Modeling Aberrant Angiogenesis in Arteriovenous Malformations Using Endothelial Cells and Organoids for Pharmacological Treatment
Abstract
1. Introduction
2. Materials and Methods
2.1. Patient-Derived Human Samples and Cell Isolation
2.2. Pharmacological Treatment of AVM Endothelial Cells and AVM Organoids
2.3. Phenotypic and Molecular Characterization of AVM ECs
2.3.1. Isolation and Culture of Human Endothelial Cells (hECs)
2.3.2. Immunofluorescence and Brightfield Imaging Analysis
2.3.3. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.3.4. TaqMan Assay (Mir)
2.3.5. Tube Formation Assay
2.4. Establishment and Immunostaining of AVM Organoids
2.4.1. Isolation and Reprogramming of Human Fibroblasts
2.4.2. Generation of Blood Vessel Organoids (BVOs)
2.4.3. Whole-Mount Immunofluorescence of AVM Organoids
2.5. Statistical Analysis
3. Results
3.1. Pharmacological Treatment of AVM ECs
3.1.1. Morphological Changes in AVM ECs Following Pharmacological Treatment
3.1.2. Immunofluorescence Images of AVM ECs Treated with Thalidomide, Rapamycin, and U0126
3.1.3. Expression of Angiogenesis-Associated Genes in AVM ECs After Pharmacological Treatment
3.1.4. Expression of miR-135b-5p in AVM ECs After Pharmacological Treatment
3.1.5. Tube Formation Assay
3.2. Immunofluorescent Analysis of AVM Organoids Following Pharmacological Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Adams, D.M. Practical genetic and biologic therapeutic considerations in vascular anomalies. Tech. Vasc. Interv. Radiol. 2019, 22, 100629. [Google Scholar] [CrossRef] [PubMed]
- Wallner, C.; Kehrer, A.; Rössler, J.; Körber, M.I.; Karuppusamy, K.; Wetzig, T.; Rössler, M.; Meila, D. Extracranial arteriovenous malformations: A 10-year experience at a German vascular anomaly center and evaluation of diagnostic imaging for endovascular therapy assessment. Front. Med. 2024, 11, 1473685. [Google Scholar] [CrossRef] [PubMed]
- Coulie, J.; Vikkula, M.; Boon, L.M. Extracranial arteriovenous malformations: Towards etiology-based therapeutic management. J. Clin. Investig. 2025, 135, e172837. [Google Scholar] [CrossRef] [PubMed]
- Adams, D.M.; Trenor, C.C.; Hammill, A.M.; Vinks, A.A.; Patel, M.N.; Chaudry, G.; Wentzel, M.S.; Mobberley-Schuman, P.S.; Campbell, L.M.; Brookbank, C.; et al. Efficacy and safety of sirolimus in the treatment of complicated vascular anomalies. Pediatrics 2016, 137, e20153257. [Google Scholar] [CrossRef] [PubMed]
- Favata, M.F.; Horiuchi, K.Y.; Manos, E.J.; Daulerio, A.J.; Stradley, D.A.; Feeser, W.S.; Van Dyk, D.E.; Pitts, W.J.; Earl, R.A.; Hobbs, F.; et al. Identification of a Novel Inhibitor of Mitogen-activated Protein Kinase Kinase. J. Biol. Chem. 1998, 273, 18623–18632. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Zhou, J.; Chen, Y.; Yang, X.; Hua, C.; Jin, Y.; Lin, X. MEK inhibitors for the treatment of extracranial arteriovenous malformations. Chin.J. Plast. Reconstr. Surg. 2023, 5, 141–144. [Google Scholar] [CrossRef]
- Couto, J.A.; Huang, A.Y.; Konczyk, D.J.; Goss, J.A.; Fisherman, S.J.; Mulliken, J.B.; Mulliken, J.B.; Warman, M.L. Somatic MAP2K1 mutations are associated with extracranial arteriovenous malformation. Am. J. Hum. Genet. 2017, 100, 546–554. [Google Scholar] [CrossRef] [PubMed]
- Boon, L.M.; Dekeuleneer, V.; Coulie, J.; Brouillard, P.; Vikkula, M. Case Report Study of Thalidomide Therapy in 18 Patients with Severe Arteriovenous Malformations. Nat. Cardiovasc. Res. 2022, 1, 562–567. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, S.; Xue, A.; Shi, J.; Zheng, C.; Huang, Y. Thalidomide inhibits angiogenesis via downregulation of VEGF and angiopoietin-2 in Crohn’s disease. Inflammation 2021, 44, 795–807. [Google Scholar] [CrossRef] [PubMed]
- Rafiee, P.; Stein, D.J.; Nelson, V.M.; Otterson, M.F.; Shaker, R.; Binion, D.G. Thalidomide inhibits inflammatory and angiogenic activation of human intestinal microvascular endothelial cells (HIMEC). Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 298, G167–G176. [Google Scholar] [CrossRef] [PubMed]
- Vargesson, N. Thalidomide-induced limb defects: Resolving a 50-year-old puzzle. BioEssays 2015, 37, 564–572. [Google Scholar] [CrossRef] [PubMed]
- Eklund, L.; Bry, M.; Alitalo, K. Mouse models for studying angiogenesis and lymphangiogenesis in cancer. Mol Oncol. 2013, 7, 259–282. [Google Scholar] [CrossRef] [PubMed]
- Kural, M.H.; Dai, G.; Niklason, L.E.; Gui, L. An Ex vivo vessel injury model to study remodeling. Cell Transplant. 2018, 27, 1375–1389. [Google Scholar] [CrossRef] [PubMed]
- Oh, E.J.; Kim, H.M.; Kwak, S.; Huh, C.; Chung, H.Y. The Formation of Human Arteriovenous Malformation Organoids and Their Characteristics. Cells 2024, 13, 1955. [Google Scholar] [CrossRef] [PubMed]
- Soon, K.; Li, M.; Wu, R.; Zhou, A.; Khosraviani, N.; Turner, W.D.; Wythe, J.D.; Fish, J.E.; Nunes, S.S. A human model of arteriovenous malformation (AVM)-on-a-chip reproduces key disease hallmarks and enables drug testing in perfused human vessel networks. Biomaterials 2022, 288, 121729. [Google Scholar] [CrossRef] [PubMed]
- Fraissenon, A.; Bayard, C.; Morin, G.; Benichi, S.; Hoguin, C.; Protic, S.; Zerbib, L.; Ladraa, S.; Firpion, M.; Blauwblomme, T.; et al. Sotorasib for Vascular Malformations Associated with KRAS G12C Mutation. N. Engl. J. Med. 2024, 391, 334–342. [Google Scholar] [CrossRef] [PubMed]
- Bourdeau, A.; Dumont, D.J.; Letarte, M. A murine model of hereditary hemorrhagic telangiectasia. J. Clin. Investig. 1999, 104, 1343–1351. [Google Scholar] [CrossRef] [PubMed]
- Ruiz, S.; Zhao, H.; Chandakkar, P.; Papoin, J.; Choi, H.; Nomura-Kitabayashi, A.; Patel, R.; Gillen, M.; Diao, L.; Chatterjee, P.K.; et al. Correcting Smad1/5/8, mTOR, and VEGFR2 treats pathology in hereditary hemorrhagic telangiectasia models. J. Clin. Investig. 2020, 130, 942–957. [Google Scholar] [CrossRef] [PubMed]
- Nelin, L.D.; White, H.A.; Jin, Y.; Trittmann, J.K.; Chen, B.; Liu, Y. The Src family tyrosine kinases src and yes have differential effects on inflammation-induced apoptosis in human pulmonary microvascular endothelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 2016, 310, L880–L888. [Google Scholar] [CrossRef] [PubMed]
- Marx, S.O.; Marks, A.R.; Woods, T.C. Rapamycin Regulates Endothelial Cell Migration through Regulation of the Cyclin-dependent Kinase Inhibitor p27Kip1. J. Biol. Chem. 2010, 285, 11991–11997. [Google Scholar] [CrossRef] [PubMed]
- Suehiro, J.; Kanki, T.; Makihara, C.; Schadler, K.; Miura, M.; Manabe, Y.; Aburatani, H.; Kodama, T.; Minami, T. Genome-wide approaches reveal functional VEGF-inducible NFATc1 binding to angiogenesis-related genes in the endothelium. J. Biol. Chem. 2014, 289, 29044–29059. [Google Scholar] [CrossRef] [PubMed]
- Seebauer, C.T.; Wiens, B.; Hintschich, C.A.; da Silva, N.P.B.; Evert, K.; Haubner, F.; Kapp, F.G.; Wendl, C.; Renner, K.; Bohr, C.; et al. Targeting the microenvironment in the treatment of arteriovenous malformations. Angiogenesis 2024, 27, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Lobov, I.B.; Brooks, P.C.; Lang, R.A. Angiopoietin-2 displays VEGF-dependent modulation of capillary structure and endothelial cell survival in vivo. Proc. Natl. Acad. Sci. USA 2002, 99, 11205–11210. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Zhang, L.; Liu, X.; Sun, W.; Kato, K.; Chen, C.; Li, X.; Li, T.; Sun, Z.; Han, W.; et al. Angiocrine FSTL1 (Follistatin-Like Protein 1) Insufficiency Leads to Atrial and Venous Wall Fibrosis via SMAD3 Activation. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 958–972. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.-H.; Fong, L.W.R.; Yu, E.; Wu, R.; Trorr, J.F.; Weiss, R.H. Upregulation of MARCKS in kidney cancer and its potential as a therapeutic target. Oncogene 2017, 36, 3588–3598. [Google Scholar] [CrossRef] [PubMed]
- Besler, M.; Dost, F.S.; Şenler, F.Ç.; Kirmizi, B.A.; Savaş, B.; Akbulut, H. The role of pericytes on the efficacy of bevacizumab in colorectal cancer. Turk. J. Med. Sci. 2022, 52, 1543–1550. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Kim, G.; Lee, J.H.; Ryu, J.Y.; Oh, E.J.; Kim, H.M.; Kwak, S.; Hur, K.; Chung, H.Y. MicroRNA-135b-5p Is a Pathologic Biomarker in the Endothelial Cells of Arteriovenous Malformations. Int. J. Mol. Sci. 2024, 25, 4888. [Google Scholar] [CrossRef] [PubMed]








| No. | Age | Sex | AVM Status | Sample Type | Location |
| 1 | 56 | M | None | Blood vessel | Ant. neck |
| 2 | 47 | M | None | Blood vessel | Lt. lower leg |
| 3 | 29 | M | None | Blood vessel | Rt. thigh |
| 4 | 45 | M | None | Blood vessel | Rt. groin |
| 5 | 26 | M | None | Blood vessel | Rt. groin |
| 6 | 8y3m | F | None | Blood vessel | Rt. groin |
| 7 | 77 | M | None | Blood vessel | Rt. groin |
| 8 | 51 | M | None | Blood vessel | Lt. thigh |
| 9 | 27 | M | None | Blood vessel | Lt. trunk |
| 10 | 72 | M | None | Blood vessel | Lt. face |
| No. | Age | Sex | AVM Status | Sample Type | Location |
| 1 | 56 | M | AVM | Blood vessel | Lt. face |
| 2 | 7y3m | F | AVM | Blood vessel | Rt. ear |
| 3 | 6y11m | F | AVM | Blood vessel | Upper back |
| 4 | 27 | F | AVM | Blood vessel | Rt. ear |
| 5 | 66 | M | AVM | Blood vessel | Rt. thumb |
| 6 | 52 | M | AVM | Blood vessel | Rt. glabella |
| 7 | 29 | M | AVM | Blood vessel | Rt. heel |
| 8 | 23 | F | AVM | Blood vessel | Lt. face |
| 9 | 49 | M | AVM | Blood vessel | Lt. forearm |
| 10 | 55 | M | AVM | Blood vessel | Rt. wrist |
| No. | Age | Sex | AVM Status | Sample Type | Location |
| 1 | 6y4m | F | AVM | Skin | Lt. face |
| 2 | 7y3m | F | AVM | Skin | Rt. retroauricular |
| 3 | 5y11m | M | AVM | Skin | Rt. forearm |
| 4 | 59 | F | AVM | Skin | Lt. groin |
| 5 | 23 | F | AVM | Skin | Lt. face |
| 6 | 29 | M | AVM | Skin | Rt. thigh |
| 7 | 44 | F | AVM | Skin | Rt. ear |
| 8 | 66 | M | AVM | Skin | Rt. groin |
| 9 | 52 | M | AVM | Skin | Rt. glabella |
| 10 | 49 | M | AVM | Skin | Lt. forearm |
| Primer Sequence | ||
|---|---|---|
| GAPDH | Forward sequence | GGAAGGTGAAGGTCGGAGTCA |
| Reverse sequence | GTCATTGATGGCAACAATATCCACT | |
| FSTL1 | Forward sequence | TCGCATCATCCAGTGGCTGGAA |
| Reverse sequence | TCACTGGAGTCCAGGCGAGAAT | |
| MARCKS | Forward sequence | CTCCTCGACTTCTTCGCCCAAG |
| Reverse sequence | TCTTGAAGGAGAAGCCGCTCAG | |
| CSPG4 | Forward sequence | GTCCTGCCTGTCAATGACCAAC |
| Reverse sequence | CGATGGTGTAGACCAGATCCTC | |
| ANG2 | Forward sequence | TGGCTAGTGACCCCCTACAG |
| Reverse sequence | GCTGTGTTCTCTCCAGGCAT | |
| VEGF | Forward sequence | GAGTTGCACAGGGGAGGTAT |
| Reverse sequence | AGAGGTTAGTGACCCAGCCA | |
| Title | Mature Mirna Sequence (5′-3′) |
|---|---|
| Endogenous (has-miR-361-5p;) | UUAUCAGAAUCUCCAGGGGUAC |
| hsa-miR-135b-5p | UAUGGCUUUUCAUUCCUAUGUGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oh, E.J.; Kim, H.M.; Kwak, S.; Chung, H.Y. Modeling Aberrant Angiogenesis in Arteriovenous Malformations Using Endothelial Cells and Organoids for Pharmacological Treatment. Cells 2025, 14, 1081. https://doi.org/10.3390/cells14141081
Oh EJ, Kim HM, Kwak S, Chung HY. Modeling Aberrant Angiogenesis in Arteriovenous Malformations Using Endothelial Cells and Organoids for Pharmacological Treatment. Cells. 2025; 14(14):1081. https://doi.org/10.3390/cells14141081
Chicago/Turabian StyleOh, Eun Jung, Hyun Mi Kim, Suin Kwak, and Ho Yun Chung. 2025. "Modeling Aberrant Angiogenesis in Arteriovenous Malformations Using Endothelial Cells and Organoids for Pharmacological Treatment" Cells 14, no. 14: 1081. https://doi.org/10.3390/cells14141081
APA StyleOh, E. J., Kim, H. M., Kwak, S., & Chung, H. Y. (2025). Modeling Aberrant Angiogenesis in Arteriovenous Malformations Using Endothelial Cells and Organoids for Pharmacological Treatment. Cells, 14(14), 1081. https://doi.org/10.3390/cells14141081

