Innovative Tools for DNA Topology Probing in Human Cells Reveal a Build-Up of Positive Supercoils Following Replication Stress at Telomeres and at the FRA3B Fragile Site
Abstract
:1. Introduction
2. Materials and Methods
2.1. Vectors
2.2. Topotool Purification
2.3. In Vitro Topology Assay and 2D Gel
2.4. Cell Culture, Transfections, Lentiviral Production, and Infections
2.5. Direct Observation of Topotools in Cells
2.6. PNA-FISH IF
2.7. ChIP
2.8. Slot Blot
2.9. qPCR
A for | CAGCCACCCTTCCTTACTGG |
A rev | GCCACTAGAGTCAGCCAAGG |
B for | CCTCTTTGCCACACACTTGC |
B rev | TAATTGGCACAGGGCCTGAC |
C for | GAGTCAACAGAGTGGACCTACC |
C rev | TAGATGACCGGAAGGTGTGTT |
D for | CCAGCAGTTAATGGCTTGCT |
D rev | GTTGGGCCATGACCAGTTAC |
E for | GTAAACAATGCAGGATCACCGTGTA |
E rev | TTCCACCTACTTTGGGCCTGAG |
F for | TGTGGTCATCACCAACCCAG |
F rev | CAGGTTAGCAGGTCTCGGTG |
Sub-telo for | CCCAAACCCTAACCCTAAAA |
Sub-telo rev | CTTCCTGTTTGCAGCACTGA |
2.10. Immunoblots
2.11. qRT–PCR for Measuring TRF2 Expression
2.12. siRNA KD of TERF2 mRNA
3. Results
3.1. GyrA CTD and HMfB-Based Topotools to Investigate DNA Topology Inside the Nucleus
3.2. Topotools Are Nuclear and Bind Chromatin
3.3. Topoisomerase 2 Inhibition Causes a Build-Up of Positive Supercoils at Telomeres
3.4. Replicative Stress Causes a Build-Up of Positive Supercoils at Telomeres
3.5. Trichostatin-A Treatment Causes an Increase in HMfB Binding
3.6. TRF2 Depletion Has a Dual Effect on Telomere Topology
3.7. Replicative Stress Causes Topological Changes in the Fragile FRA3B Site
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
T-loop | Telomeric loop a lasso-like structure ending telomeres of most species |
R-loop | RNA loop, a loop created by the retention of an RNA transcript on a transcribed region |
HA tag | tag derived from the human influenza hemagglutinin (HA) protein |
NLS | Nuclear Localization Signal |
RFP | Red Fluorescent Protein |
IPTG | Isopropyl β- d-1-thiogalactopyranoside |
PMSF | phenylmethylsulfonyl fluoride |
PNA-FISH | Peptide nucleic Acid—Fluorescence in situ Hybridization |
IF | Immuno-Fluorescence assay |
ChIP | Chromatin Immuno-Precipitation |
qPCR | quantitative Polymerase Chain Reaction |
qRT-PCR | Reverse transcription followed by qPCR |
KD | knock-down |
References
- Racko, D.; Benedetti, F.; Dorier, J.; Stasiak, A. Are TADs supercoiled? Nucleic Acids Res. 2019, 47, 521–532. [Google Scholar] [CrossRef] [PubMed]
- Giraud-Panis, M.J.; Pisano, S.; Benarroch-Popivker, D.; Pei, B.; Le Du, M.H.; Gilson, E. One identity or more for telomeres? Front. Oncol. 2013, 3, 48. [Google Scholar] [CrossRef] [PubMed]
- Ghilain, C.; Gilson, E.; Giraud-Panis, M.J. Multifunctionality of the Telomere-Capping Shelterin Complex Explained by Variations in Its Protein Composition. Cells 2021, 10, 1753. [Google Scholar] [CrossRef]
- De Lange, T. Human telomeres are attached to the nuclear matrix. EMBO J. 1992, 11, 717–724. [Google Scholar] [CrossRef]
- Luderus, M.E.; van Steensel, B.; Chong, L.; Sibon, O.C.; Cremers, F.F.; de Lange, T. Structure, subnuclear distribution, and nuclear matrix association of the mammalian telomeric complex. J. Cell Biol. 1996, 135, 867–881. [Google Scholar] [CrossRef]
- Dimitrova, N.; Chen, Y.C.; Spector, D.L.; de Lange, T. 53BP1 promotes non-homologous end joining of telomeres by increasing chromatin mobility. Nature 2008, 456, 524–528. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Kam, Z.; Carlton, P.M.; Xu, L.; Sedat, J.W.; Blackburn, E.H. Rapid telomere motions in live human cells analyzed by highly time-resolved microscopy. Epigenetics Chromatin 2008, 1, 4. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Lenain, C.; Bauwens, S.; Rizzo, A.; Saint-Leger, A.; Poulet, A.; Benarroch, D.; Magdinier, F.; Morere, J.; Amiard, S.; et al. TRF2 and apollo cooperate with topoisomerase 2alpha to protect human telomeres from replicative damage. Cell 2010, 142, 230–242. [Google Scholar] [CrossRef] [PubMed]
- Benarroch-Popivker, D.; Pisano, S.; Mendez-Bermudez, A.; Lototska, L.; Kaur, P.; Bauwens, S.; Djerbi, N.; Latrick, C.M.; Fraisier, V.; Pei, B.; et al. TRF2-Mediated Control of Telomere DNA Topology as a Mechanism for Chromosome-End Protection. Mol. Cell 2016, 61, 274–286. [Google Scholar] [CrossRef]
- Doksani, Y.; Wu, J.Y.; de Lange, T.; Zhuang, X. Super-resolution fluorescence imaging of telomeres reveals TRF2-dependent T-loop formation. Cell 2013, 155, 345–356. [Google Scholar] [CrossRef]
- Griffith, J.D.; Comeau, L.; Rosenfield, S.; Stansel, R.M.; Bianchi, A.; Moss, H.; de Lange, T. Mammalian telomeres end in a large duplex loop. Cell 1999, 97, 503–514. [Google Scholar] [CrossRef] [PubMed]
- Jack, A.; Kim, Y.; Strom, A.R.; Lee, D.S.W.; Williams, B.; Schaub, J.M.; Kellogg, E.H.; Finkelstein, I.J.; Ferro, L.S.; Yildiz, A.; et al. Compartmentalization of telomeres through DNA-scaffolded phase separation. Dev. Cell 2022, 57, 277–290 e279. [Google Scholar] [CrossRef] [PubMed]
- Min, J.; Wright, W.E.; Shay, J.W. Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52. Genes Dev. 2019, 33, 814–827. [Google Scholar] [CrossRef] [PubMed]
- Amiard, S.; Doudeau, M.; Pinte, S.; Poulet, A.; Lenain, C.; Faivre-Moskalenko, C.; Angelov, D.; Hug, N.; Vindigni, A.; Bouvet, P.; et al. A topological mechanism for TRF2-enhanced strand invasion. Nat. Struct. Mol. Biol. 2007, 14, 147–154. [Google Scholar] [CrossRef] [PubMed]
- Kouzine, F.; Gupta, A.; Baranello, L.; Wojtowicz, D.; Ben-Aissa, K.; Liu, J.; Przytycka, T.M.; Levens, D. Transcription-dependent dynamic supercoiling is a short-range genomic force. Nat. Struct. Mol. Biol. 2013, 20, 396–403. [Google Scholar] [CrossRef] [PubMed]
- Naughton, C.; Avlonitis, N.; Corless, S.; Prendergast, J.G.; Mati, I.K.; Eijk, P.P.; Cockroft, S.L.; Bradley, M.; Ylstra, B.; Gilbert, N. Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures. Nat. Struct. Mol. Biol. 2013, 20, 387–395. [Google Scholar] [CrossRef]
- Corless, S.; Gilbert, N. Investigating DNA supercoiling in eukaryotic genomes. Brief Funct. Genom. 2017, 16, 379–389. [Google Scholar] [CrossRef]
- Beuzer, P.; Quivy, J.P.; Almouzni, G. Establishment of a replication fork barrier following induction of DNA binding in mammalian cells. Cell Cycle 2014, 13, 1607–1616. [Google Scholar] [CrossRef]
- Cristofari, G.; Lingner, J. Telomere length homeostasis requires that telomerase levels are limiting. EMBO J. 2006, 25, 565–574. [Google Scholar] [CrossRef] [PubMed]
- Kowarz, E.; Loscher, D.; Marschalek, R. Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Biotechnol. J. 2015, 10, 647–653. [Google Scholar] [CrossRef]
- Ruthenburg, A.J.; Graybosch, D.M.; Huetsch, J.C.; Verdine, G.L. A superhelical spiral in the Escherichia coli DNA gyrase A C-terminal domain imparts unidirectional supercoiling bias. J. Biol. Chem. 2005, 280, 26177–26184. [Google Scholar] [CrossRef]
- Mattiroli, F.; Bhattacharyya, S.; Dyer, P.N.; White, A.E.; Sandman, K.; Burkhart, B.W.; Byrne, K.R.; Lee, T.; Ahn, N.G.; Santangelo, T.J.; et al. Structure of histone-based chromatin in Archaea. Science 2017, 357, 609–612. [Google Scholar] [CrossRef] [PubMed]
- Sandman, K.; Krzycki, J.A.; Dobrinski, B.; Lurz, R.; Reeve, J.N. HMf, a DNA-binding protein isolated from the hyperthermophilic archaeon Methanothermus fervidus, is most closely related to histones. Proc. Natl. Acad. Sci. USA 1990, 87, 5788–5791. [Google Scholar] [CrossRef]
- Pommier, Y.; Nussenzweig, A.; Takeda, S.; Austin, C. Human topoisomerases and their roles in genome stability and organization. Nat. Rev. Mol. Cell Biol. 2022, 23, 407–427. [Google Scholar] [CrossRef] [PubMed]
- Mendez-Bermudez, A.; Giraud-Panis, M.J.; Ye, J.; Gilson, E. Heterochromatin replication goes hand in hand with telomere protection. Nat. Struct. Mol. Biol. 2020, 27, 313–318. [Google Scholar] [CrossRef]
- Mendez-Bermudez, A.; Lototska, L.; Bauwens, S.; Giraud-Panis, M.J.; Croce, O.; Jamet, K.; Irizar, A.; Mowinckel, M.; Koundrioukoff, S.; Nottet, N.; et al. Genome-wide Control of Heterochromatin Replication by the Telomere Capping Protein TRF2. Mol. Cell 2018, 70, 449–461 e445. [Google Scholar] [CrossRef]
- Wootton, J.; Soutoglou, E. Chromatin and Nuclear Dynamics in the Maintenance of Replication Fork Integrity. Front. Genet. 2021, 12, 773426. [Google Scholar] [CrossRef]
- Baur, J.A.; Wright, W.E.; Shay, J.W. Analysis of mammalian telomere position effect. Methods Mol. Biol. 2004, 287, 121–136. [Google Scholar] [CrossRef] [PubMed]
- Baur, J.A.; Zou, Y.; Shay, J.W.; Wright, W.E. Telomere position effect in human cells. Science 2001, 292, 2075–2077. [Google Scholar] [CrossRef]
- Koering, C.E.; Pollice, A.; Zibella, M.P.; Bauwens, S.; Puisieux, A.; Brunori, M.; Brun, C.; Martins, L.; Sabatier, L.; Pulitzer, J.F.; et al. Human telomeric position effect is determined by chromosomal context and telomeric chromatin integrity. EMBO Rep. 2002, 3, 1055–1061. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhang, T.; Ge, Y.; Tang, M.; Ma, W.; Zhang, Q.; Gong, S.; Wright, W.E.; Shay, J.; Liu, H.; et al. 2D gel electrophoresis reveals dynamics of t-loop formation during the cell cycle and t-loop in maintenance regulated by heterochromatin state. J. Biol. Chem. 2019, 294, 6645–6656. [Google Scholar] [CrossRef] [PubMed]
- Le Tallec, B.; Koundrioukoff, S.; Wilhelm, T.; Letessier, A.; Brison, O.; Debatisse, M. Updating the mechanisms of common fragile site instability: How to reconcile the different views? Cell. Mol. Life Sci. 2014, 71, 4489–4494. [Google Scholar] [CrossRef] [PubMed]
- Letessier, A.; Millot, G.A.; Koundrioukoff, S.; Lachages, A.M.; Vogt, N.; Hansen, R.S.; Malfoy, B.; Brison, O.; Debatisse, M. Cell-type-specific replication initiation programs set fragility of the FRA3B fragile site. Nature 2011, 470, 120–123. [Google Scholar] [CrossRef] [PubMed]
- Sarni, D.; Sasaki, T.; Irony Tur-Sinai, M.; Miron, K.; Rivera-Mulia, J.C.; Magnuson, B.; Ljungman, M.; Gilbert, D.M.; Kerem, B. 3D genome organization contributes to genome instability at fragile sites. Nat. Commun. 2020, 11, 3613. [Google Scholar] [CrossRef]
- Canela, A.; Maman, Y.; Jung, S.; Wong, N.; Callen, E.; Day, A.; Kieffer-Kwon, K.R.; Pekowska, A.; Zhang, H.; Rao, S.S.P.; et al. Genome Organization Drives Chromosome Fragility. Cell 2017, 170, 507–521 e518. [Google Scholar] [CrossRef]
- Dixon, J.R.; Gorkin, D.U.; Ren, B. Chromatin Domains: The Unit of Chromosome Organization. Mol. Cell 2016, 62, 668–680. [Google Scholar] [CrossRef]
- Le Tallec, B.; Millot, G.A.; Blin, M.E.; Brison, O.; Dutrillaux, B.; Debatisse, M. Common fragile site profiling in epithelial and erythroid cells reveals that most recurrent cancer deletions lie in fragile sites hosting large genes. Cell Rep. 2013, 4, 420–428. [Google Scholar] [CrossRef]
- Wu, H.Y.; Shyy, S.H.; Wang, J.C.; Liu, L.F. Transcription generates positively and negatively supercoiled domains in the template. Cell 1988, 53, 433–440. [Google Scholar] [CrossRef]
- Liu, L.F.; Wang, J.C. Supercoiling of the DNA template during transcription. Proc. Natl. Acad. Sci. USA 1987, 84, 7024–7027. [Google Scholar] [CrossRef]
- Schalbetter, S.A.; Mansoubi, S.; Chambers, A.L.; Downs, J.A.; Baxter, J. Fork rotation and DNA precatenation are restricted during DNA replication to prevent chromosomal instability. Proc. Natl. Acad. Sci. USA 2015, 112, E4565–E4570. [Google Scholar] [CrossRef] [PubMed]
- Peter, B.J.; Ullsperger, C.; Hiasa, H.; Marians, K.J.; Cozzarelli, N.R. The structure of supercoiled intermediates in DNA replication. Cell 1998, 94, 819–827. [Google Scholar] [CrossRef]
- Dillon, L.W.; Pierce, L.C.; Lehman, C.E.; Nikiforov, Y.E.; Wang, Y.H. DNA topoisomerases participate in fragility of the oncogene RET. PLoS ONE 2013, 8, e75741. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.S.; Kawamura, R.; Littlehale, M.L.; Marko, J.F.; Laub, M.T. High-resolution, genome-wide mapping of positive supercoiling in chromosomes. Elife 2021, 10, 67236. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.S.; Haakonsen, D.L.; Zeng, W.; Schumacher, M.A.; Laub, M.T. A Bacterial Chromosome Structuring Protein Binds Overtwisted DNA to Stimulate Type II Topoisomerases and Enable DNA Replication. Cell 2018, 175, 583–597.e23. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghilain, C.; Vidal-Cruchez, O.; Joly, A.; Debatisse, M.; Gilson, E.; Giraud-Panis, M.-J. Innovative Tools for DNA Topology Probing in Human Cells Reveal a Build-Up of Positive Supercoils Following Replication Stress at Telomeres and at the FRA3B Fragile Site. Cells 2024, 13, 1361. https://doi.org/10.3390/cells13161361
Ghilain C, Vidal-Cruchez O, Joly A, Debatisse M, Gilson E, Giraud-Panis M-J. Innovative Tools for DNA Topology Probing in Human Cells Reveal a Build-Up of Positive Supercoils Following Replication Stress at Telomeres and at the FRA3B Fragile Site. Cells. 2024; 13(16):1361. https://doi.org/10.3390/cells13161361
Chicago/Turabian StyleGhilain, Claire, Olivia Vidal-Cruchez, Aurélia Joly, Michelle Debatisse, Eric Gilson, and Marie-Josèphe Giraud-Panis. 2024. "Innovative Tools for DNA Topology Probing in Human Cells Reveal a Build-Up of Positive Supercoils Following Replication Stress at Telomeres and at the FRA3B Fragile Site" Cells 13, no. 16: 1361. https://doi.org/10.3390/cells13161361
APA StyleGhilain, C., Vidal-Cruchez, O., Joly, A., Debatisse, M., Gilson, E., & Giraud-Panis, M.-J. (2024). Innovative Tools for DNA Topology Probing in Human Cells Reveal a Build-Up of Positive Supercoils Following Replication Stress at Telomeres and at the FRA3B Fragile Site. Cells, 13(16), 1361. https://doi.org/10.3390/cells13161361