7145, Sigma-Aldrich, Saint Louis, MO, USA |
| Sodium Pyruvate (100X) | 5 mL | 1% | S8636, Sigma-Aldrich, Saint Louis, MO, USA |
| FBS | 5 mL | 1% | F7524, Sigma-Aldrich, Saint Louis, MO, USA |
| KnockOut Serum Replacement | 50 mL | 10% | 10828-028, Thermo Fisher Scientific, Waltham, MA, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| ES medium | 49.995 mL | Not applicable | N/A |
| LIF | 5 µL | 10 ng/mL | 300-05, Peprotech, Cranbury, NJ, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| GMEM | 467 mL | Not applicable | 21710-082, Gibco, Thermo Fisher Scientific, Waltham, MA, USA |
| Non-essential amino acid (100X) | 5 mL | 1% | M7145, Sigma-Aldrich, Saint Louis, MO, USA |
| Sodium Pyruvate (100X) | 5 mL | 1% | S8636, Sigma-Aldrich, Saint Louis, MO, USA |
| KnockOut Serum Replacement | 7.5 mL | 1.5% | 10828-028, Thermo Fisher Scientific, Waltham, MA, USA |
| 2-mercaptoethanol | 0.5 mL | 0.1% | 21985-023, Gibco, Thermo Fisher Scientific, Waltham, MA, USA |
| N2 (100X) | 5 mL | 1% | 17502048, Thermo Fisher Scientific, Waltham, MA, USA |
| B27 without vitamin A (50X) | 10 mL | 2% | 12587010, Thermo Fisher Scientific, Waltham, MA, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| DMEM/F12-GlutaMAX | 49.5 mL | Not applicable | 31331028, Thermo Fisher Scientific, Waltham, MA, USA |
| N2 (100X) | 0.5 mL | 1% | 17502048, Thermo Fisher Scientific, Waltham, MA, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| DMEM/F12-GlutaMAX | 47.5 mL | Not applicable | 31331028, Thermo Fisher Scientific, Waltham, MA, USA |
| N2 (100X) | 0.5 mL | 1% | 17502048, Thermo Fisher Scientific, Waltham, MA, USA |
| B27 (50X) | 2 mL | 4% | 17504044, Thermo Fisher Scientific, Waltham, MA, USA |
| Ingredient | Volume | Final Concentration | Producer, Ref. |
|---|---|---|---|
| DMEM/F12-GlutaMAX | 48.95 mL | Not applicable | 31331028, Thermo Fisher Scientific, Waltham, MA, USA |
| Taurine | 50 µL of 100 mM stock | 1 mM | T0625-10G, Sigma-Aldrich, Saint Louis, MO, USA |
| B27 (50X) | 2 mL | 4% | 17504044, Thermo Fisher Scientific, Waltham, MA, USA |
| Rank | Target Sequence | Genomic Location | Off-Targets | sgRNAs Offset | Double-Strand Break Overhang | Depth of Exon-Coding Region Invasion by Single-Strand Break | |||
|---|---|---|---|---|---|---|---|---|---|
| 0 | 1 | 2 | 3 | ||||||
| 23 | GCGCCTCTAGAGGGCTTGCCAGGGCTTTCCGATGGCCTGGCTGTGCTCTTTGGCCTTC | Chr18:65934998 | 0/0 | 0/0 | 0/0 | 0/2 | −58 bp | 3′, 24 bp | 11 amino acids |
| 97 | CCACCAGGCTGGGCTGGGTGCACACAGGGCTCGCAGCAACTCCGCAGCGCCTCTAGAGGGCTTGCCAGG | Chr18:65934952 | 0/0 | 0/0 | 1/0 | 6/0 | 23 bp | 5′, 57 bp | 3 amino acids |
| 105 | CCAGGCTGGGCTGGGTGCACACAGGGCTCGCAGCAACTCCGCAGCGCCTCTAGAGGGCTTGCCAGG | Chr18:65934955 | 0/0 | 0/0 | 0/0 | 12/0 | 20 bp | 5′, 54 bp | 3 amino acids |
| 108 | CCTCTAGAGGGCTTGCCAGGGCTTTCCGATGGCCTGGATGTGCTCTTTGGCCTTCAGG | Chr18:65935001 | 0/0 | 0/0 | 0/0 | 6/7 | 12 bp | 5′, 46 bp | 16 amino acids |
| 110 | GGCTGGGCTGGGTGCACACAGGGCTCGCAACTCCGCAGCGCCTCTAGAGGGCTTGCCAGGGCT | Chr18:65934958 | 0/0 | 0/0 | 0/0 | 9/6 | −66 bp | 3′, 32 bp | 0 amino acids |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zabiegalov, O.; Berger, A.; Kamdar, D.; Adamou, K.; Tian, C.; Mbefo, M.; Quinodoz, M.; Udry, F.; Rivolta, C.; Kostic, C.; et al. Generation of a Double Reporter mES Cell Line to Simultaneously Trace the Generation of Retinal Progenitors and Photoreceptors. Cells 2025, 14, 252. https://doi.org/10.3390/cells14040252
Zabiegalov O, Berger A, Kamdar D, Adamou K, Tian C, Mbefo M, Quinodoz M, Udry F, Rivolta C, Kostic C, et al. Generation of a Double Reporter mES Cell Line to Simultaneously Trace the Generation of Retinal Progenitors and Photoreceptors. Cells. 2025; 14(4):252. https://doi.org/10.3390/cells14040252
Chicago/Turabian StyleZabiegalov, Oleksandr, Adeline Berger, Dhryata Kamdar, Kabirou Adamou, Chuanxi Tian, Martial Mbefo, Mathieu Quinodoz, Florian Udry, Carlo Rivolta, Corinne Kostic, and et al. 2025. "Generation of a Double Reporter mES Cell Line to Simultaneously Trace the Generation of Retinal Progenitors and Photoreceptors" Cells 14, no. 4: 252. https://doi.org/10.3390/cells14040252
APA StyleZabiegalov, O., Berger, A., Kamdar, D., Adamou, K., Tian, C., Mbefo, M., Quinodoz, M., Udry, F., Rivolta, C., Kostic, C., & Arsenijevic, Y. (2025). Generation of a Double Reporter mES Cell Line to Simultaneously Trace the Generation of Retinal Progenitors and Photoreceptors. Cells, 14(4), 252. https://doi.org/10.3390/cells14040252

