miR-1233-3p Inhibits Angiopoietin-1-Induced Endothelial Cell Survival, Migration, and Differentiation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. Growth Factor Treatment
2.4. miRNA Abundance Studies
2.5. miRNA Extraction and Quantitative Real-Time PCR
2.6. mRNA Extraction and Quantitative Real-Time PCR
2.7. Tie-2 Blocking Assays
2.8. Exosomes Extraction
2.9. Transfection miRNA Mimics and Inhibitors
2.10. Cell Counting
2.11. Caspase-3 Activity
2.12. Cell Migration
2.13. Capillary-like Tube Formation
2.14. Proliferation
2.15. Immunoblotting
2.16. Biotin-Labeled Pull-Down Assays
2.17. Statistical Analysis
3. Results
3.1. Regulation of miR-1233-3p by Ang-1
3.2. Regulation of EC Survival by miR-1233-3p
3.3. Regulation of EC Migration by miR-1233-3p
3.4. Effects of miR-1233-3p on EC Differentiation
3.5. Regulation of EC Proliferation by miR-1233-3p
3.6. PDRG1 Is a Direct Target miR-1233-3p
3.7. Regulation of PDRG1 Expression by Ang-1
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eelen, G.; Treps, L.; Li, X.; Carmeliet, P. Basic and therapeutic aspects of angiogenesis updated. Circ. Res. 2020, 127, 310–329. [Google Scholar] [CrossRef]
- Fagiani, E.; Christofori, G. Angiopoietins in angiogenesis. Cancer Lett. 2013, 328, 18–26. [Google Scholar] [CrossRef] [PubMed]
- Harfouche, R.; Gratton, J.P.; Yancopoulos, G.D.; Noseda, M.; Karsan, A.; Hussain, S.N.A. Angiopoietin-1 activates both anti- and proapoptotic mitogen-activated protein kinases. FASEB J. 2003, 17, 1523. [Google Scholar] [CrossRef] [PubMed]
- Suri, C.; Jones, P.F.; Patan, S.; Bartunkova, S.; Maisonpierre, P.C.; Davis, S.; Sato, T.N.; Yancopoulos, G.D. Requisite role of Angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell 1996, 87, 1171–1180. [Google Scholar] [CrossRef]
- Partanen, J.; Dumont, D.J. Functions of Tie1 and Tie2 receptor tyrosine kinases in vascular development. Curr. Top. Microbiol. Immunol. 1999, 237, 159–172. [Google Scholar] [CrossRef] [PubMed]
- Tachibana, K.; Jones, N.; Dumont, D.J.; Puri, M.C.; Bernstein, A. Selective role of a distinct tyrosine residue on Tie2 in heart development and early hematopoiesis. Mol. Cell. Biol. 2005, 25, 4693–4702. [Google Scholar] [CrossRef]
- Brindle, N.P.; Saharinen, P.; Alitalo, K. Signaling and functions of angiopoietin-1 in vascular protection. Circ. Res. 2006, 98, 1014–1023. [Google Scholar] [CrossRef] [PubMed]
- Thurston, G.; Rudge, J.S.; loffe, E.; Zhou, H.; Ross, L.; Croll, S.D.; Glazer, N.; Holash, J.; McDonald, D.M.; Yancopoulos, G.D. Angiopoietin-1 protects the adult vasculature against plasma leakage. Nat. Med. 2000, 6, 460–463. [Google Scholar] [CrossRef]
- Balakumar, P.; Kaur, T.; Singh, M. Potential target sites to modulate vascular endothelial dysfunction: Current perspectives and future directions. Toxicology 2008, 245, 49–64. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J. Non-coding RNAs and angiogenesis in cardiovascular diseases: A comprehensive review. Mol. Cell Biochem. 2024, 479, 2921–2953. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, J.; Cowan, D.B.; Wang, D.Z. Non-coding RNAs in cardiac regeneration: Mechanism of action and therapeutic potential. Semin. Cell Dev. Biol. 2021, 118, 150–162. [Google Scholar] [CrossRef] [PubMed]
- Denli, A.M.; Tops, B.B.J.; Plasterk, R.H.A.; Ketting, R.F.; Hannon, G.J. Processing of primary microRNAs by the Microprocessor complex. Nature 2004, 432, 231–235. [Google Scholar] [CrossRef] [PubMed]
- Gregory, R.I.; Yan, K.P.; Amuthan, G.; Chendrimada, T.; Doratotaj, B.; Cooch, N.; Shiekhattar, R. The Microprocessor complex mediates the genesis of microRNAs. Nature 2004, 432, 235–240. [Google Scholar] [CrossRef] [PubMed]
- Bohnsack, M.T.; Czaplinski, K.; Gorlich, D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 2004, 10, 185–191. [Google Scholar] [CrossRef] [PubMed]
- Chendrimada, T.P.; Gregory, R.I.; Kumaraswamy, E.; Norman, J.; Cooch, N.; Nishikura, K.; Shiekhattar, R. TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 2005, 436, 740–744. [Google Scholar] [CrossRef] [PubMed]
- Zampetaki, A.; Mayr, M. MicroRNAs in Vascular and Metabolic Disease. Circ. Res. 2012, 110, 508–522. [Google Scholar] [CrossRef] [PubMed]
- Rosano, S.; Cora, D.; Parab, S.; Zaffuto, S.; Isella, C.; Porporato, R.; Hoza, R.M.; Calogero, R.A.; Riganti, C.; Bussolino, F.; et al. A regulatory microRNA network controls endothelial cell phenotypic switch during sprouting angiogenesis. eLife 2020, 9, e48095. [Google Scholar] [CrossRef] [PubMed]
- Moszynska, A.; Jaśkiewicz, M.; Serocki, M.; Cabaj, A.; Crossman, D.K.; Bartoszewska, S.; Gebert, M.; Dabrowski, M.; Collawn, J.F.; Bartoszewski, R. The hypoxia-induced changes in miRNA-mRNA in RNA-induced silencing complexc and HIF-2 induced miRNA in human endothelial cells. FASEB J. 2022, 36, e22412. [Google Scholar] [CrossRef]
- van Rooij, E.; Sutherland, L.B.; Thatcher, J.E.; DiMaio, J.M.; Naseem, R.H.; Marshall, W.S.; Hill, J.A.; Olson, E.N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc. Nat. Acad. Sci. USA 2008, 105, 13027–13032. [Google Scholar] [CrossRef]
- Mutharasan, R.K.; Nagpal, V.; Ichikawa, Y.; Ardehali, H. microRNA-210 is upregulated in hypoxic cardiomyocytes through Akt- and p53-dependent pathways and exerts cytoprotective effects. Am. J. Physiol. Heart Circ. Physiol. 2011, 301, H1519–H1530. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, V.; Golyardi, F.; Mayaki, D.; Echavarria, R.; Harel, S.; Xia, J.; Hussain, S.N.A. Negative regulation of angiogenesis by novel micro RNAs. Pharmacol. Res. 2019, 139, 173–181. [Google Scholar] [CrossRef] [PubMed]
- Qureshi, R.; Sacan, A. A novel method for the normalization of microRNA RT-PCR data. BMC Med. Genom. 2013, 6, S14. [Google Scholar] [CrossRef] [PubMed]
- Carpentier, G.; Martinelli, M.; Courty, J.; Cascone, I. The 4th ImageJ User and Developer Conference Proceedings. 2012, 198–201. ISBN: 2-919941-18-6. Available online: http://image.bio.methods.free.fr/ImageJ/IMG/pdf/angiogenesisanalyzer.pdf (accessed on 17 November 2024).
- Wang, Y.L.; Juranek, S.; Li, H.; Sheng, G.; Tuschl, T.; Patel, D.J. Structure of an argonaute silencing complex with a seed-containing guide DNA and target RNA duplex. Nature 2008, 456, 921–926. [Google Scholar] [CrossRef] [PubMed]
- Cloonan, N.; Wani, S.; Xu, Q.; Gu, J.; Lea, K.; Heater, S.; Barbacioru, C.; Steptoe, A.L.; Martin, H.C.; Nourbakhsh, E.; et al. MicroRNAs and their isomiRs function cooperatively to target common biological pathways. Gen. Biol. 2011, 12c, R126. [Google Scholar] [CrossRef]
- Orom, U.A.; Lund, A.H. Isolation of microRNA targets using biotinylated synthetic microRNAs. Methods 2007, 43, 162–165. [Google Scholar] [CrossRef]
- Guduric-Fuchs, J.; O’Connor, A.; Camp, B.; O’Neill, C.L.; Medina, R.J.; Simpson, D.A. Selective extracellular vesicle-mediated export of an overlapping set of microRNAs from multiple cell types. BMC Genom. 2012, 13, 357. [Google Scholar] [CrossRef]
- Shaban, S.A.; Rezaie, J.; Nejati, V. Exosomes derived from senescent endothelial cells contain distinct pro-angiogenic miRNAs and proteins. Cardiovasc. Toxicol. 2022, 22, 592–601. [Google Scholar] [CrossRef] [PubMed]
- Silva, J.; Garcia, V.; Zaballos, A.; Provencio, M.; Lombardia, L.; Almonacid, L.; Garcia, J.M.; Dominguez, G.; Pena, C.; Diaz, R.; et al. Vesicle-related microRNAs in plasma of nonsmall cell lung cancer patients and correlation with survival. Eur. Respir. J. 2011, 37, 617–623. [Google Scholar] [CrossRef]
- Dill, H.; Linder, B.; Fehr, A.; Fischer, U. Intronic miR-26b controls neuronal differentiation by repressing its host transcript, ctdsp2. Genes Dev. 2012, 26, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Suarez, Y.; Fernández-Hernando, C.; Yu, J.; Gerber, S.A.; Harrison, K.D.; Pober, J.S.; Iruela-Arispe, M.L.; Merkenschlager, M.; Sesa, W.C. Dicer-dependent endothelial microRNAs are necessary for postnatal angiogenesis. Proc. Nat. Acad. Sci. USA 2008, 105, 14082–14087. [Google Scholar] [CrossRef] [PubMed]
- Wuerdinger, T.; Tannous, B.A.; Saydam, O.; Skog, J.; Grau, S.; Soutschek, J.; Weissleder, E.; Breakefield, X.O.; Krichevsky, A. miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells. Cancer Cell. 2008, 14, 382–393. [Google Scholar] [CrossRef]
- Smits, M.; Mir, S.E.; A Nilsson, R.J.; van der Stoop, P.M.; Niers, J.M.; Marquez, V.E.; Cloos, J.; Breakefield, X.O.; Krichevsky, A.M.; Noske, D.P.; et al. Down-Regulation of miR-101 in endothelial cells promotes blood vessel formation through reduced repression of EZH2. PLoS ONE 2011, 6, e16282. [Google Scholar] [CrossRef] [PubMed]
- Echavarria, R.; Mayaki, D.; Neel, J.C.; Harel, S.; Sachez, V.; Hussain, S.N.A. Angiopoietin-1 inhibits toll-like receptor 4 signalling in cultured endothelial cells: Role of miR-146b-5p. Cardiovasc. Res. 2015, 106, 465–477. [Google Scholar] [CrossRef]
- Vickers, K.C.; Palmisano, B.T.; Shoucri, B.M.; Shamburek, R.D.; Remaley, A.T. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat. Cell Biol. 2011, 13, 423–433. [Google Scholar] [CrossRef]
- Zhang, S.; Yang, Y.; Lv, X.; Liu, W.; Zhu, S.; Wang, Y.; Xu, H. Unraveling the intricate roles of exosomes in cardiovascular diseases: A comprehensive review of physiological significance and pathological implications. Int. J. Mol. Sci. 2023, 24, 15677. [Google Scholar] [CrossRef]
- Mause, S.F.; Weber, C. Microparticles protagonists of a novel communication network for intercellular information exchange. Cir. Res. 2010, 107, 1047–1057. [Google Scholar] [CrossRef] [PubMed]
- Zhong, W.Y.; Peng, H.; Tian, A.; Wei, Y.; Li, H.; Tian, J.; Zhao, X. Expression of miRNA-1233 in placenta from patients with hypertensive disorder complicating pregnancy and its role in disease pathogenesis. Internat. J. Clin. Exp. Med. 2015, 8, 9121–9127. [Google Scholar]
- Munaut, C.; Tebache, L.; Blacher, S.; Noel, A.; Nisolle, M.; Chantraine, F. Dysregulated circulating miRNAs in preeclampsia. Biomed. Rep. 2016, 5, 686–692. [Google Scholar] [CrossRef]
- Wulfken, L.M.; Moritz, R.; Ohlmann, C.; Holdenrieder, S.; Jung, V.; Becker, F.; Herrmann, E.; Walgenbach-Brünagel, G.; von Ruecker, A.; Muller, S.C.; et al. MicroRNAs in renal cell carcinoma: Diagnostic implications of serum miR-1233 levels. PLoS ONE 2011, 6, e25787. [Google Scholar] [CrossRef] [PubMed]
- Boudreau, N.J.; Varner, J.A. The homeobox transcription factor Hox D3 promotes integrin alpha(5)beta(1) expression and function during angiogenesis. J. Biol. Chem. 2004, 279, 4862–4868. [Google Scholar] [CrossRef]
- Mace, K.A.; Hansen, S.L.; Myers, C.; Young, D.M.; Boudreau, N. HOXA3 induces cell migration in endothelial and epithelial cells promoting angiogenesis and wound repair. J. Cell Sci. 2005, 118, 2567–2577. [Google Scholar] [CrossRef]
- Myers, C.; Charboneau, A.; Boudreau, N. Homeobox B3 promotes capillary morphogenesis and angiogenesis. J. Cell Biol. 2000, 148, 343–351. [Google Scholar] [CrossRef]
- Myers, C.; Charboneau, A.; Cheung, I.; Hanks, D.; Boudreau, N. Sustained expression of homeobox D10 inhibits angiogenesis. Am. J. Path. 2002, 161, 2099–2109. [Google Scholar] [CrossRef] [PubMed]
- Raman, V.; Martensen, S.A.; Reisman, D.; Evron, E.; Odenwald, W.F.; Jaffee, E.; Marks, J.; Sukumar, S. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 2000, 405, 974–978. [Google Scholar] [CrossRef] [PubMed]
- Chung, N.; Bo, K.J.; Chae, S.W.; Jeon, Y.W.; Lee, K.H.; Rha, H.K. HOX gene analysis of endothelial cell differentiation in human bone marrow-derived mesenchymal stem cells. Mol. Biol. Rep. 2009, 36, 227–235. [Google Scholar] [CrossRef]
- Chen, J.; Zhu, S.; Jiang, N.; Shang, Z.; Quan, C.; Niu, Y. HoxB3 promotes prostate cancer cell progression by transactivating CDCA3. Cancer Lett. 2013, 330, 217–224. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.J.; Yan, R.L.; Zhang, X.; Zhu, Z.; Wang, C.W.; Liang, C.; Zhang, X. Deregulation of MicroRNA-375 inhibits cancer proliferation migration and chemosensitivity in pancreatic cancer through the association of HOXB3. Am. J. Trans. Res. 2016, 8, 1551–1559. [Google Scholar]
- Luo, X.Q.; Huang, Y.; Sheikh, M.S. Cloning and characterization of a novel gene PDRG that is differentially regulated by p53 and ultraviolet radiation. Oncogene 2003, 22, 7247–7257. [Google Scholar] [CrossRef]
- Boulon, S.; Pradet-Balade, B.; Verheggen, C.; Molle, D.; Boireau, S.; Georgieva, M.; Azzang, K.; Robert, M.C.; Ahmad, Y.; Neel, H.; et al. HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II. Mol. Cell 2010, 39, 912–924. [Google Scholar] [CrossRef]
- Mita, P.; Savas, J.N.; Ha, S.; Djouder, N.; Yates III, J.R.; Logan, S.K. Analysis of URI nuclear interaction with RPB5 and components of the R2TP/prefoldin-like complex. PLoS ONE 2013, 8, e63879. [Google Scholar] [CrossRef]
- Jiang, L.Y.; Luo, X.Q.; Shi, J.X.; Sun, H.; Sun, Q.; Sheikh, M.S.; Huang, Y. PDRG1, a novel tumor marker for multiple malignancies that is selectively regulated by genotoxic stress. Cancer Biol. Therap. 2011, 11, 567–573. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.M.; Xu, Y.X.; Liu, J.; Cui, H.Y.; Cao, H.W.; Ren, J. PDRG1 promotes the proliferation and migration of GBM cells by MEK/ERK/CD44 pathway. Cancer Sci. 2022, 113, 500–516. [Google Scholar] [CrossRef]
- Xu, Y.X.; Liu, J.; Jiang, T.; Shi, L.S.; Shang, L.; Song, J.; Li, L.P. PDRG1 predicts poor prognosis and facilitates the proliferation and metastasis of colorectal cancer. Exp. Cell. Res. 2021, 409, 112924. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′→3′) | Accession Number | Expected Size (bp) |
---|---|---|---|
β-ACTIN | F: AGAAAATCTGGCACCACACC R: GGGGTGTTGAAGGTCTCAAA | NM_001101 | 126 |
GAPDH | F: AAGAAGGTGGTGAAGCAGGCG R: ACCAGGAAATGAGCTTGACAA | NM_02396.1 | 166 |
GOLGA8A GOLGA8B | F: TAGGCTCCCGTGCTTTTCT R: AAAGCTCCCCCAAAAGGTTA | NM_181077.3 NM_001023567.4 | 285 285 |
PDRG1 | F: TGGGTGGTTGCTGAATGAAG R: GGTAAGAGGCGCATCCACTC | NM_030815.2 | 222 |
CENPB | F:GACGTTCCGGGAGAAGTCAC R:AGCCCTCGAGCTTGTCGTAG | NM_001810.5 | 215 |
HOXB3 | F: GGTGGAGCTGGAGAAGGAGT R: GGCCTTCTGGTCCTTCTTGT | NM_002146.4 | 148 |
ZFP91 | F: CTCGCTATTTGCAGCACCACR: GCCCGAGCACAATATTCACA | NM_053023.4 | 165 |
miR-1233-3p | F:TGAGCCCTGTCCTCCCGCAG | MIMAT0005588 | |
miR1233-5p | F:AGTGGGAGGCCAGGGCACGGCA | MIMAT0022943 | |
pre-miR-1233 | F: AGTGGGAGGCCAGGGCACGGCA R: GCGGGAGGACAGGGCTCA | NR_036050 | |
U6 | F: ACTAAAATTGGAACGATACAGAGA | NR_004394.1 | |
5S | F: ATACCGGGTGCTGTAGGCTT | D14867 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanchez, V.; Harel, S.; Sa’ub, A.K.; Mayaki, D.; Hussain, S.N.A. miR-1233-3p Inhibits Angiopoietin-1-Induced Endothelial Cell Survival, Migration, and Differentiation. Cells 2025, 14, 75. https://doi.org/10.3390/cells14020075
Sanchez V, Harel S, Sa’ub AK, Mayaki D, Hussain SNA. miR-1233-3p Inhibits Angiopoietin-1-Induced Endothelial Cell Survival, Migration, and Differentiation. Cells. 2025; 14(2):75. https://doi.org/10.3390/cells14020075
Chicago/Turabian StyleSanchez, Veronica, Sharon Harel, Anas Khalid Sa’ub, Dominique Mayaki, and Sabah N. A. Hussain. 2025. "miR-1233-3p Inhibits Angiopoietin-1-Induced Endothelial Cell Survival, Migration, and Differentiation" Cells 14, no. 2: 75. https://doi.org/10.3390/cells14020075
APA StyleSanchez, V., Harel, S., Sa’ub, A. K., Mayaki, D., & Hussain, S. N. A. (2025). miR-1233-3p Inhibits Angiopoietin-1-Induced Endothelial Cell Survival, Migration, and Differentiation. Cells, 14(2), 75. https://doi.org/10.3390/cells14020075