Non-Canonical Wnt16 and microRNA-145 Mediate the Response of Human Bone Marrow Stromal Cells to Additively Manufactured Porous 3-Dimensional Biomimetic Titanium–Aluminum–Vanadium Constructs
Abstract
1. Introduction
2. Materials and Methods
2.1. Construct Manufacturing
2.1.1. Computer-Aided Design of Constructs
2.1.2. Surface Treatment
2.2. Material Characterization
2.2.1. Scanning Electron Microscopy (SEM)
2.2.2. Laser Confocal Microscopy
2.2.3. Micro-Computed Tomography
2.3. Cell Culture
2.3.1. Bone Marrow Stromal Cells
2.3.2. Human Osteoclast Precursors (OCPs)
2.4. Biological Responses
2.4.1. Cellular Responses on 3D Porous and Fully Dense Ti6Al4V Disks
2.4.2. Autocrine Effect of Wnt16 on Cellular Response to Ti6Al4V Constructs
2.4.3. Paracrine Effect of the 3D Construct on Osteoclast Activity
2.4.4. The Effect of miR-145-5p on Differentiation of MSCs
2.4.5. Regulation of Wnt16 Production on Porous Ti6Al4V
2.5. Statistical Analysis
3. Results
3.1. Solid and Porous Ti6Al4V Constructs Have Comparable Surface Topography
3.2. Local Factor Production Varies with Construct Type and Incubation Time
3.3. Wnt16 Increased Cell Proliferation and Inhibited the Impact of 3D Porosity on Osteoblast Differentiation
3.4. MSCs Grown on 3D Constructs Produce Factors That Inhibit Osteoclast Activity
3.5. Wnt16 Acts via miR-145 and sema3A
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mobarak, M.H.; Islam, M.A.; Hossain, N.; Al Mahmud, M.Z.; Rayhan, M.T.; Nishi, N.J.; Chowdhury, M.A. Recent Advances of Additive Manufacturing in Implant Fabrication—A Review. Appl. Surf. Sci. Adv. 2023, 18, 100462. [Google Scholar] [CrossRef]
- Boland, G.M.; Perkins, G.; Hall, D.J.; Tuan, R.S. Wnt 3a Promotes Proliferation and Suppresses Osteogenic Differentiation of Adult Human Mesenchymal Stem Cells. J. Cell Biochem. 2004, 93, 1210–1230. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Schwartz, Z.; Gittens, R.A.; Cheng, A.; Olivares-Navarrete, R.; Chen, H.; Boyan, B.D. Role of Integrin A2 Β1 in Mediating Osteoblastic Differentiation on Three-Dimensional Titanium Scaffolds with Submicron-Scale Texture. J. Biomed. Mater. Res. A 2015, 103, 1907–1918. [Google Scholar] [CrossRef]
- Olivares-Navarrete, R.; Hyzy, S.L.; Park, J.H.; Dunn, G.R.; Haithcock, D.A.; Wasilewski, C.E.; Boyan, B.D.; Schwartz, Z. Mediation of Osteogenic Differentiation of Human Mesenchymal Stem Cells on Titanium Surfaces by a Wnt-Integrin Feedback Loop. Biomaterials 2011, 32, 6399–6411. [Google Scholar] [CrossRef]
- Cheng, A.; Chen, H.; Schwartz, Z.; Boyan, B.D. Imaging Analysis of the Interface between Osteoblasts and Microrough Surfaces of Laser-Sintered Titanium Alloy Constructs. J. Microsc. 2018, 270, 41–52. [Google Scholar] [CrossRef]
- Olivares-Navarrete, R.; Hyzy, S.L.; Haithcock, D.A.; Cundiff, C.A.; Schwartz, Z.; Boyan, B.D. Coordinated Regulation of Mesenchymal Stem Cell Differentiation on Microstructured Titanium Surfaces by Endogenous Bone Morphogenetic Proteins. Bone 2015, 73, 208–216. [Google Scholar] [CrossRef]
- Boyan, B.D.; Olivares-Navarrete, R.; Berger, M.B.; Hyzy, S.L.; Schwartz, Z. Role of Wnt11 during Osteogenic Differentiation of Human Mesenchymal Stem Cells on Microstructured Titanium Surfaces. Sci. Rep. 2018, 8, 8588. [Google Scholar] [CrossRef]
- Friedman, M.S.; Oyserman, S.M.; Hankenson, K.D. Wnt11 Promotes Osteoblast Maturation and Mineralization through R-Spondin 2. J. Biol. Chem. 2009, 284, 14117–14125. [Google Scholar] [CrossRef]
- Berger, M.B.; Bosh, K.; Deng, J.; Jacobs, T.W.; Cohen, D.J.; Boyan, B.D.; Schwartz, Z. Wnt16 Increases Bone-to-Implant Contact in an Osteopenic Rat Model by Increasing Proliferation and Regulating the Differentiation of Bone Marrow Stromal Cells. Ann. Biomed. Eng. 2024, 52, 1744–1762. [Google Scholar] [CrossRef]
- Gori, F.; Lerner, U.; Ohlsson, C.; Baron, R. A New WNT on the Bone: WNT16, Cortical Bone Thickness, Porosity and Fractures. Bonekey Rep. 2015, 4, 669. [Google Scholar] [CrossRef]
- Movérare-Skrtic, S.; Henning, P.; Liu, X.; Nagano, K.; Saito, H.; Börjesson, A.E.; Sjögren, K.; Windahl, S.H.; Farman, H.; Kindlund, B.; et al. Osteoblast-Derived WNT16 Represses Osteoclastogenesis and Prevents Cortical Bone Fragility Fractures. Nat. Med. 2014, 20, 1279–1288. [Google Scholar] [CrossRef] [PubMed]
- Movérare-Skrtic, S.; Wu, J.; Henning, P.; Gustafsson, K.L.; Sjögren, K.; Windahl, S.H.; Koskela, A.; Tuukkanen, J.; Börjesson, A.E.; Lagerquist, M.K.; et al. The Bone-Sparing Effects of Estrogen and WNT16 Are Independent of Each Other. Proc. Natl. Acad. Sci. USA 2015, 112, 14972–14977. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.; Von den Hoff, J.W.; Torensma, R.; Meng, L.; Bian, Z. Wnt16 Is Involved in Intramembranous Ossification and Suppresses Osteoblast Differentiation through the Wnt/β-Catenin Pathway. J. Cell Physiol. 2014, 229, 384–392. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhu, W.; Wang, L.; Wu, J.; Ding, F.; Song, Y. MiR-145-5p Suppresses Osteogenic Differentiation of Adipose-Derived Stem Cells by Targeting Semaphorin 3A. In Vitro Cell Dev. Biol. Anim. 2019, 55, 189–202. [Google Scholar] [CrossRef]
- Jin, Y.; Hong, F.; Bao, Q.; Xu, Q.; Duan, R.; Zhu, Z.; Zhang, W.; Ma, C. MicroRNA-145 Suppresses Osteogenic Differentiation of Human Jaw Bone Marrow Mesenchymal Stem Cells Partially via Targeting Semaphorin 3A. Connect. Tissue Res. 2020, 61, 577–585. [Google Scholar] [CrossRef]
- Kalil, E.C.; Cotrim, K.C.; Siqueira, R.; Moraschini, V.; Faverani, L.P.; Souza, J.G.G.; Shibli, J.A. Does an Osteoporosis-like Condition Jeopardize the Osseointegration Process around Dental Implants Placed in Animal Models? A Systematic Review. Int. J. Oral. Maxillofac. Implants 2024, 0, 1–32. [Google Scholar] [CrossRef]
- Lotz, E.M.; Cohen, D.J.; Schwartz, Z.; Boyan, B.D. Titanium Implant Surface Properties Enhance Osseointegration in Ovariectomy Induced Osteoporotic Rats without Pharmacologic Intervention. Clin. Oral. Implants Res. 2020, 31, 374–387. [Google Scholar] [CrossRef]
- Cohen, D.J.; Cheng, A.; Sahingur, K.; Clohessy, R.M.; Hopkins, L.B.; Boyan, B.D.; Schwartz, Z. Performance of Laser Sintered Ti-6Al-4V Implants with Bone-Inspired Porosity and Micro/Nanoscale Surface Roughness in the Rabbit Femur. Biomed. Mater. 2017, 12, 025021. [Google Scholar] [CrossRef]
- Cheng, A.; Cohen, D.J.; Kahn, A.; Clohessy, R.M.; Sahingur, K.; Newton, J.B.; Hyzy, S.L.; Boyan, B.D.; Schwartz, Z. Laser Sintered Porous Ti-6Al-4V Implants Stimulate Vertical Bone Growth. Ann. Biomed. Eng. 2017, 45, 2025–2035. [Google Scholar] [CrossRef]
- Cheng, A.; Humayun, A.; Boyan, B.D.; Schwartz, Z. Enhanced Osteoblast Response to Porosity and Resolution of Additively Manufactured Ti-6Al-4V Constructs with Trabeculae-Inspired Porosity. 3D Print. Addit. Manuf. 2016, 3, 10. [Google Scholar] [CrossRef]
- Cheng, A.; Humayun, A.; Cohen, D.J.; Boyan, B.D.; Schwartz, Z. Additively Manufactured 3D Porous Ti-6Al-4V Constructs Mimic Trabecular Bone Structure and Regulate Osteoblast Proliferation, Differentiation and Local Factor Production in a Porosity and Surface Roughness Dependent Manner. Biofabrication 2014, 6, 045007. [Google Scholar] [CrossRef] [PubMed]
- Alrabeah, G.O.; Brett, P.; Knowles, J.C.; Petridis, H. The Effect of Metal Ions Released from Different Dental Implant-Abutment Couples on Osteoblast Function and Secretion of Bone Resorbing Mediators. J. Dent. 2017, 66, 91–101. [Google Scholar] [CrossRef] [PubMed]
- Cohen, D.J.; Dennis, C.D.; Deng, J.; Boyan, B.D.; Schwartz, Z. Estradiol Induces Bone Osteolysis in Triple-Negative Breast Cancer via Its Membrane-Associated Receptor ERα36. JBMR Plus 2024, 8, ziae041. [Google Scholar] [CrossRef] [PubMed]
- Berger, M.B.; Jacobs, T.W.; Boyan, B.D.; Schwartz, Z. Hot Isostatic Pressure Treatment of 3D Printed Ti6Al4V Alters Surface Modifications and Cellular Response. J. Biomed. Mater. Res. B Appl. Biomater. 2020, 108, 1262–1273. [Google Scholar] [CrossRef]
- Stein, G.S.; Lian, J.B.; Owen, T.A. Relationship of Cell Growth to the Regulation of Tissue-Specific Gene Expression during Osteoblast Differentiation. FASEB J. 1990, 4, 3111–3123. [Google Scholar] [CrossRef]
- De Peppo, G.M.; Marolt, D. Modulating the Biochemical and Biophysical Culture Environment to Enhance Osteogenic Differentiation and Maturation of Human Pluripotent Stem Cell-Derived Mesenchymal Progenitors. Stem Cell Res. Ther. 2013, 4, 1–11. [Google Scholar] [CrossRef]
- Tang, Y.; Wu, X.; Lei, W.; Pang, L.; Wan, C.; Shi, Z.; Zhao, L.; Nagy, T.R.; Peng, X.; Hu, J.; et al. TGF-Beta1-Induced Migration of Bone Mesenchymal Stem Cells Couples Bone Resorption with Formation. Nat. Med. 2009, 15, 757–765. [Google Scholar] [CrossRef]
- Si, J.; Wang, C.; Zhang, D.; Wang, B.; Hou, W.; Zhou, Y. Osteopontin in Bone Metabolism and Bone Diseases. Med. Sci. Monit. 2020, 26, e919159-1. [Google Scholar] [CrossRef]
- Lotz, E.M.; Berger, M.B.; Boyan, B.D.; Schwartz, Z. Regulation of Mesenchymal Stem Cell Differentiation on Microstructured Titanium Surfaces by Semaphorin 3A. Bone 2020, 134, 115260. [Google Scholar] [CrossRef]
- Schwartz, Z.; Olivares-Navarrete, R.; Wieland, M.; Cochran, D.L.; Boyan, B.D. Mechanisms Regulating Increased Production of Osteoprotegerin by Osteoblasts Cultured on Microstructured Titanium Surfaces. Biomaterials 2009, 30, 3390–3396. [Google Scholar] [CrossRef]
- Fukuda, T.; Takeda, S.; Xu, R.; Ochi, H.; Sunamura, S.; Sato, T.; Shibata, S.; Yoshida, Y.; Gu, Z.; Kimura, A.; et al. Sema3A Regulates Bone-Mass Accrual through Sensory Innervations. Nature 2013, 497, 490–493. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Cohen, D.J.; Sabalewski, E.L.; Van Duyn, C.; Wilson, D.S.; Schwartz, Z.; Boyan, B.D. Semaphorin 3A Delivered by a Rapidly Polymerizing Click Hydrogel Overcomes Impaired Implant Osseointegration in a Rat Type 2 Diabetes Model. Acta Biomater. 2023, 157, 236–251. [Google Scholar] [CrossRef] [PubMed]
- Boyce, B.F.; Xing, L. The RANKL/RANK/OPG Pathway. Curr. Osteoporos. Rep. 2007, 5, 98–104. [Google Scholar] [CrossRef]
- Boyce, B.F.; Xing, L. Functions of RANKL/RANK/OPG in Bone Modeling and Remodeling. Arch. Biochem. Biophys. 2008, 473, 139–146. [Google Scholar] [CrossRef]
- Deng, J.; Cohen, D.J.; Berger, M.B.; Sabalewski, E.L.; McClure, M.J.; Boyan, B.D.; Schwartz, Z. Osseointegration of Titanium Implants in a Botox-Induced Muscle Paralysis Rat Model Is Sensitive to Surface Topography and Semaphorin 3A Treatment. Biomimetics 2023, 8, 93. [Google Scholar] [CrossRef]
Gene | Primer Sequence |
---|---|
h_GAPDH_F | GCTCTCCAGAACATCATCC |
h_GAPDH_R | TGCTTCACCACCTTCTTG |
h_U6 F1 | CTCGCTTCGGCAGCACA |
h_U6 R1 | AACGCTTCACGAATTTGCGT |
h_WNT16_F | TCTCCATCTCTCCTACAGCTCC |
h_WNT16_R | ACATCCAGTTTCCTTGGGCT |
h_145-5p F | AGCCGGTCCAGTTTTCCCAGGA |
h_145-5p R | GTGCAGGGTCCGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cohen, D.J.; Berger, M.B.; Deng, J.; Jacobs, T.W.; Boyan, B.D.; Schwartz, Z. Non-Canonical Wnt16 and microRNA-145 Mediate the Response of Human Bone Marrow Stromal Cells to Additively Manufactured Porous 3-Dimensional Biomimetic Titanium–Aluminum–Vanadium Constructs. Cells 2025, 14, 211. https://doi.org/10.3390/cells14030211
Cohen DJ, Berger MB, Deng J, Jacobs TW, Boyan BD, Schwartz Z. Non-Canonical Wnt16 and microRNA-145 Mediate the Response of Human Bone Marrow Stromal Cells to Additively Manufactured Porous 3-Dimensional Biomimetic Titanium–Aluminum–Vanadium Constructs. Cells. 2025; 14(3):211. https://doi.org/10.3390/cells14030211
Chicago/Turabian StyleCohen, David. J., Michael B. Berger, Jingyao Deng, Thomas W. Jacobs, Barbara D. Boyan, and Zvi Schwartz. 2025. "Non-Canonical Wnt16 and microRNA-145 Mediate the Response of Human Bone Marrow Stromal Cells to Additively Manufactured Porous 3-Dimensional Biomimetic Titanium–Aluminum–Vanadium Constructs" Cells 14, no. 3: 211. https://doi.org/10.3390/cells14030211
APA StyleCohen, D. J., Berger, M. B., Deng, J., Jacobs, T. W., Boyan, B. D., & Schwartz, Z. (2025). Non-Canonical Wnt16 and microRNA-145 Mediate the Response of Human Bone Marrow Stromal Cells to Additively Manufactured Porous 3-Dimensional Biomimetic Titanium–Aluminum–Vanadium Constructs. Cells, 14(3), 211. https://doi.org/10.3390/cells14030211