Atypical Exon 2/3 Mutants G48C, Q43K, and E37K Present Oncogenic Phenotypes Distinct from Characterized NRAS Variants
Abstract
1. Introduction
2. Materials and Methods
2.1. Generation of NRAS Mutant Constructs
2.2. Cell Culture Maintenance and Transfection
2.3. Western Blot Analysis
2.4. Cell Proliferation Assay
2.5. 3D Spheroid Assay
2.6. Caspase 3/7 Assay
2.7. Wound Healing Assay
2.8. Actin Cytoskeletal Staining
2.9. Protein Modeling and in Silico Prediction of the Functional Impact of the Novel NRAS Mutations
2.10. Statistical Analysis
3. Results
3.1. NRAS G48C, Q43K, and E37K Promote Cellular Proliferation in HCT116 and NIH3T3 Cells
3.2. NRAS G48C, Q43K, and E37K Promote 3D Spheroid Formation in HCT116 Cells
3.3. The Novel NRAS Mutants G48C, Q43K, and E37K Promote Apoptosis Resistance
3.4. NRAS G48C, Q43K, and E37K Show No Effect on Cellular Migration in NIH3T3, but G48C Enhanced the Migration Rate of HCT116 Cells
3.5. NRAS G48C, Q43K, and E37K Induce Cytoskeletal Remodeling in NIH3T3 Cells
3.6. Prediction of the Oncogenic Impact of NRAS Mutants through Bioinformatics-Based Modeling and Molecular Docking Simulations
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fernandez, J.K.; Borlongan, M.A.; Baliton, M.A.; Sacdalan, D.L.; Sy, F.F.; Agoncillo, A.; Arenos, C.L.; Tatoy, V.; Uy, T.J.; Reveldez, I.A.; et al. Knowledge, Attitudes, and Practices in Colorectal Cancer Screening in the Philippines. Acta Med. Philipp. 2024. [Google Scholar] [CrossRef] [Scilit]
- Pecorino, L. Molecular Biology of Cancer: Mechanisms, Targets, and Therapeutics, 5th ed.; Oxford University Press: Oxford, UK, 2021; ISBN 978-0-19-883302-4. [Google Scholar]
- Mitin, N.; Rossman, K.L.; Der, C.J. Signaling Interplay in Ras Superfamily Function. Curr. Biol. 2005, 15, R563–R574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgess, A.W.; Garrett, T.P.J. EGFR Receptor Family Extracellular Domain Structures and Functions. In EGFR Signaling Networks in Cancer Therapy; Haley, J.D., Gullick, W.J., Eds.; Humana Press: Totowa, NJ, USA, 2008; pp. 2–13. ISBN 978-1-58829-948-2. [Google Scholar]
- Liu, D. Cancer Biomarkers for Targeted Therapy. Biomark. Res. 2019, 7, 25. [Google Scholar] [CrossRef] [Scilit]
- Misale, S.; Nicolantonio, F.D.; Sartore-Bianchi, A.; Siena, S.; Bardelli, A. Resistance to Anti-EGFR Therapy in Colorectal Cancer: From Heterogeneity to Convergent Evolution. Cancer Discov. 2014, 4, 1269–1280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castellano, E.; Santos, E. Functional Specificity of Ras Isoforms: So Similar but So Different. Genes Cancer 2011, 2, 216–231. [Google Scholar] [CrossRef] [Scilit]
- Jaffee, E.M.; Hruban, R.H.; Canto, M.; Kern, S.E. Focus on Pancreas Cancer. Cancer Cell 2002, 2, 25–28. [Google Scholar] [CrossRef] [Scilit]
- Zhu, G.; Pei, L.; Xia, H.; Tang, Q.; Bi, F. Role of Oncogenic KRAS in the Prognosis, Diagnosis and Treatment of Colorectal Cancer. Mol. Cancer 2021, 20, 143. [Google Scholar] [CrossRef] [Scilit]
- Cascetta, P.; Marinello, A.; Lazzari, C.; Gregorc, V.; Planchard, D.; Bianco, R.; Normanno, N.; Morabito, A. KRAS in NSCLC: State of the Art and Future Perspectives. Cancers 2022, 14, 5430. [Google Scholar] [CrossRef] [Scilit]
- Alawieh, D.; Cysique-Foinlan, L.; Willekens, C.; Renneville, A. RAS Mutations in Myeloid Malignancies: Revisiting Old Questions with Novel Insights and Therapeutic Perspectives. Blood Cancer J. 2024, 14, 72. [Google Scholar] [CrossRef] [Scilit]
- Phadke, M.S.; Smalley, K.S.M. Targeting NRAS Mutations in Advanced Melanoma. J. Clin. Oncol. 2023, 41, 2661–2664. [Google Scholar] [CrossRef] [Scilit]
- Pązik, M.; Michalska, K.; Żebrowska-Nawrocka, M.; Zawadzka, I.; Łochowski, M.; Balcerczak, E. Clinical Significance of HRAS and KRAS Genes Expression in Patients with Non–Small-Cell Lung Cancer—Preliminary Findings. BMC Cancer 2021, 21, 130. [Google Scholar] [CrossRef] [Scilit]
- Muñoz-Maldonado, C.; Zimmer, Y.; Medová, M. A Comparative Analysis of Individual RAS Mutations in Cancer Biology. Front. Oncol. 2019, 9, 1088. [Google Scholar] [CrossRef] [Scilit]
- Prior, I.A.; Lewis, P.D.; Mattos, C. A Comprehensive Survey of Ras Mutations in Cancer. Cancer Res. 2012, 72, 2457–2467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Velho, S.; Vakiani, E.; Peng, S.; Bass, A.J.; Chu, G.C.; Gierut, J.; Bugni, J.M.; Der, C.J.; Philips, M.; et al. Mutant N-RAS Protects Colorectal Cancer Cells from Stress-Induced Apoptosis and Contributes to Cancer Development and Progression. Cancer Discov. 2013, 3, 294–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schirripa, M.; Cremolini, C.; Loupakis, F.; Morvillo, M.; Bergamo, F.; Zoratto, F.; Salvatore, L.; Antoniotti, C.; Marmorino, F.; Sensi, E.; et al. Role of NRAS Mutations as Prognostic and Predictive Markers in Metastatic Colorectal Cancer. Int. J. Cancer 2015, 136, 83–90. [Google Scholar] [CrossRef] [Scilit]
- Au, H.-J.; Karapetis, C.S.; O’Callaghan, C.J.; Tu, D.; Moore, M.J.; Zalcberg, J.R.; Kennecke, H.; Shapiro, J.D.; Koski, S.; Pavlakis, N.; et al. Health-Related Quality of Life in Patients with Advanced Colorectal Cancer Treated with Cetuximab: Overall and KRAS-Specific Results of the NCIC CTG and AGITG CO.17 Trial. J. Clin. Oncol. 2009, 27, 1822–1828. [Google Scholar] [CrossRef] [Scilit]
- Cercek, A.; Capanu, M.; Hechtman, J.F.; Kemeny, N.; Saltz, L.; Braghiroli, M.I.; Yaeger, R.; Chou, J.F. Clinical Features and Outcomes of Patients with Colorectal Cancers Harboring NRAS Mutations. Clin. Cancer Res. 2017, 23, 4753–4760. [Google Scholar] [CrossRef] [Scilit]
- Sacdalan, D.L.; Garcia, R.L.; Diwa, M.H.; Sacdalan, D.B. Clinicopathologic Factors Associated with Mismatch Repair Status Among Filipino Patients with Young-Onset Colorectal Cancer. Cancer Manag. Res. 2021, 13, 2105–2115. [Google Scholar] [CrossRef] [Scilit]
- Yu, R.T.D.; Garcia, R.L. NRAS Mutant E132K Identified in Young-Onset Sporadic Colorectal Cancer and the Canonical Mutants G12D and Q61K Affect Distinct Oncogenic Phenotypes. Sci. Rep. 2020, 10, 11028. [Google Scholar] [CrossRef] [Scilit]
- Danac, J.M.C.; Garcia, R.L. CircPVT1 Attenuates Negative Regulation of NRAS by Let-7 and Drives Cancer Cells towards Oncogenicity. Sci. Rep. 2021, 11, 9021. [Google Scholar] [CrossRef] [Scilit]
- Thorgeirsson, U.P.; Turpeenniemi-Hujanen, T.; Williams, J.E.; Westin, E.H.; Heilman, C.A.; Talmadge, J.E.; Liotta, L.A. NIH/3T3 Cells Transfected with Human Tumor DNA Containing Activated Ras Oncogenes Express the Metastatic Phenotype in Nude Mice. Mol. Cell Biol. 1985, 5, 259–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Apageorge, A.G.; Willumsen, B.M.; Johnsen, M.; Kung, H.F.; Stacey, D.W.; Vass, W.C.; Lowy, D.R. A Transforming Ras Gene Can Provide an Essential Function Ordinarily Supplied by an Endogenous Ras Gene. Mol. Cell Biol. 1986, 6, 1843–1846. [Google Scholar]
- DeFeo-Jones, D.; Tatchell, K.; Robinson, L.C.; Sigal, I.S.; Vass, W.C.; Lowy, D.R.; Scolnick, E.M. Mammalian and Yeast Ras Gene Products: Biological Function in Their Heterologous Systems. Science 1985, 228, 179–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, C.-M.; Li, H.; Gasman, S.; Huang, J.; Schiff, R.; Chang, E.C. Compartmentalized Ras Proteins Transform NIH 3T3 Cells with Different Efficiencies. Mol. Cell. Biol. 2011, 31, 983–997. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garett, C.; Sell, S. (Eds.) Cellular Cancer Markers, 12th ed.; Humana Press: Totowa, NJ, USA, 1995. [Google Scholar]
- Haagensen, E.J.; Thomas, H.D.; Mudd, C.; Tsonou, E.; Wiggins, C.M.; Maxwell, R.J.; Moore, J.D.; Newell, D.R. Pre-Clinical Use of Isogenic Cell Lines and Tumours in Vitro and in Vivo for Predictive Biomarker Discovery; Impact of KRAS and PI3KCA Mutation Status on MEK Inhibitor Activity Is Model Dependent. Eur. J. Cancer 2016, 56, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Ghodsinia, A.A.; Lego, J.-A.M.T.; Garcia, R.L. Mutation-Associated Phenotypic Heterogeneity in Novel and Canonical PIK3CA Helical and Kinase Domain Mutants. Cells 2020, 9, 1116. [Google Scholar] [CrossRef] [Scilit]
- Gebäck, T.; Schulz, M.M.P.; Koumoutsakos, P.; Detmar, M. TScratch: A Novel and Simple Software Tool for Automated Analysis of Monolayer Wound Healing Assays. BioTechniques 2009, 46, 265–274. [Google Scholar] [CrossRef] [Scilit]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; Beer, T.A.P.D.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology Modelling of Protein Structures and Complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef] [Scilit]
- Adzhubei, I.A.; Schmidt, S.; Peshkin, L.; Ramensky, V.E.; Gerasimova, A.; Bork, P.; Kondrashov, A.S.; Sunyaev, S.R. A Method and Server for Predicting Damaging Missense Mutations. Nat. Methods 2010, 7, 248–249. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Chan, A.P. PROVEAN Web Server: A Tool to Predict the Functional Effect of Amino Acid Substitutions and Indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef] [Scilit]
- Mathe, E. Computational Approaches for Predicting the Biological Effect of P53 Missense Mutations: A Comparison of Three Sequence Analysis Based Methods. Nucleic Acids Res. 2006, 34, 1317–1325. [Google Scholar] [CrossRef] [Scilit]
- Tavtigian, S.V. Comprehensive Statistical Study of 452 BRCA1 Missense Substitutions with Classification of Eight Recurrent Substitutions as Neutral. J. Med. Genet. 2005, 43, 295–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pejaver, V.; Urresti, J.; Lugo-Martinez, J.; Pagel, K.A.; Lin, G.N.; Nam, H.-J.; Mort, M.; Cooper, D.N.; Sebat, J.; Iakoucheva, L.M.; et al. Inferring the Molecular and Phenotypic Impact of Amino Acid Variants with MutPred2. Nat. Commun. 2020, 11, 5918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shihab, H.A.; Rogers, M.F.; Gough, J.; Mort, M.; Cooper, D.N.; Day, I.N.M.; Gaunt, T.R.; Campbell, C. An Integrative Approach to Predicting the Functional Effects of Non-Coding and Coding Sequence Variation. Bioinformatics 2015, 31, 1536–1543. [Google Scholar] [CrossRef] [Scilit]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the Speed and Accuracy of Docking with a New Scoring Function, Efficient Optimization and Multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haigis, K.M.; Kendall, K.R.; Wang, Y.; Cheung, A.; Haigis, M.C.; Glickman, J.N.; Niwa-Kawakita, M.; Sweet-Cordero, A.; Sebolt-Leopold, J.; Shannon, K.M.; et al. Differential Effects of Oncogenic K-Ras and N-Ras on Proliferation, Differentiation and Tumor Progression in the Colon. Nat. Genet. 2008, 40, 600–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kijanska, M.; Kelm, J. In Vitro 3D Spheroids and Microtissues: ATP-Based Cell Viability and Toxicity Assays. In Assay Guidance Manual; Markossian, S., Grossman, A., Arkin, M., Auld, D., Austin, C., Baell, J., Brimacombe, K., Chung, T.D.Y., Coussens, N.P., Dahlin, J.L., et al., Eds.; Eli Lilly & Company and the National Center for Advancing Translational Sciences: Bethesda, MD, USA, 2004. [Google Scholar]
- Mary, G.; Malgras, B.; Perez, J.E.; Nagle, I.; Luciani, N.; Pimpie, C.; Asnacios, A.; Pocard, M.; Reffay, M.; Wilhelm, C. Magnetic Compression of Tumor Spheroids Increases Cell Proliferation In Vitro and Cancer Progression In Vivo. Cancers 2022, 14, 366. [Google Scholar] [CrossRef] [Scilit]
- Alcantara, K.M.M.; Malapit, J.R.P.; Yu, R.T.D.; Garrido, J.A.M.G.; Rigor, J.P.T.; Angeles, A.K.J.; la Paz, E.M.C.-D.; Garcia, R.L. Non-Redundant and Overlapping Oncogenic Readouts of Non-Canonical and Novel Colorectal Cancer KRAS and NRAS Mutants. Cells 2019, 8, 1557. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Medarde, A.; Santos, E. Ras in Cancer and Developmental Diseases. Genes Cancer 2011, 2, 344–358. [Google Scholar] [CrossRef] [Scilit]
- Behairy, M.Y.; Soltan, M.A.; Adam, M.S.; Refaat, A.M.; Ezz, E.M.; Albogami, S.; Fayad, E.; Althobaiti, F.; Gouda, A.M.; Sileem, A.E.; et al. Computational Analysis of Deleterious SNPs in NRAS to Assess Their Potential Correlation with Carcinogenesis. Front. Genet. 2022, 13, 872845. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y. TM-Align: A Protein Structure Alignment Algorithm Based on the TM-Score. Nucleic Acids Res. 2005, 33, 2302–2309. [Google Scholar] [CrossRef] [Scilit]
- Cutsem, E.V.; Cervantes, A.; Adam, R.; Sobrero, A.; Krieken, J.H.V.; Aderka, D.; Aguilar, E.A.; Bardelli, A.; Benson, A.; Bodoky, G.; et al. ESMO Consensus Guidelines for the Management of Patients with Metastatic Colorectal Cancer. Ann. Oncol. 2016, 27, 1386–1422. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, N.; YAmada, Y.; Taniguchi, H.; Akiyoshi, K.; Honma, Y.; Kato, S.I.; Hamaguchi, T.; Shimada, Y. Mutations in NRAS Codon 61, KRAS Codon 146, and BRAF V600E as Prognostic Factors in Patients Who Received Anti-EGFR Antibody for Metastatic Colorectal Cancer. J. Clin. Oncol. 2012, 30, e14126. [Google Scholar] [CrossRef] [Scilit]
- Willumsen, B.M.; Norris, K.; Papageorge, A.G.; Hubbert, N.L.; Lowy, D.R. Harvey Murine Sarcoma Virus P21 Ras Protein: Biological and Biochemical Significance of the Cysteine Nearest the Carboxy Terminus. EMBO J. 1984, 3, 2581–2585. [Google Scholar] [CrossRef] [Scilit]
- Stacey, D.; Kung, H.-F. Transformation of NIH 3T3 Cells by Microinjection of Ha-Ras P21 Protein. Nature Publ. Group 1984, 312, 237–242. [Google Scholar] [CrossRef] [Scilit]
- Berg, K.C.G.; Eide, P.W.; Eilertsen, I.A.; Johannessen, B.; Bruun, J.; Danielsen, S.A.; Bjørnslett, M.; Meza-Zepeda, L.A.; Eknæs, M.; Lind, G.E.; et al. Multi-Omics of 34 Colorectal Cancer Cell Lines—A Resource for Biomedical Studies. Mol. Cancer 2017, 16, 116. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.L.; May, L.; Lhotak, V.; Shahrzad, S.; Shirasawa, S.; Weitz, J.I.; Coomber, B.L.; Mackman, N.; Rak, J.W. Oncogenic Events Regulate Tissue Factor Expression in Colorectal Cancer Cells: Implications for Tumor Progression and Angiogenesis. Blood 2005, 105, 1734–1741. [Google Scholar] [CrossRef] [Scilit]
- El Agy, F.; El Bardai, S.; El Otmani, I.; Benbrahim, Z.; Karim, I.M.H.; Mazaz, K.; Benjelloun, E.B.; Ousadden, A.; El Abkari, M.; Ibrahimi, S.A.; et al. Mutation Status and Prognostic Value of KRAS and NRAS Mutations in Moroccan Colon Cancer Patients: A First Report. PLoS ONE 2021, 16, e0248522. [Google Scholar] [CrossRef] [Scilit]
- Kuhn, N.; Klinger, B.; Uhlitz, F.; Sieber, A.; Rivera, M.; Klotz-Noack, K.; Fichtner, I.; Hoffmann, J.; Blüthgen, N.; Falk, C.; et al. Mutation-Specific Effects of NRAS Oncogenes in Colorectal Cancer Cells. Adv. Biol. Regul. 2021, 79, 100778. [Google Scholar] [CrossRef] [Scilit]
- Loree, J.M.; Wang, Y.; Syed, M.A.; Sorokin, A.V.; Coker, O.; Xiu, J.; Weinberg, B.A.; Vanderwalde, A.M.; Tesfaye, A.; Raymond, V.M.; et al. Clinical and Functional Characterization of Atypical KRAS /NRAS Mutations in Metastatic Colorectal Cancer. Clin. Cancer Res. 2021, 27, 4587–4598. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Xiao, J.; Zhang, T.; Zheng, Y.; Jin, H. Analysis of KRAS, NRAS, and BRAF Mutations, Microsatellite Instability, and Relevant Prognosis Effects in Patients with Early Colorectal Cancer: A Cohort Study in East Asia. Front. Oncol. 2022, 12, 897548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gökmen, İ.; Taştekin, E.; Demir, N.; Özcan, E.; Akgül, F.; Hacıoğlu, M.B.; Erdoğan, B.; Topaloğlu, S.; Çiçin, İ. Molecular Pattern and Clinical Implications of KRAS/NRAS and BRAF Mutations in Colorectal Cancer. Curr. Issues Mol. Biol. 2023, 45, 7803–7812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fennema, E.; Rivron, N.; Rouwkema, J.; Van Blitterswijk, C.; De Boer, J. Spheroid Culture as a Tool for Creating 3D Complex Tissues. Trends Biotechnol. 2013, 31, 108–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heidorn, S.J.; Milagre, C.; Whittaker, S.; Nourry, A.; Niculescu-Duvas, I.; Dhomen, N.; Hussain, J.; Reis-Filho, J.S.; Springer, C.J.; Pritchard, C.; et al. Kinase-Dead BRAF and Oncogenic RAS Cooperate to Drive Tumor Progression through CRAF. Cell 2010, 140, 209–221. [Google Scholar] [CrossRef] [Scilit]
- Voice, J.K.; Klemke, R.L.; Le, A.; Jackson, J.H. Four Human Ras Homologs Differ in Their Abilities to Activate Raf-1, Induce Transformation, and Stimulate Cell Motility. J. Biol. Chem. 1999, 274, 17164–17170. [Google Scholar] [CrossRef] [Scilit]
- Davidson, P.M.; Cadot, B. Actin on and around the Nucleus. Trends Cell Biol. 2021, 31, 211–223. [Google Scholar] [CrossRef] [Scilit]
- Shao, X.; Li, Q.; Mogilner, A.; Bershadsky, A.D.; Shivashankar, G.V. Mechanical Stimulation Induces Formin-Dependent Assembly of a Perinuclear Actin Rim. Proc. Natl. Acad. Sci. USA 2015, 112, E2595–E2601. [Google Scholar] [CrossRef] [Scilit]
- Vignjevic, D.; Montagnac, G. Reorganisation of the Dendritic Actin Network during Cancer Cell Migration and Invasion. Semin. Cancer Biol. 2008, 18, 12–22. [Google Scholar] [CrossRef] [Scilit]
- Hoon, J.-L.; Wong, W.-K.; Koh, C.-G. Functions and Regulation of Circular Dorsal Ruffles. Mol. Cell. Biol. 2012, 32, 4246–4257. [Google Scholar] [CrossRef] [Scilit]
- Sahu, P.; Jena, S.R.; Samanta, L. Tunneling Nanotubes: A Versatile Target for Cancer Therapy. Curr. Cancer Drug Targets 2018, 18, 514–521. [Google Scholar] [CrossRef] [Scilit]
- Sinha, P.; Islam, M.N.; Bhattacharya, S.; Bhattacharya, J. Intercellular Mitochondrial Transfer: Bioenergetic Crosstalk between Cells. Curr. Opin. Genet. Dev. 2016, 38, 97–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mc Gee, M.M. Targeting the Mitotic Catastrophe Signaling Pathway in Cancer. Mediat. Inflamm. 2015, 2015, 146282. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Title 1 | Sequence (5’-3’) * |
|---|---|
| G48C-ext-fwd | TATCGCTCGAGATGACTGAGTACAAACTGGTGGTGGTTGGAG |
| G48C-mut-rev | TGTCCAACAAACAGGTTTCACAATCTATAACCACTTG |
| G48C-mut-fwd | ACAAGTGGTTATAGATTGTGAAACCTGTTTGTTGGAC |
| G48C-ext-rev | TCTAGGTCGACACACATGGCAATCCCATACAACCTTACATCACC |
| Q43K-InvPCR-fwd | GGATTCTTACAGAAAAAAAGTGGTTATAGATGGTGAAACCTG |
| Q43K-InvPCR-rev | CCATCTATAACCACTTTTTTTCTGTAAGAATCCTCTATGGTG |
| E37K-InvPCR-fwd | GATCCCACCATAAAGGATTCTTACAGAAAACAAGTGGT |
| E37K-InvPCR-rev | GTTTTCTGTAAGAATCCTTTATGGTGGGATCATATTCATCTACA |
| PROVEAN | Polyphen-2 | ALIGN GVGD | MutPred | FATHMM | |
|---|---|---|---|---|---|
| G48C | Deleterious (−3.606) | Probably damaging (0.998) | Highly pathogenic (Class65) | Pathogenic (0.850) | Cancer (−2.83) |
| Q43K | Deleterious (−6.339) | Possibly damaging (0.493) | Pathogenic (Class 45) | Pathogenic (0.864) | Cancer (−2.13) |
| E37K | Deleterious (−3.046) | Possibly damaging (0.506) | Highly pathogenic (Class 55 | Pathogenic (0.788) | Cancer (−2.47) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fran, M.A.G.; Leaño, D.M.G.; de Borja, J.A.D.; Uy, C.J.T.; Andresan, A.A.R.; Sacdalan, D.L.; Garcia, R.L. Atypical Exon 2/3 Mutants G48C, Q43K, and E37K Present Oncogenic Phenotypes Distinct from Characterized NRAS Variants. Cells 2024, 13, 1691. https://doi.org/10.3390/cells13201691
Fran MAG, Leaño DMG, de Borja JAD, Uy CJT, Andresan AAR, Sacdalan DL, Garcia RL. Atypical Exon 2/3 Mutants G48C, Q43K, and E37K Present Oncogenic Phenotypes Distinct from Characterized NRAS Variants. Cells. 2024; 13(20):1691. https://doi.org/10.3390/cells13201691
Chicago/Turabian StyleFran, Mark Anthony G., Dominique Mickai G. Leaño, James Allen D. de Borja, Charles John T. Uy, Aleq Adrianne R. Andresan, Dennis L. Sacdalan, and Reynaldo L. Garcia. 2024. "Atypical Exon 2/3 Mutants G48C, Q43K, and E37K Present Oncogenic Phenotypes Distinct from Characterized NRAS Variants" Cells 13, no. 20: 1691. https://doi.org/10.3390/cells13201691
APA StyleFran, M. A. G., Leaño, D. M. G., de Borja, J. A. D., Uy, C. J. T., Andresan, A. A. R., Sacdalan, D. L., & Garcia, R. L. (2024). Atypical Exon 2/3 Mutants G48C, Q43K, and E37K Present Oncogenic Phenotypes Distinct from Characterized NRAS Variants. Cells, 13(20), 1691. https://doi.org/10.3390/cells13201691

