Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Transfections
2.2. Quantitative Real-Time PCR (qRT-PCR)
- AKT1 (fw: GGACAAGGACGGGCACATTA, rv: CGACCGCACATCATCTCGTA),
- CDH1 (fw: AGTGACTGATGCTGATGCCC, rv: AATGTACTGCTGCTTGGCCT),
- CDH2 (fw: GTGCATGAAGGACAGCCTCT, rv: TGGAAAGCTTCTCACGGCAT),
- ACTA2 (fw: GTTCCGCTCCTCTCTCCAAC, rv: GTGCGGACAGGAATTGAAGC),
- VIM (fw: GGACCAGCTAACCAACGACA, rv: AAGGTCAAGACGTGCCAGAG),
- ZEB1 (fw: GCTGTTTCAAGATGTTTCCTTCCA, rv: GCCTATGCTCCACTCCTTGC),
- ZEB2 (fw: CAACCATGAGTCCTCCCCAC, rv: GTCTGGATCGTGGCTTCTGG),
- FN1 (fw: TCAGCTTCCTGGCACTTCTG, rv: TCCCTGGGGATGTGACCAAT) and housekeeping gene GAPDH (fw: GACAGTCAGCCGCATCTTCT, rv: GCGCCCAATACGACCAAATC).
2.3. Protein Analysis
2.4. Bioassays
2.5. Databases and Analysis
2.6. Statistics
3. Results
3.1. Downregulation of miR-143-3p Expression Is Associated with Prostate Cancer
3.2. AKT1 Is a Novel Target of miR-143-3p in Prostate Cancer
3.3. miR-143-3p Influences Key EMT Markers
3.4. miR-143-3p Alters Proliferation, Migration and Colony-Forming Capacity of Prostate Cells
3.5. Mapping the Functional Network of the miR-143-3p/AKT1 Axis
3.6. Potential of miR-143-3p as a Biomarker of Prostate Cancer
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Belkahla, S.; Nahvi, I.; Biswas, S.; Nahvi, I.; Ben Amor, N. Advances and development of prostate cancer, treatment, and strategies: A systemic review. Front. Cell Dev. Biol. 2022, 10, 991330. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.I.; Hamid, A.; Adhami, V.M.; Lall, R.K.; Mukhtar, H. Role of epithelial mesenchymal transition in prostate tumorigenesis. Curr. Pharm. Des. 2015, 21, 1240–1248. [Google Scholar] [CrossRef] [Scilit]
- Ribatti, D.; Tamma, R.; Annese, T. Epithelial-Mesenchymal Transition in Cancer: A Historical Overview. Transl. Oncol. 2020, 13, 100773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussen, B.M.; Shoorei, H.; Mohaqiq, M.; Dinger, M.E.; Hidayat, H.J.; Taheri, M.; Ghafouri-Fard, S. The Impact of Non-coding RNAs in the Epithelial to Mesenchymal Transition. Front. Mol. Biosci. 2021, 8, 665199. [Google Scholar] [CrossRef] [Scilit]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef] [Scilit]
- Smolarz, B.; Durczyński, A.; Romanowicz, H.; Szyłło, K.; Hogendorf, P. miRNAs in Cancer (Review of Literature). Int. J. Mol. Sci. 2022, 23, 2805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lynch, S.M.; O’Neill, K.M.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. Regulation of miR-200c and miR-141 by Methylation in Prostate Cancer. Prostate 2016, 76, 1146–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lynch, S.M.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. miR-24 regulates CDKN1B/p27 expression in prostate cancer. Prostate 2016, 76, 637–648. [Google Scholar] [CrossRef] [Scilit]
- Angel, C.Z.; Lynch, S.M.; Nesbitt, H.; McKenna, M.M.; Walsh, C.P.; McKenna, D.J. miR-210 is induced by hypoxia and regulates neural cell adhesion molecule in prostate cells. J. Cell Physiol. 2020, 235, 6194–6203. [Google Scholar] [CrossRef] [Scilit]
- Stafford, M.Y.C.; Willoughby, C.E.; Walsh, C.P.; McKenna, D.J. Prognostic value of miR-21 for prostate cancer: A systematic review and meta-analysis. Biosci. Rep. 2022, 42, BSR20211972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stafford, M.Y.C.; McKenna, D.J. MiR-182 Is Upregulated in Prostate Cancer and Contributes to Tumor Progression by Targeting MITF. Int. J. Mol. Sci. 2023, 24, 1824. [Google Scholar] [CrossRef] [Scilit]
- Sekhon, K.; Bucay, N.; Majid, S.; Dahiya, R.; Saini, S. MicroRNAs and epithelial-mesenchymal transition in prostate cancer. Oncotarget 2016, 7, 67597–67611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farooqi, A.A.; Qureshi, M.Z.; Attar, R.; Alhewairini, S.S.; Fayyaz, S.; Sabitaliyevich, U.Y.; Duisenbayevich, T.M.; Alaaeddine, N. MicroRNA-143 as a new weapon against cancer: Overview of the mechanistic insights and long non-coding RNA mediated regulation of miRNA-143 in different cancers. Cell Mol. Biol. (Noisy-le-Grand) 2019, 65, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Shi, H.; Shen, H.; Xu, J.; Zhao, S.; Yao, S.; Jiang, N. MiR-143-3p suppresses the progression of ovarian cancer. Am. J. Transl. Res. 2018, 10, 866–874. [Google Scholar]
- Ju, Y.; Choi, G.E.; Lee, M.W.; Jeong, M.; Kwon, H.; Kim, D.H.; Kim, J.; Jin, H.; Lee, K.E.; Hyun, K.Y.; et al. Identification of miR-143-3p as a diagnostic biomarker in gastric cancer. BMC Med. Genom. 2023, 16, 135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Chen, X. MYBL2 Is Targeted by miR-143-3p and Regulates Breast Cancer Cell Proliferation and Apoptosis. Oncol. Res. 2018, 26, 913–922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Z.; Gao, Q.; Xin, W.; Wang, L.; Chen, Y.; Su, C.; Gao, S.; Sun, R. The role of miR-143-3p/FNDC1 axis on the progression of non-small cell lung cancer. Eur. J. Histochem. 2023, 67, 3577. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Chen, J.; Li, H.; Yang, Y.; Yun, H.; Yang, S.; Mao, X. LncRNA UCA1 promotes the invasion and EMT of bladder cancer cells by regulating the miR-143/HMGB1 pathway. Oncol. Lett. 2017, 14, 5556–5562. [Google Scholar] [CrossRef] [Scilit]
- Asghariazar, V.; Mansoori, B.; Kadkhodayi, M.; Safarzadeh, E.; Mohammadi, A.; Baradaran, B.; Sakhinia, E. MicroRNA-143 act as a tumor suppressor microRNA in human lung cancer cells by inhibiting cell proliferation, invasion, and migration. Mol. Biol. Rep. 2022, 49, 7637–7647. [Google Scholar] [CrossRef] [Scilit]
- Huang, C.S.; Tsai, C.H.; Yu, C.P.; Wu, Y.S.; Yee, M.F.; Ho, J.Y.; Yu, D.S. Long Noncoding RNA LINC02470 Sponges MicroRNA-143-3p and Enhances SMAD3-Mediated Epithelial-to-Mesenchymal Transition to Promote the Aggressive Properties of Bladder Cancer. Cancers 2022, 14, 968. [Google Scholar] [CrossRef] [Scilit]
- Lei, C.; Du, F.; Sun, L.; Li, T.; Li, T.; Min, Y.; Nie, A.; Wang, X.; Geng, L.; Lu, Y.; et al. miR-143 and miR-145 inhibit gastric cancer cell migration and metastasis by suppressing MYO6. Cell Death Dis. 2017, 8, e3101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, L.N.; Qiao, G.L.; Yu, J.; Yang, C.M.; Chen, Y.; Deng, Z.F.; Song, L.H.; Ma, L.J.; Yan, H.L. Hsa_circ_0003998 promotes epithelial to mesenchymal transition of hepatocellular carcinoma by sponging miR-143-3p and PCBP1. J. Exp. Clin. Cancer Res. 2020, 39, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, J.; Wu, H.J.; Zhang, H.F.; Fang, S.Q.; Zeng, R. miR-143-3p inhibits proliferation and invasion of hepatocellular carcinoma cells by regulating its target gene FGF1. Clin. Transl. Oncol. 2021, 23, 468–480. [Google Scholar] [CrossRef] [Scilit]
- Jahangiri, B.; Khalaj-Kondori, M.; Asadollahi, E.; Purrafee Dizaj, L.; Sadeghizadeh, M. MSC-Derived exosomes suppress colorectal cancer cell proliferation and metastasis via miR-100/mTOR/miR-143 pathway. Int. J. Pharm. 2022, 627, 122214. [Google Scholar] [CrossRef] [Scilit]
- Zhai, L.; Ma, C.; Li, W.; Yang, S.; Liu, Z. miR-143 suppresses epithelial-mesenchymal transition and inhibits tumor growth of breast cancer through down-regulation of ERK5. Mol. Carcinog. 2016, 55, 1990–2000. [Google Scholar] [CrossRef] [Scilit]
- Bufalino, A.; Cervigne, N.K.; de Oliveira, C.E.; Fonseca, F.P.; Rodrigues, P.C.; Macedo, C.C.; Sobral, L.M.; Miguel, M.C.; Lopes, M.A.; Paes Leme, A.F.; et al. Low miR-143/miR-145 Cluster Levels Induce Activin A Overexpression in Oral Squamous Cell Carcinomas, Which Contributes to Poor Prognosis. PLoS ONE 2015, 10, e0136599. [Google Scholar] [CrossRef] [Scilit]
- Xu, B.; Wang, C.; Wang, Y.L.; Chen, S.Q.; Wu, J.P.; Zhu, W.D.; Wang, C.Y.; Guan, H.; Guan, C.; You, Z.H.; et al. miR-143 inhibits renal cell carcinoma cells metastatic potential by suppressing ABL2. Kaohsiung J. Med. Sci. 2020, 36, 592–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, R.; Zhang, C.; Cheng, Y.; Wang, S.; Lin, H.; Zhang, H. LncRNA UCC promotes epithelial-mesenchymal transition via the miR-143-3p/SOX5 axis in non-small-cell lung cancer. Lab. Investig. 2021, 101, 1153–1165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, P.; Chen, W.G.; Li, X.W. MicroRNA-143 acts as a tumor suppressor by targeting hexokinase 2 in human prostate cancer. Am. J. Cancer Res. 2015, 5, 2056–2063. [Google Scholar] [PubMed]
- Clapé, C.; Fritz, V.; Henriquet, C.; Apparailly, F.; Fernandez, P.L.; Iborra, F.; Avancès, C.; Villalba, M.; Culine, S.; Fajas, L. miR-143 interferes with ERK5 signaling, and abrogates prostate cancer progression in mice. PLoS ONE 2009, 4, e7542. [Google Scholar] [CrossRef] [Scilit]
- Ma, Z.; Luo, Y.; Qiu, M. miR-143 Induces the Apoptosis of Prostate Cancer LNCap Cells by Suppressing Bcl-2 Expression. Med. Sci. Monit. 2017, 23, 359–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Jiang, H.; Zhang, Y.; Wang, C.; Xia, X.; Sun, Y. GR silencing impedes the progression of castration-resistant prostate cancer through the JAG1/NOTCH2 pathway via up-regulation of microRNA-143-3p. Cancer Biomark. 2020, 28, 483–497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, H.; Wang, D.; Gao, R.; Chen, L.; Feng, Y.; Gao, D. Zhoushi Qiling decoction induces apoptosis of human prostate cancer cells via miR-143/Bcl-2 axis. Aging 2021, 13, 17202–17210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, X.B.; Fu, G.B.; Wang, L.; Ge, X.; Liu, W.T.; Wen, Y.Y.; Sun, H.R.; Liu, L.Z.; Wang, Z.J.; Jiang, B.H. Insulin-like growth factor-I induces chemoresistence to docetaxel by inhibiting miR-143 in human prostate cancer. Oncotarget 2017, 8, 107157–107166. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Cao, H.; Zhao, W.; Chen, L.; Wang, D.; Gao, R. miR-143 mediates abiraterone acetate resistance by regulating the JNK/Bcl-2 signaling pathway in prostate cancer. J. Cancer 2022, 13, 3652–3659. [Google Scholar] [CrossRef] [Scilit]
- Chu, H.; Zhong, D.; Tang, J.; Li, J.; Xue, Y.; Tong, N.; Qin, C.; Yin, C.; Zhang, Z.; Wang, M. A functional variant in miR-143 promoter contributes to prostate cancer risk. Arch. Toxicol. 2016, 90, 403–414. [Google Scholar] [CrossRef] [Scilit]
- Harati-Sadegh, M.; Sargazi, S.; Saravani, M.; Sheervalilou, R.; Mirinejad, S.; Saravani, R. Relationship between miR-143/145 cluster variations and cancer risk: Proof from a Meta-analysis. Nucleosides Nucleotides Nucleic Acids 2021, 40, 578–591. [Google Scholar] [CrossRef] [Scilit]
- Peng, X.; Guo, W.; Liu, T.; Wang, X.; Tu, X.; Xiong, D.; Chen, S.; Lai, Y.; Du, H.; Chen, G.; et al. Identification of miRs-143 and -145 that is associated with bone metastasis of prostate cancer and involved in the regulation of EMT. PLoS ONE 2011, 6, e20341. [Google Scholar] [CrossRef] [Scilit]
- Zeng, Q.; Liu, J.; Wu, Q.; Song, R.; Miao, W.; Ma, Y.; Yang, H. Long Non-Coding RNA AC008972.1 as a Novel Therapeutic Target for Prostate Cancer. Cancer Biother. Radiopharm. 2022. Online ahead of print. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goldman, M.J.; Craft, B.; Hastie, M.; Repečka, K.; McDade, F.; Kamath, A.; Banerjee, A.; Luo, Y.; Rogers, D.; Brooks, A.N.; et al. Visualizing and interpreting cancer genomics data via the Xena platform. Nat. Biotechnol. 2020, 38, 675–678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, R.; Qu, H.; Wang, S.; Chater, J.M.; Wang, X.; Cui, Y.; Yu, L.; Zhou, R.; Jia, Q.; Traband, R.; et al. CancerMIRNome: An interactive analysis and visualization database for miRNome profiles of human cancer. Nucl. Acids Res. 2022, 50, D1139–D1146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.Y.; Lin, Y.C.; Cui, S.; Huang, Y.; Tang, Y.; Xu, J.; Bao, J.; Li, Y.; Wen, J.; Zuo, H.; et al. miRTarBase update 2022: An informative resource for experimentally validated miRNA-target interactions. Nucl. Acids Res. 2022, 50, D222–D230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, M.; Liu, Y.; Zheng, C.; Qu, H. dbEMT 2.0: An updated database for epithelial-mesenchymal transition genes with experimentally verified information and precalculated regulation information for cancer metastasis. J. Genet. Genom. 2019, 46, 595–597. [Google Scholar] [CrossRef] [Scilit]
- Vasaikar, S.V.; Deshmukh, A.P.; den Hollander, P.; Addanki, S.; Kuburich, N.A.; Kudaravalli, S.; Joseph, R.; Chang, J.T.; Soundararajan, R.; Mani, S.A. EMTome: A resource for pan-cancer analysis of epithelial-mesenchymal transition genes and signatures. Br. J. Cancer 2021, 124, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Oliveros, J.C.; Venny. An Interactive Tool for Comparing Lists with Venn’s Diagrams. 2007–2015. Available online: https://bioinfogp.cnb.csic.es/tools/venny/index.html (accessed on 28 July 2022).
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucl. Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lánczky, A.; Győrffy, B. Web-Based Survival Analysis Tool Tailored for Medical Research (KMplot): Development and Implementation. J. Med. Internet Res. 2021, 23, e27633. [Google Scholar] [CrossRef] [Scilit]
- Warde-Farley, D.; Donaldson, S.L.; Comes, O.; Zuberi, K.; Badrawi, R.; Chao, P.; Franz, M.; Grouios, C.; Kazi, F.; Lopes, C.T.; et al. The GeneMANIA prediction server: Biological network integration for gene prioritization and predicting gene function. Nucl. Acids Res. 2010, 38, W214–W220. [Google Scholar] [CrossRef] [Scilit]
- Kern, F.; Aparicio-Puerta, E.; Li, Y.; Fehlmann, T.; Kehl, T.; Wagner, V.; Ray, K.; Ludwig, N.; Lenhof, H.P.; Meese, E.; et al. miRTargetLink 2.0-interactive miRNA target gene and target pathway networks. Nucl. Acids Res. 2021, 49, W409–W416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, B.; Rosenberg, A.Z.; Choi, S.M.; Fox-Talbot, K.; De Marzo, A.M.; Nonn, L.; Brennen, W.N.; Marchionni, L.; Halushka, M.K.; Lupold, S.E. Cell-type specific expression of oncogenic and tumor suppressive microRNAs in the human prostate and prostate cancer. Sci. Rep. 2018, 8, 7189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leite, K.R.; Tomiyama, A.; Reis, S.T.; Sousa-Canavez, J.M.; Sañudo, A.; Camara-Lopes, L.H.; Srougi, M. MicroRNA expression profiles in the progression of prostate cancer--from high-grade prostate intraepithelial neoplasia to metastasis. Urol. Oncol. 2013, 31, 796–801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szczyrba, J.; Löprich, E.; Wach, S.; Jung, V.; Unteregger, G.; Barth, S.; Grobholz, R.; Wieland, W.; Stöhr, R.; Hartmann, A.; et al. The microRNA profile of prostate carcinoma obtained by deep sequencing. Mol. Cancer Res. 2010, 8, 529–538. [Google Scholar] [CrossRef] [Scilit]
- Noguchi, S.; Yasui, Y.; Iwasaki, J.; Kumazaki, M.; Yamada, N.; Naito, S.; Akao, Y. Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013, 328, 353–361. [Google Scholar] [CrossRef] [Scilit]
- Akao, Y.; Kumazaki, M.; Shinohara, H.; Sugito, N.; Kuranaga, Y.; Tsujino, T.; Yoshikawa, Y.; Kitade, Y. Impairment of K-Ras signaling networks and increased efficacy of epidermal growth factor receptor inhibitors by a novel synthetic miR-143. Cancer Sci. 2018, 109, 1455–1467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karimi Roshan, M.; Soltani, A.; Soleimani, A.; Rezaie Kahkhaie, K.; Afshari, A.R.; Soukhtanloo, M. Role of AKT and mTOR signaling pathways in the induction of epithelial-mesenchymal transition (EMT) process. Biochimie 2019, 165, 229–234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, H.; Lian, R.; Li, Y.; Liu, C.; Liang, S.; Li, W.; Tao, T.; Wu, X.; Ye, Y.; Yang, X.; et al. AKT-induced lncRNA VAL promotes EMT-independent metastasis through diminishing Trim16-dependent Vimentin degradation. Nat. Commun. 2020, 11, 5127. [Google Scholar] [CrossRef] [Scilit]
- Ngalame, N.N.; Makia, N.L.; Waalkes, M.P.; Tokar, E.J. Mitigation of arsenic-induced acquired cancer phenotype in prostate cancer stem cells by miR-143 restoration. Toxicol. Appl. Pharmacol. 2016, 312, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Dai, G.; Yu, L.; Hu, Q.; Chen, J.; Guo, W. miR-143-3p inhibits the proliferation, migration and invasion in osteosarcoma by targeting FOSL2. Sci. Rep. 2018, 8, 606. [Google Scholar] [CrossRef] [Scilit]
- Xia, C.; Yang, Y.; Kong, F.; Kong, Q.; Shan, C. MiR-143-3p inhibits the proliferation, cell migration and invasion of human breast cancer cells by modulating the expression of MAPK7. Biochimie 2018, 147, 98–104. [Google Scholar] [CrossRef] [Scilit]
- Gang, X.; Yuan, M.; Zhang, J. Long Non-Coding RNA TMPO-AS1 Promotes Cervical Cancer Cell Proliferation, Migration, and Invasion by Regulating miR-143-3p/ZEB1 Axis. Cancer Manag. Res. 2020, 12, 1587–1599. [Google Scholar] [CrossRef] [Scilit]
- Han, L.; Tang, M.; Xu, X.; Jiang, B.; Wei, Y.; Qian, H.; Lu, X. MiR-143-3p suppresses cell proliferation, migration, and invasion by targeting Melanoma-Associated Antigen A9 in laryngeal squamous cell carcinoma. J. Cell Biochem. 2019, 120, 1245–1257. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Jiang, J.; He, G.; Zhou, H.; Ji, C. miR-143-3p represses leukemia cell proliferation by inhibiting KAT6A expression. Anticancer Drugs 2022, 33, e662–e669. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.P.; Hu, Y.P.; Wu, X.S.; Wu, Y.S.; Ye, Y.Y.; Li, H.F.; Liu, Y.C.; Jiang, L.; Liu, F.T.; Zhang, Y.J.; et al. miR-143-3p targeting of ITGA6 suppresses tumour growth and angiogenesis by downregulating PLGF expression via the PI3K/AKT pathway in gallbladder carcinoma. Cell Death Dis. 2018, 9, 182. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhang, X.; Wang, J.; Zhang, Y.; Ye, Q.; Wang, Y.; Fei, D.; Wang, Q. Inflammatory Periodontal Ligament Stem Cells Drive M1 Macrophage Polarization via Exosomal miR-143-3p-Mediated Regulation of PI3K/AKT/NF-κB Signaling. Stem Cells 2023, 41, 184–199. [Google Scholar] [CrossRef] [Scilit]
- Xie, F.; Li, C.; Zhang, X.; Peng, W.; Wen, T. MiR-143-3p suppresses tumorigenesis in pancreatic ductal adenocarcinoma by targeting KRAS. Biomed. Pharmacother. 2019, 119, 109424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Shi, Z.M.; Jiang, C.F.; Liu, X.; Chen, Q.D.; Qian, X.; Li, D.M.; Ge, X.; Wang, X.F.; Liu, L.Z.; et al. MiR-143 acts as a tumor suppressor by targeting N-RAS and enhances temozolomide-induced apoptosis in glioma. Oncotarget 2014, 5, 5416–5427. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhang, Y.; Wang, S.; Liu, G.; Ruan, L. Loss of miR-143 and miR-145 in condyloma acuminatum promotes cellular proliferation and inhibits apoptosis by targeting NRAS. R. Soc. Open Sci. 2018, 5, 172376. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez, M.; Bajo-Santos, C.; Hessvik, N.P.; Lorenz, S.; Fromm, B.; Berge, V.; Sandvig, K.; Linē, A.; Llorente, A. Identification of non-invasive miRNAs biomarkers for prostate cancer by deep sequencing analysis of urinary exosomes. Mol. Cancer 2017, 16, 156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolayırlı, I.M.; Önal, B.; Adıgüzel, M.; Konukoğlu, D.; Demirdağ, Ç.; Kurtuluş, E.M.; Türegün, F.A.; Uzun, H. The clinical significance of circulating miR-21, miR-142, miR-143, and miR-146a in patients with prostate cancer. J. Med. Biochem. 2022, 41, 191–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lorente, G.; Ntostis, P.; Maitland, N.; Mengual, L.; Musquera, M.; Muneer, A.; Oliva, R.; Iles, D.; Miller, D. Semen sampling as a simple, noninvasive surrogate for prostate health screening. Syst. Biol. Reprod. Med. 2021, 67, 354–365. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Li, H.; Huang, A. MiR-429 and MiR-143-3p Function as Diagnostic and Prognostic Markers for Osteosarcoma. Clin. Lab. 2020, 66, 1945–1950. [Google Scholar] [CrossRef] [Scilit]
- Urdinez, J.; Boro, A.; Mazumdar, A.; Arlt, M.J.; Muff, R.; Botter, S.M.; Bode-Lesniewska, B.; Fuchs, B.; Snedeker, J.G.; Gvozdenovic, A. The miR-143/145 Cluster, a Novel Diagnostic Biomarker in Chondrosarcoma, Acts as a Tumor Suppressor and Directly Inhibits Fascin-1. J. Bone Miner. Res. 2020, 35, 1077–1091. [Google Scholar] [CrossRef] [Scilit]
- Puerta-Gil, P.; García-Baquero, R.; Jia, A.Y.; Ocaña, S.; Alvarez-Múgica, M.; Alvarez-Ossorio, J.L.; Cordon-Cardo, C.; Cava, F.; Sánchez-Carbayo, M. miR-143, miR-222, and miR-452 are useful as tumor stratification and noninvasive diagnostic biomarkers for bladder cancer. Am. J. Pathol. 2012, 180, 1808–1815. [Google Scholar] [CrossRef] [Scilit]
- Elhamamsy, A.R.; El Sharkawy, M.S.; Zanaty, A.F.; Mahrous, M.A.; Mohamed, A.E.; Abushaaban, E.A. Circulating miR-92a, miR-143 and miR-342 in Plasma are Novel Potential Biomarkers for Acute Myeloid Leukemia. Int. J. Mol. Cell Med. 2017, 6, 77–86. [Google Scholar] [CrossRef] [Scilit]
- Sahami-Fard, M.H.; Kheirandish, S.; Sheikhha, M.H. Expression levels of miR-143-3p and -424-5p in colorectal cancer and their clinical significance. Cancer Biomark. 2019, 24, 291–297. [Google Scholar] [CrossRef] [Scilit]
- McNally, C.J.; Ruddock, M.W.; Moore, T.; McKenna, D.J. Biomarkers That Differentiate Benign Prostatic Hyperplasia from Prostate Cancer: A Literature Review. Cancer Manag. Res. 2020, 12, 5225–5241. [Google Scholar] [CrossRef] [Scilit]
- McNally, C.J.; Watt, J.; Kurth, M.J.; Lamont, J.V.; Moore, T.; Fitzgerald, P.; Pandha, H.; McKenna, D.J.; Ruddock, M.W. A Novel Combination of Serum Markers in a Multivariate Model to Help Triage Patients Into “Low” and “High-Risk” Categories for Prostate Cancer. Front. Oncol. 2022, 12, 837127. [Google Scholar] [CrossRef] [Scilit]
- Eklund, M.; Nordström, T.; Aly, M.; Adolfsson, J.; Wiklund, P.; Brandberg, Y.; Thompson, J.; Wiklund, F.; Lindberg, J.; Presti, J.C.; et al. The Stockholm-3 (STHLM3) Model can Improve Prostate Cancer Diagnostics in Men Aged 50-69 yr Compared with Current Prostate Cancer Testing. Eur. Urol. Focus 2018, 4, 707–710. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.C.; Gupta, A. MicroRNAs: Potential biomarkers for diagnosis and prognosis of different cancers. Transl. Cancer Res. 2020, 9, 5798–5818. [Google Scholar] [CrossRef] [Scilit]
- Wang, T.H.; Lee, C.Y.; Lee, T.Y.; Huang, H.D.; Hsu, J.B.; Chang, T.H. Biomarker Identification through Multiomics Data Analysis of Prostate Cancer Prognostication Using a Deep Learning Model and Similarity Network Fusion. Cancers 2021, 13, 2528. [Google Scholar] [CrossRef] [Scilit]
- Kwon, Y.W.; Jo, H.S.; Bae, S.; Seo, Y.; Song, P.; Song, M.; Yoon, J.H. Application of Proteomics in Cancer: Recent Trends and Approaches for Biomarkers Discovery. Front. Med. 2021, 8, 747333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Vargas Roditi, L.; Jacobs, A.; Rueschoff, J.H.; Bankhead, P.; Chevrier, S.; Jackson, H.W.; Hermanns, T.; Fankhauser, C.D.; Poyet, C.; Chun, F.; et al. Single-cell proteomics defines the cellular heterogeneity of localized prostate cancer. Cell Rep. Med. 2022, 3, 100604. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Set | Gene Set ID | Description | Count/ List Total | Adjusted p-Value 1 | Gene Symbol |
|---|---|---|---|---|---|
| KEGG | hsa05215 | Prostate cancer | 13/228 | 1.46 × 10−7 | KRAS; HRAS; AKT1; MDM2; BCL2; BRAF; MAPK1; PDGFRA; IGF1R; PIK3R1; AKT2; MMP9; PDGFB |
| Disease Ontology | DOID:10283 | Prostate cancer | 25/228 | 1.92 × 10−7 | KRAS; MYO6; COL1A1; SERPINE1; FHIT; PTGS2; AKT1; MDM2; BCL2; SDC1; MAPK1; PDGFRA; SMAD3; CTNND1; IGF1R; TNF; LIMK1; XIAP; IGFBP5; PIK3R1; MMP2; MMP9; MMP14; ITGB1; ITGB4 |
| DisGeNET | umls:C0936223 | Metastatic prostate carcinoma | 13/228 | 1.90 × 10−5 | KRAS; PTGS2; JAG1; AKT1; CD44; CTNND1; ERBB3; TNF; LIMK1; MMP2; MMP9; MMP14; TERT |
| umls:C1654637 | Androgen-independent prostate cancer | 11/228 | 2.00 × 10−5 | COX2; FSCN1; PTGS2; AKT1; BCL2; MAPK1; TNF; XIAP; AKT2; MMP9; STAR | |
| umls:C0007112 | Adenocarcinoma of prostate | 9/228 | 4.63 × 10−4 | KRAS; SERPINE1; FHIT; PTGS2; AKT1; BCL2; CD44; BRAF; MMP9 |
| Gene Set | Gene Set ID | Description | Count/ List Total | Adjusted p-Value 1 | Gene Symbol |
|---|---|---|---|---|---|
| KEGG | hsa04151 | PI3K-Akt signaling pathway | 19/228 | 4.15 × 10−5 | KRAS; COL1A1; HRAS; AKT1; MDM2; BCL2; MAPK1; PDGFRA; ERBB3; IGF1R; PPP2R5E; YWHAB; PIK3R1; AKT2; TLR2; ITGB1; ITGB4; PPP2R2A; PDGFB |
| hsa04510 | Focal adhesion | 14/228 | 4.20 × 10−5 | COL1A1; HRAS; AKT1; BCL2; BRAF; MAPK1; PDGFRA; IGF1R; XIAP; PIK3R1; AKT2; ITGB1; ITGB4; PDGFB | |
| hsa04540 | Gap junction | 8/228 | 3.49 × 10−4 | KRAS; MAPK7; HRAS; MAPK1; PDGFRA; TUBB2A; GJD2; PDGFB | |
| REACTOME | R-HSA-3000171 | Non-integrin membrane–ECM interactions | 8/228 | 3.25 × 10−4 | COL1A1; SDC1; COL5A1; COL5A2; COL3A1; ITGB1; ITGB4; PDGFB |
| R-HSA-1474244 | Extracellular matrix organization | 15/228 | 1.86 × 10−3 | COL1A1; SERPINE1; MMP13; SDC1; CD44; COL5A1; COL5A2; COL3A1; ADAMTS4; MMP2; MMP9; MMP14; ITGB1; ITGB4; PDGFB | |
| R-HSA-1474228 | Degradation of the extracellular matrix | 10/228 | 1.97 × 10−3 | COL1A1; MMP13; CD44; COL5A1; COL5A2; COL3A1; ADAMTS4; MMP2; MMP9; MMP14 | |
| R-HSA-1257604 | PIP3 activates AKT signaling | 12/228 | 8.33 × 10−3 | AKT1; MDM2; MAPK1; PDGFRA; ERBB3; PPP2R5E; XIAP; PIK3R1; AKT2; RCOR1; PDGFB; MTA3 | |
| R-HSA-2219528 | PI3K/AKT signaling in cancer | 7/228 | 1.04 × 10−2 | AKT1; MDM2; PDGFRA; ERBB3; PIK3R1; AKT2; PDGFB | |
| GO-BP | GO:0030198 | Extracellular matrix organization | 20/228 | 7.03 × 10−6 | COL1A1; FSCN1; SERPINE1; MMP13; CD44; COL5A1; PDGFRA; SMAD3; COL5A2; TNF; COL3A1; ADAMTS4; CTGF; MMP2; MMP9; NFKB2; MMP14; ITGB1; ITGB4; PDGFB |
| GO:0022617 | Extracellular matrix disassembly | 7/228 | 2.30 × 10−3 | FSCN1; MMP13; CD44; ADAMTS4; MMP2; MMP9; MMP14 | |
| GO:0007160 | Cell–matrix adhesion | 11/228 | 2.53 × 10−3 | SERPINE1; JAG1; BCL2; CD44; SMAD3; COL3A1; CTGF; PIK3R1; MMP14; ITGB1; ITGB4 | |
| MSigDB | HEMT | HALLMARK_EPITHELIAL_MESENCHYMAL_TRANSITION | 11/228 | 4.36 × 10−2 | COL1A1; SERPINE1; SDC1; CD44; COL5A1; COL5A2; COL3A1; CTGF; MMP2; MMP14; ITGB1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Armstrong, L.; Willoughby, C.E.; McKenna, D.J. Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer. Cells 2023, 12, 2207. https://doi.org/10.3390/cells12182207
Armstrong L, Willoughby CE, McKenna DJ. Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer. Cells. 2023; 12(18):2207. https://doi.org/10.3390/cells12182207
Chicago/Turabian StyleArmstrong, Lee, Colin E. Willoughby, and Declan J. McKenna. 2023. "Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer" Cells 12, no. 18: 2207. https://doi.org/10.3390/cells12182207
APA StyleArmstrong, L., Willoughby, C. E., & McKenna, D. J. (2023). Targeting of AKT1 by miR-143-3p Suppresses Epithelial-to-Mesenchymal Transition in Prostate Cancer. Cells, 12(18), 2207. https://doi.org/10.3390/cells12182207

