Role of ACSBG1 in Brain Lipid Metabolism and X-Linked Adrenoleukodystrophy Pathogenesis: Insights from a Knockout Mouse Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and General Methods
2.2. Animals and Their Care
2.3. Production of an ACSBG1 Knockout Mouse (Acsbg1−/−)
2.4. Quantitative Real-Time PCR Assay
2.5. Lipid Analysis by GC/MS
2.6. Electrophoresis and Western Blotting
2.7. Statistical Analysis
3. Results
3.1. Production and Characterization of an Acsbg1 Knockout (Acsbg1−/−) Mouse
3.2. Acyl-CoA Synthetase Activity in w.t. and Acsbg1−/− Mouse Tissue
3.3. Regional Distribution of ACSBG1 Expression in Mouse Brain
3.4. Brain ACSBG1 Expression Increases with Development of w.t. Mice
3.5. ACSBG1 Depletion Decreases Levels of Saturated VLCFA and Monounsaturated FA While Increasing ω3 Polyunsaturated FA Levels in Cerebella of Adult Mice
3.6. Levels of Specific FA Are Affected by ACSBG1 Depletion in Cerebella of Adult Mice
3.7. Depletion of ACSBG1 Affects the Developmental Expression Pattern of Enzymes Required for De Novo FA Synthesis in Mouse Cerebellum
3.8. mRNA Expression of Several Other FA Metabolism Enzymes Is Affected by ACSBG1 Deficiency
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Watkins, P.A. Fatty acid activation. Prog. Lipid Res. 1997, 36, 55–83. [Google Scholar] [CrossRef] [PubMed]
- Watkins, P.A.; Maiguel, D.; Jia, Z.; Pevsner, J. Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome. J. Lipid Res. 2007, 48, 2736–2750. [Google Scholar] [CrossRef] [PubMed]
- Min, K.T.; Benzer, S. Preventing neurodegeneration in the Drosophila mutant bubblegum. Science 1999, 284, 1985–1988. [Google Scholar] [CrossRef] [PubMed]
- Moser, H.W.; Smith, K.D.; Watkins, P.A.; Powers, J.; Moser, A.B. X-linked Adrenoleukodystrophy. In The Metabolic and Molecular Bases of Inherited Disease, 8th ed.; Scriver, C.R., Beaudet, A.L., Sly, W.S., Valle, D., Eds.; McGraw-Hill: New York, NY, USA, 2001; pp. 3257–3301. [Google Scholar]
- Lazo, O.; Contreras, M.; Hashmi, M.; Stanley, W.; Irazu, C.; Singh, I. Peroxisomal lignoceroyl-CoA ligase deficiency in childhood adrenoleukodystrophy and adrenomyeloneuropathy. Proc. Natl. Acad. Sci. USA 1988, 85, 7647–7651. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Wanders, R.J.; van Roermund, C.W.; van Wijland, M.J.; Schutgens, R.B.; van den Bosch, H.; Schram, A.W.; Tager, J.M. Direct demonstration that the deficient oxidation of very long chain fatty acids in X-linked adrenoleukodystrophy is due to an impaired ability of peroxisomes to activate very long chain fatty acids. Biochem. Biophys. Res. Commun. 1988, 153, 618–624. [Google Scholar] [CrossRef] [PubMed]
- Mosser, J.; Douar, A.M.; Sarde, C.O.; Kioschis, P.; Feil, R.; Moser, H.; Poustka, A.M.; Mandel, J.L.; Aubourg, P. Putative X-linked adrenoleukodystrophy gene shares unexpected homology with ABC transporters. Nature 1993, 361, 726–730. [Google Scholar] [CrossRef] [PubMed]
- Braiterman, L.T.; Zheng, S.; Watkins, P.A.; Geraghty, M.T.; Johnson, G.; McGuinness, M.C.; Moser, A.B.; Smith, K.D. Suppression of peroxisomal membrane protein defects by peroxisomal ATP binding cassette (ABC) proteins. Hum. Mol. Genet. 1998, 7, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Wiesinger, C.; Kunze, M.; Regelsberger, G.; Forss-Petter, S.; Berger, J. Impaired very long-chain acyl-CoA β-oxidation in human X-linked adrenoleukodystrophy fibroblasts is a direct consequence of ABCD1 transporter dysfunction. J. Biol. Chem. 2013, 288, 19269–19279. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Morita, M.; Shimozawa, N.; Kashiwayama, Y.; Suzuki, Y.; Imanaka, T. ABC subfamily D proteins and very long chain fatty acid metabolism as novel targets in adrenoleukodystrophy. Curr. Drug Targets 2011, 12, 694–706. [Google Scholar] [CrossRef] [PubMed]
- van Roermund, C.W.; Visser, W.F.; Ijlst, L.; van Cruchten, A.; Boek, M.; Kulik, W.; Waterham, H.R.; Wanders, R.J. The human peroxisomal ABC half transporter ALDP functions as a homodimer and accepts acyl-CoA esters. FASEB J. 2008, 22, 4201–4208. [Google Scholar] [CrossRef] [PubMed]
- Steinberg, S.J.; Morgenthaler, J.; Heinzer, A.K.; Smith, K.D.; Watkins, P.A. Very long-chain acyl-CoA synthetases. Human “bubblegum” represents a new family of proteins capable of activating very long-chain fatty acids. J. Biol. Chem. 2000, 275, 35162–35169. [Google Scholar] [CrossRef] [PubMed]
- Pei, Z.; Oey, N.A.; Zuidervaart, M.M.; Jia, Z.; Li, Y.; Steinberg, S.J.; Smith, K.D.; Watkins, P.A. The acyl-CoA synthetase “bubblegum” (lipidosin): Further characterization and role in neuronal fatty acid beta-oxidation. J. Biol. Chem. 2003, 278, 47070–47078. [Google Scholar] [CrossRef] [PubMed]
- Moriya-Sato, A.; Hida, A.; Inagawa-Ogashiwa, M.; Wada, M.R.; Sugiyama, K.; Shimizu, J.; Yabuki, T.; Seyama, Y.; Hashimoto, N. Novel acyl-CoA synthetase in adrenoleukodystrophy target tissues. Biochem. Biophys. Res. Commun. 2000, 279, 62–68. [Google Scholar] [CrossRef] [PubMed]
- Fraisl, P.; Forss-Petter, S.; Zigman, M.; Berger, J. Murine bubblegum orthologue is a microsomal very long-chain acyl-CoA synthetase. Biochem. J. 2004, 377 Pt 1, 85–93. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Lopes-Marques, M.; Machado, A.M.; Ruivo, R.; Fonseca, E.; Carvalho, E.; Castro, L.F.C. Expansion, retention and loss in the Acyl-CoA synthetase “Bubblegum” (Acsbg) gene family in vertebrate history. Gene 2018, 664, 111–118. [Google Scholar] [CrossRef] [PubMed]
- Jia, Z.; Moulson, C.L.; Pei, Z.; Miner, J.H.; Watkins, P.A. Fatty acid transport protein 4 is the principal very long chain fatty acyl-CoA synthetase in skin fibroblasts. J. Biol. Chem. 2007, 282, 20573–20583. [Google Scholar] [CrossRef] [PubMed]
- Fagerberg, L.; Hallström, B.M.; Oksvold, P.; Kampf, C.; Djureinovic, D.; Odeberg, J.; Habuka, M.; Tahmasebpoor, S.; Danielsson, A.; Edlund, K.; et al. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell. Proteom. 2014, 13, 397–406. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [PubMed]
- Lagerstedt, S.A.; Hinrichs, D.R.; Batt, S.M.; Magera, M.J.; Rinaldo, P.; McConnell, J.P. Quantitative determination of plasma c8-c26 total fatty acids for the biochemical diagnosis of nutritional and metabolic disorders. Mol. Genet. Metab. 2001, 73, 38–45. [Google Scholar] [CrossRef]
- Jia, Z.; Pei, Z.; Li, Y.; Wei, L.; Smith, K.D.; Watkins, P.A. X-linked adrenoleukodystrophy: Role of very long-chain acyl-CoA synthetases. Mol. Genet. Metab. 2004, 83, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yu, W.; Li, S.; Guo, D.; He, J.; Wang, Y. Acetyl-CoA Carboxylases and Diseases. Front. Oncol. 2022, 12, 836058. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Günenc, A.N.; Graf, B.; Stark, H.; Chari, A. Fatty Acid Synthase: Structure, Function, and Regulation. Subcell. Biochem. 2022, 99, 1–33. [Google Scholar] [CrossRef] [PubMed]
- A’Bháird, N.N.; Ramsay, R.R. Malonyl-CoA inhibition of peroxisomal carnitine octanoyltransferase. Biochem. J. 1992, 286 Pt 2, 637–640. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Brenna, J.T.; Kothapalli, K.S.D. New understandings of the pathway of long-chain polyunsaturated fatty acid biosynthesis. Curr. Opin. Clin. Nutr. Metab. Care 2022, 25, 60–66. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yu, H.; Gao, R.; Liu, M.; Xie, W. A comprehensive review of the family of very-long-chain fatty acid elongases: Structure, function, and implications in physiology and pathology. Eur. J. Med. Res. 2023, 28, 532. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Bezman, L.; Moser, A.B.; Raymond, G.V.; Rinaldo, P.; Watkins, P.A.; Smith, K.D.; Kass, N.E.; Moser, H.W. Adrenoleukodystrophy: Incidence, new mutation rate, and results of extended family screening. Ann. Neurol. 2001, 49, 512–517. [Google Scholar] [CrossRef] [PubMed]
- de Beer, M.; Engelen, M.; van Geel, B.M. Frequent occurrence of cerebral demyelination in adrenomyeloneuropathy. Neurology 2014, 83, 2227–2231. [Google Scholar] [CrossRef] [PubMed]
- Moser, H.W. Adrenoleukodystrophy: Phenotype, genetics, pathogenesis and therapy. Brain 1997, 120 Pt 8, 1485–1508. [Google Scholar] [CrossRef] [PubMed]
- Kemp, S.; Wanders, R. Biochemical aspects of X-linked adrenoleukodystrophy. Brain Pathol. 2010, 20, 831–837. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Sheng, Y.; Tsai-Morris, C.H.; Li, J.; Dufau, M.L. Lessons from the gonadotropin-regulated long chain acyl-CoA synthetase (GR-LACS) null mouse model: A role in steroidogenesis, but not result in X-ALD phenotype. J. Steroid Biochem. Mol. Biol. 2009, 114, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Berger, J.; Albet, S.; Bentejac, M.; Netik, A.; Holzinger, A.; Roscher, A.A.; Bugaut, M.; Forss-Petter, S. The four murine peroxisomal ABC-transporter genes differ in constitutive, inducible and developmental expression. Eur. J. Biochem. 1999, 265, 719–727. [Google Scholar] [CrossRef] [PubMed]
- Guesnet, P.; Alessandri, J.M. Docosahexaenoic acid (DHA) and the developing central nervous system (CNS)-Implications for dietary recommendations. Biochimie 2011, 93, 7–12. [Google Scholar] [CrossRef] [PubMed]
- Dyall, S.C. Long-chain omega-3 fatty acids and the brain: A review of the independent and shared effects of EPA, DPA and DHA. Front. Aging Neurosci. 2015, 7, 52. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Lakshimi, V.I.; Kavitha, M. New Insights into Prospective Health Potential of ω-3 PUFAs. Curr. Nutr. Rep. 2023, 12, 813–829. [Google Scholar] [CrossRef] [PubMed]
- Nomali, M.; Heidari, M.E.; Ayati, A.; Tayebi, A.; Shevchuk, O.; Mohammadrezaei, R.; Navid, H.; Khayyatzadeh, S.S.; Palii, S.; Valizade Shiran, F.; et al. Omega-3 supplementation and outcomes of heart failure: A systematic review of clinical trials. Medicine 2024, 103, e36804. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Fathima, S.; Prokopiou, E.; Georgiou, T. Omega-3 Polyunsaturated Fatty Acids and Their Anti-Oxidant, Anti-Inflammatory and Neuroprotective Effects in Diabetic Retinopathy: A Narrative Review. Front. Biosci. 2023, 28, 153. [Google Scholar] [CrossRef] [PubMed]
- Schmitz, G.; Ecker, J. The opposing effects of n-3 and n-6 fatty acids. Prog. Lipid Res. 2008, 47, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Burdge, G.C. Is essential fatty acid interconversion an important source of PUFA in humans? Br. J. Nutr. 2019, 121, 615–624. [Google Scholar] [CrossRef] [PubMed]








| Gene | NCBI Reference Sequence | Size (bp) | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|---|---|
| Acsbg1 | NM_053178.2 | 168 | catgtccagcccctacaact | atggcctcacaggttttgtc |
| Acc1 | NM_133360.2 | 239 | gcctcttcctgacaaacgag | tgactgccgaaacatctctg |
| Acc2 | NM_133904.2 | 217 | accgactgaaggacatacgg | acgctgaagtaaccccacac |
| Fasn | NM_007988.3 | 158 | tgggttctagccagcagagt | accaccagagaccgttatgc |
| Fads1 | NM_146094.2 | 177 | aagcacatgccatacaacca | cagcggcatgtaagtgaaga |
| Fads2 | NM_019699.1 | 152 | gctctcagatcaccgaggac | agtgccgaagtacgagagga |
| Elovl2 | NM_054326.1 | 148 | tcgacagtgcaggagaaggtga | cgcgtggtgatagacatgaagg |
| Elovl5 | NM_068801.1 | 112 | ggtggctgttcttccagattgg | cttcaggtggtctttcctccga |
| Gapdh | NM_008084.2 | 223 | aactttggcattgtggaagg | acacattgggggtaggaaca |
| 21 Days | n = | 21 Days | n = | |
|---|---|---|---|---|
| w.t. | 10.0 ± 1.0 | 9 | 12.3 ± 1.3 | 15 |
| Acsbg1−/− | 8.3 ± 0.5 | 7 | 10.1 ± 1.1 | 12 |
| C16:0 Activation (nmol/20 min/mg Protein) | C24:0 Activation (nmol/20 min/mg Protein) | |||
|---|---|---|---|---|
| Tissue | w.t. | Acsbg1−/− | w.t. | Acsbg1−/− |
| Whole brain | 16.5 | 17.3 | 2.2 | 2.0 |
| Cerebellum | 8.7 | 16.5 | 0.6 | 0.8 |
| Brain mitochondria | 26.9 | 26.7 | 5.5 | 5.3 |
| Adrenal gland | 38.2 | 50.0 | 1.2 | 1.4 |
| Testis | 18.8 | 18.6 | 1.7 | 1.6 |
| Age (Days) | 1 | 4 | 8 | 15 | 50 | 120 | 180 | |
|---|---|---|---|---|---|---|---|---|
| Total saturated FA | w.t. | 47.5 | 48.6 | 47.0 | 47.3 | 46.4 | 45.9 | 44.9 |
| Acsbg1−/− | 40.4 | 47.2 | 47.1 | 47.0 | 45.3 | 46.7 | 43.4 | |
| Total sat. VLCFA (C22-30) | w.t. | 0.2 | 0.2 | 0.3 | 1.2 | 2.7 | 2.8 | 3.2 |
| Acsbg1−/− | 0.1 | 0.2 | 0.4 | 1.0 | 2.5 | 2.3 | 2.4 | |
| Total ω9 FA | w.t. | 14.9 | 13.8 | 14.2 | 15.9 | 21.3 | 21.7 | 24.2 |
| Acsbg1−/− | 15.3 | 13.6 | 13.8 | 14.6 | 19.0 | 20.3 | 21.0 | |
| Total ω5+ω7 FA | w.t. | 5.4 | 4.9 | 5.2 | 4.3 | 4.3 | 4.1 | 4.4 |
| Acsbg1−/− | 5.2 | 5.3 | 4.9 | 4.4 | 4.6 | 4.2 | 4.8 | |
| Total ω6 FA | w.t. | 17.8 | 18.5 | 18.7 | 18.0 | 12.5 | 12.4 | 11.8 |
| Acsbg1−/− | 21.2 | 18.0 | 19.0 | 18.8 | 13.5 | 13.0 | 12.8 | |
| Total ω3 FA | w.t. | 11.6 | 11.7 | 12.7 | 13.6 | 15.3 | 15.7 | 14.7 |
| Acsbg1−/− | 15.0 | 13.4 | 13.2 | 14.0 | 17.6 | 16.7 | 18.1 | |
| Total trans FA | w.t. | 2.9 | 2.6 | 2.2 | 0.9 | 0.2 | 0.2 | 0.2 |
| Acsbg1−/− | 2.9 | 2.7 | 2.1 | 1.2 | 0.1 | 0.2 | 0.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ye, X.; Li, Y.; González-Lamuño, D.; Pei, Z.; Moser, A.B.; Smith, K.D.; Watkins, P.A. Role of ACSBG1 in Brain Lipid Metabolism and X-Linked Adrenoleukodystrophy Pathogenesis: Insights from a Knockout Mouse Model. Cells 2024, 13, 1687. https://doi.org/10.3390/cells13201687
Ye X, Li Y, González-Lamuño D, Pei Z, Moser AB, Smith KD, Watkins PA. Role of ACSBG1 in Brain Lipid Metabolism and X-Linked Adrenoleukodystrophy Pathogenesis: Insights from a Knockout Mouse Model. Cells. 2024; 13(20):1687. https://doi.org/10.3390/cells13201687
Chicago/Turabian StyleYe, Xiaoli, Yuanyuan Li, Domingo González-Lamuño, Zhengtong Pei, Ann B. Moser, Kirby D. Smith, and Paul A. Watkins. 2024. "Role of ACSBG1 in Brain Lipid Metabolism and X-Linked Adrenoleukodystrophy Pathogenesis: Insights from a Knockout Mouse Model" Cells 13, no. 20: 1687. https://doi.org/10.3390/cells13201687
APA StyleYe, X., Li, Y., González-Lamuño, D., Pei, Z., Moser, A. B., Smith, K. D., & Watkins, P. A. (2024). Role of ACSBG1 in Brain Lipid Metabolism and X-Linked Adrenoleukodystrophy Pathogenesis: Insights from a Knockout Mouse Model. Cells, 13(20), 1687. https://doi.org/10.3390/cells13201687

