Calcineurin Controls Cellular Prion Protein Expression in Mouse Astrocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Astrocyte-Specific CaN-KO Mice (ACN-KO)
2.2. Primary Hippocampal Astrocytic and Neuronal Cultures
2.3. Pharmacological Treatments
2.4. Assessment of Protein Synthesis
2.5. Immunofluorescence
2.6. Quantitative Fluorescence Image Analysis
2.7. Cell Transfection
2.8. Western Blotting
2.9. Preparation of Synaptosomes and Astrocyte Sub-Cellular Fractionation
2.10. Deglycosylation Assay
2.11. Total RNA Extraction and Real-Time PCR
2.12. Proteomic Analysis
2.13. Statistical Analysis
3. Results
3.1. CaN KO and FK506 Treatment Reduced PrPC Expression in Mouse Hippocampal Astrocytes
3.2. Total and Membrane PrPC Downregulation
3.3. CaN Ablation-Induced PrPC Downregulation Is not due to Alterations of Gene Expression or Protein Degradation
3.4. Reduction of PrPC Expression in CaN-KO Astrocytes Results from Deregulation of Global Protein Synthesis
3.5. FK506 and CaN-KO Reduced the Expression and Plasma Membrane Localization of WT and Mutant PrP Associated with Human Inherited Prion Diseases
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Prusiner, S.B. Prions. Proc. Natl. Acad. Sci. USA 1998, 95, 13363–13383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puoti, G.; Bizzi, A.; Forloni, G.; Safar, J.G.; Tagliavini, F.; Gambetti, P. Sporadic Human Prion Diseases: Molecular Insights and Diagnosis. Lancet Neurol. 2012, 11, 618–628. [Google Scholar] [CrossRef]
- Sy, M.-S.; Gambetti, P.; Wong, B.-S. Human Prion Diseases. Med. Clin. N. Am. 2002, 86, 551–571. [Google Scholar] [CrossRef]
- Takada, L.T.; Kim, M.-O.; Metcalf, S.; Gala, I.I.; Geschwind, M.D. Chapter 29—Prion Disease. In Handbook of Clinical Neurology; Geschwind, D.H., Paulson, H.L., Klein, C., Eds.; Neurogenetics, Part II.; Elsevier: Amsterdam, The Netherlands, 2018; Volume 148, pp. 441–464. [Google Scholar]
- Marín-Moreno, A.; Espinosa, J.C.; Torres, J.M. Transgenic Mouse Models for the Study of Prion Diseases. Prog. Mol. Biol. Transl. Sci. 2020, 175, 147–177. [Google Scholar] [CrossRef]
- Orge, L.; Lima, C.; Machado, C.; Tavares, P.; Mendonça, P.; Carvalho, P.; Silva, J.; Pinto, M.d.L.; Bastos, E.; Pereira, J.C.; et al. Neuropathology of Animal Prion Diseases. Biomolecules 2021, 11, 466. [Google Scholar] [CrossRef]
- Vorberg, I.; Chiesa, R. Experimental Models to Study Prion Disease Pathogenesis and Identify Potential Therapeutic Compounds. Curr. Opin. Pharmacol. 2019, 44, 28–38. [Google Scholar] [CrossRef] [PubMed]
- Scheckel, C.; Imeri, M.; Schwarz, P.; Aguzzi, A. Ribosomal Profiling during Prion Disease Uncovers Progressive Translational Derangement in Glia but Not in Neurons. eLife 2020, 9, e62911. [Google Scholar] [CrossRef]
- Smith, H.L.; Freeman, O.J.; Butcher, A.J.; Holmqvist, S.; Humoud, I.; Schätzl, T.; Hughes, D.T.; Verity, N.C.; Swinden, D.P.; Hayes, J.; et al. Astrocyte Unfolded Protein Response Induces a Specific Reactivity State That Causes Non-Cell-Autonomous Neuronal Degeneration. Neuron 2020, 105, 855–866.e5. [Google Scholar] [CrossRef] [Green Version]
- Lim, D.; Rodríguez-Arellano, J.J.; Parpura, V.; Zorec, R.; Zeidán-Chuliá, F.; Genazzani, A.A.; Verkhratsky, A. Calcium Signalling Toolkits in Astrocytes and Spatio-Temporal Progression of Alzheimer’s Disease. Curr. Alzheimer Res. 2016, 13, 359–369. [Google Scholar] [CrossRef]
- Lim, D.; Ronco, V.; Grolla, A.A.; Verkhratsky, A.; Genazzani, A.A. Glial Calcium Signalling in Alzheimer’s Disease. Rev. Physiol. Biochem. Pharmacol. 2014, 167, 45–65. [Google Scholar] [CrossRef]
- Verkhratsky, A.; Sofroniew, M.V.; Messing, A.; deLanerolle, N.C.; Rempe, D.; Rodríguez, J.J.; Nedergaard, M. Neurological Diseases as Primary Gliopathies: A Reassessment of Neurocentrism. ASN Neuro 2012, 4, AN20120010. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Chen, M.; Zhu, C. Neuroinflammation in Prion Disease. Int. J. Mol. Sci. 2021, 22, 2196. [Google Scholar] [CrossRef]
- Hartmann, C.A.; Martins, V.R.; Lima, F.R.S. High Levels of Cellular Prion Protein Improve Astrocyte Development. FEBS Lett. 2013, 587, 238–244. [Google Scholar] [CrossRef] [PubMed]
- Kushwaha, R.; Sinha, A.; Makarava, N.; Molesworth, K.; Baskakov, I.V. Non-Cell Autonomous Astrocyte-Mediated Neuronal Toxicity in Prion Diseases. Acta Neuropathol. Commun. 2021, 9, 22. [Google Scholar] [CrossRef] [PubMed]
- Lima, F.R.S.; Arantes, C.P.; Muras, A.G.; Nomizo, R.; Brentani, R.R.; Martins, V.R. Cellular Prion Protein Expression in Astrocytes Modulates Neuronal Survival and Differentiation. J. Neurochem. 2007, 103, 2164–2176. [Google Scholar] [CrossRef]
- Baumgärtel, K.; Mansuy, I.M. Neural Functions of Calcineurin in Synaptic Plasticity and Memory. Learn. Mem. 2012, 19, 375–384. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brini, M.; Ottolini, D.; Calì, T.; Carafoli, E. Calcium in Health and Disease. Met. Ions. Life Sci. 2013, 13, 81–137. [Google Scholar] [CrossRef] [PubMed]
- Creamer, T.P. Calcineurin. Cell Commun. Signal. 2020, 18, 137. [Google Scholar] [CrossRef]
- Furman, J.L.; Norris, C.M. Calcineurin and Glial Signaling: Neuroinflammation and Beyond. J. Neuroinflamm. 2014, 11, 158. [Google Scholar] [CrossRef] [Green Version]
- Abdul, H.M.; Sama, M.A.; Furman, J.L.; Mathis, D.M.; Beckett, T.L.; Weidner, A.M.; Patel, E.S.; Baig, I.; Murphy, M.P.; LeVine, H.; et al. Cognitive Decline in Alzheimer’s Disease Is Associated with Selective Changes in Calcineurin/NFAT Signaling. J. Neurosci. 2009, 29, 12957–12969. [Google Scholar] [CrossRef]
- Agostinho, P.; Lopes, J.P.; Velez, Z.; Oliveira, C.R. Overactivation of Calcineurin Induced by Amyloid-Beta and Prion Proteins. Neurochem. Int. 2008, 52, 1226–1233. [Google Scholar] [CrossRef] [Green Version]
- Moon, J.-H.; Hong, J.-M.; Park, S.-Y. Calcineurin Activation by Prion Protein Induces Neurotoxicity via Mitochondrial Reactive Oxygen Species. Oxid. Med. Cell. Longev. 2021, 2021, 5572129. [Google Scholar] [CrossRef] [PubMed]
- Shah, S.Z.A.; Hussain, T.; Zhao, D.; Yang, L. A Central Role for Calcineurin in Protein Misfolding Neurodegenerative Diseases. Cell. Mol. Life Sci. 2017, 74, 1061–1074. [Google Scholar] [CrossRef] [PubMed]
- Biasini, E.; Massignan, T.; Fioriti, L.; Rossi, V.; Dossena, S.; Salmona, M.; Forloni, G.; Bonetto, V.; Chiesa, R. Analysis of the cerebellar proteome in a transgenic mouse model of inherited prion disease reveals preclinical alteration of calcineurin activity. Proteomics 2006, 6, 2823–2834. [Google Scholar] [CrossRef]
- Chiesa, R.; Piccardo, P.; Ghetti, B.; Harris, D.A. Neurological Illness in Transgenic Mice Expressing a Prion Protein with an Insertional Mutation. Neuron 1998, 21, 1339–1351. [Google Scholar] [CrossRef] [Green Version]
- Nakagaki, T.; Ishibashi, D.; Mori, T.; Miyazaki, Y.; Takatsuki, H.; Tange, H.; Taguchi, Y.; Satoh, K.; Atarashi, R.; Nishida, N. Administration of FK506 from Late Stage of Disease Prolongs Survival of Human Prion-Inoculated Mice. Neurotherapeutics 2020, 17, 1850–1860. [Google Scholar] [CrossRef]
- Nakagaki, T.; Satoh, K.; Ishibashi, D.; Fuse, T.; Sano, K.; Kamatari, Y.O.; Kuwata, K.; Shigematsu, K.; Iwamaru, Y.; Takenouchi, T.; et al. FK506 Reduces Abnormal Prion Protein through the Activation of Autolysosomal Degradation and Prolongs Survival in Prion-Infected Mice. Autophagy 2013, 9, 1386–1394. [Google Scholar] [CrossRef] [Green Version]
- Mukherjee, A.; Morales-Scheihing, D.; Gonzalez-Romero, D.; Green, K.; Taglialatela, G.; Soto, C. Calcineurin Inhibition at the Clinical Phase of Prion Disease Reduces Neurodegeneration, Improves Behavioral Alterations and Increases Animal Survival. PLoS Pathog. 2010, 6, e1001138. [Google Scholar] [CrossRef] [Green Version]
- Chiesa, R.; Restelli, E.; Comerio, L.; Del Gallo, F.; Imeri, L. Transgenic Mice Recapitulate the Phenotypic Heterogeneity of Genetic Prion Diseases without Developing Prion Infectivity: Role of Intracellular PrP Retention in Neurotoxicity. Prion 2016, 10, 93–102. [Google Scholar] [CrossRef]
- Bouybayoune, I.; Mantovani, S.; Del Gallo, F.; Bertani, I.; Restelli, E.; Comerio, L.; Tapella, L.; Baracchi, F.; Fernández-Borges, N.; Mangieri, M.; et al. Transgenic Fatal Familial Insomnia Mice Indicate Prion Infectivity-Independent Mechanisms of Pathogenesis and Phenotypic Expression of Disease. PLoS Pathog. 2015, 11, e1004796. [Google Scholar] [CrossRef]
- Dossena, S.; Imeri, L.; Mangieri, M.; Garofoli, A.; Ferrari, L.; Senatore, A.; Restelli, E.; Balducci, C.; Fiordaliso, F.; Salio, M.; et al. Mutant Prion Protein Expression Causes Motor and Memory Deficits and Abnormal Sleep Patterns in a Transgenic Mouse Model. Neuron 2008, 60, 598–609. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiesa, R.; Drisaldi, B.; Quaglio, E.; Migheli, A.; Piccardo, P.; Ghetti, B.; Harris, D.A. Accumulation of Protease-Resistant Prion Protein (PrP) and Apoptosis of Cerebellar Granule Cells in Transgenic Mice Expressing a PrP Insertional Mutation. Proc. Natl. Acad. Sci. USA 2000, 97, 5574–5579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Büeler, H.; Raeber, A.; Sailer, A.; Fischer, M.; Aguzzi, A.; Weissmann, C. High Prion and PrPSc Levels but Delayed Onset of Disease in Scrapie-Inoculated Mice Heterozygous for a Disrupted PrP Gene. Mol. Med. 1994, 1, 19–30. [Google Scholar] [CrossRef] [Green Version]
- Dematteis, G.; Restelli, E.; Chiesa, R.; Aronica, E.; Genazzani, A.A.; Lim, D.; Tapella, L. Calcineurin Controls Expression of EAAT1/GLAST in Mouse and Human Cultured Astrocytes through Dynamic Regulation of Protein Synthesis and Degradation. Int. J. Mol. Sci. 2020, 21, 2213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tapella, L.; Soda, T.; Mapelli, L.; Bortolotto, V.; Bondi, H.; Ruffinatti, F.A.; Dematteis, G.; Stevano, A.; Dionisi, M.; Ummarino, S.; et al. Deletion of Calcineurin from GFAP-Expressing Astrocytes Impairs Excitability of Cerebellar and Hippocampal Neurons through Astroglial Na+/K+ ATPase. Glia 2020, 68, 543–560. [Google Scholar] [CrossRef] [PubMed]
- Tapella, L.; Dematteis, G.; Ruffinatti, F.A.; Ponzoni, L.; Fiordaliso, F.; Corbelli, A.; Albanese, E.; Pistolato, B.; Pagano, J.; Barberis, E.; et al. Deletion of Calcineurin from Astrocytes Reproduces Proteome Signature of Alzheimer’s Disease and Epilepsy and Predisposes to Seizures. Cell Calcium 2021, 100, 102480. [Google Scholar] [CrossRef]
- Biggi, S.; Pancher, M.; Stincardini, C.; Luotti, S.; Massignan, T.; Dalle Vedove, A.; Astolfi, A.; Gatto, P.; Lolli, G.; Barreca, M.L.; et al. Identification of Compounds Inhibiting Prion Replication and Toxicity by Removing PrPC from the Cell Surface. J. Neurochem. 2020, 152, 136–150. [Google Scholar] [CrossRef]
- White, M.D.; Farmer, M.; Mirabile, I.; Brandner, S.; Collinge, J.; Mallucci, G.R. Single Treatment with RNAi against Prion Protein Rescues Early Neuronal Dysfunction and Prolongs Survival in Mice with Prion Disease. Proc. Natl. Acad. Sci. USA 2008, 105, 10238–10243. [Google Scholar] [CrossRef] [Green Version]
- White, M.D.; Mallucci, G.R. RNAi for the Treatment of Prion Disease: A Window for Intervention in Neurodegeneration? CNS Neurol. Disord. Drug Targets 2009, 8, 342–352. [Google Scholar] [CrossRef]
- Minikel, E.V.; Zhao, H.T.; Le, J.; O’Moore, J.; Pitstick, R.; Graffam, S.; Carlson, G.A.; Kavanaugh, M.P.; Kriz, J.; Kim, J.B.; et al. Prion Protein Lowering Is a Disease-Modifying Therapy across Prion Disease Stages, Strains and Endpoints. Nucleic Acids Res. 2020, 48, 10615–10631. [Google Scholar] [CrossRef]
- Nazor Friberg, K.; Hung, G.; Wancewicz, E.; Giles, K.; Black, C.; Freier, S.; Bennett, F.; Dearmond, S.J.; Freyman, Y.; Lessard, P.; et al. Intracerebral Infusion of Antisense Oligonucleotides into Prion-Infected Mice. Mol. Ther. Nucleic Acids 2012, 1, e9. [Google Scholar] [CrossRef]
- Raymond, G.J.; Zhao, H.T.; Race, B.; Raymond, L.D.; Williams, K.; Swayze, E.E.; Graffam, S.; Le, J.; Caron, T.; Stathopoulos, J.; et al. Antisense Oligonucleotides Extend Survival of Prion-Infected Mice. JCI Insight 2019, 5, 131175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tapella, L.; Cerruti, M.; Biocotino, I.; Stevano, A.; Rocchio, F.; Canonico, P.L.; Grilli, M.; Genazzani, A.A.; Lim, D. TGF-Β2 and TGF-Β3 from Cultured β-Amyloid-Treated or 3xTg-AD-Derived Astrocytes May Mediate Astrocyte-Neuron Communication. Eur. J. Neurosci. 2018, 47, 211–221. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, E.K.; Clavarino, G.; Ceppi, M.; Pierre, P. SUnSET, a Nonradioactive Method to Monitor Protein Synthesis. Nat. Methods 2009, 6, 275–277. [Google Scholar] [CrossRef] [PubMed]
- Massignan, T.; Biasini, E.; Lauranzano, E.; Veglianese, P.; Pignataro, M.; Fioriti, L.; Harris, D.A.; Salmona, M.; Chiesa, R.; Bonetto, V. Mutant Prion Protein Expression Is Associated with an Alteration of the Rab GDP Dissociation Inhibitor Alpha (GDI)/Rab11 Pathway. Mol. Cell. Proteom. 2010, 9, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Gillardon, F. Differential Mitochondrial Protein Expression Profiling in Neurodegenerative Diseases. Electrophoresis 2006, 27, 2814–2818. [Google Scholar] [CrossRef]
- Rocchio, F.; Tapella, L.; Manfredi, M.; Chisari, M.; Ronco, F.; Ruffinatti, F.A.; Conte, E.; Canonico, P.L.; Sortino, M.A.; Grilli, M.; et al. Gene Expression, Proteome and Calcium Signaling Alterations in Immortalized Hippocampal Astrocytes from an Alzheimer’s Disease Mouse Model. Cell Death Dis. 2019, 10, 24. [Google Scholar] [CrossRef]
- Dalla Pozza, E.; Manfredi, M.; Brandi, J.; Buzzi, A.; Conte, E.; Pacchiana, R.; Cecconi, D.; Marengo, E.; Donadelli, M. Trichostatin A Alters Cytoskeleton and Energy Metabolism of Pancreatic Adenocarcinoma Cells: An in Depth Proteomic Study. J. Cell. Biochem. 2018, 119, 2696–2707. [Google Scholar] [CrossRef]
- Manfredi, M.; Robotti, E.; Bearman, G.; France, F.; Barberis, E.; Shor, P.; Marengo, E. Direct Analysis in Real Time Mass Spectrometry for the Nondestructive Investigation of Conservation Treatments of Cultural Heritage. J. Anal. Methods Chem. 2016, 2016, 6853591. [Google Scholar] [CrossRef] [Green Version]
- Manfredi, M.; Brandi, J.; Di Carlo, C.; Vita Vanella, V.; Barberis, E.; Marengo, E.; Patrone, M.; Cecconi, D. Mining Cancer Biology through Bioinformatic Analysis of Proteomic Data. Expert Rev. Proteom. 2019, 16, 733–747. [Google Scholar] [CrossRef]
- Albanese, P.; Nield, J.; Tabares, J.A.M.; Chiodoni, A.; Manfredi, M.; Gosetti, F.; Marengo, E.; Saracco, G.; Barber, J.; Pagliano, C. Isolation of Novel PSII-LHCII Megacomplexes from Pea Plants Characterized by a Combination of Proteomics and Electron Microscopy. Photosynth. Res. 2016, 130, 19–31. [Google Scholar] [CrossRef] [PubMed]
- Saá, P.; Harris, D.A.; Cervenakova, L. Mechanisms of Prion-Induced Neurodegeneration. Expert Rev. Mol. Med. 2016, 18, e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarnataro, D.; Pepe, A.; Zurzolo, C. Chapter Three—Cell Biology of Prion Protein. In Progress in Molecular Biology and Translational Science; Legname, G., Vanni, S., Eds.; Prion Protein; Academic Press: Cambridge, MA, USA, 2017; Volume 150, pp. 57–82. [Google Scholar]
- Hogan, P.G.; Chen, L.; Nardone, J.; Rao, A. Transcriptional Regulation by Calcium, Calcineurin, and NFAT. Genes Dev. 2003, 17, 2205–2232. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sans, M.D.; Williams, J.A. Calcineurin Is Required for Translational Control of Protein Synthesis in Rat Pancreatic Acini. Am. J. Physiol. Cell Physiol. 2004, 287, C310–C319. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Restelli, E.; Capone, V.; Pozzoli, M.; Ortolan, D.; Quaglio, E.; Corbelli, A.; Fiordaliso, F.; Beznoussenko, G.V.; Artuso, V.; Roiter, I.; et al. Activation of Src Family Kinase Ameliorates Secretory Trafficking in Mutant Prion Protein Cells. J. Biol. Chem. 2021, 296, 100490. [Google Scholar] [CrossRef]
- Fioriti, L.; Dossena, S.; Stewart, L.R.; Stewart, R.S.; Harris, D.A.; Forloni, G.; Chiesa, R. Cytosolic Prion Protein (PrP) Is Not Toxic in N2a Cells and Primary Neurons Expressing Pathogenic PrP Mutations. J. Biol. Chem. 2005, 280, 11320–11328. [Google Scholar] [CrossRef] [Green Version]
- Mallucci, G.R.; White, M.D.; Farmer, M.; Dickinson, A.; Khatun, H.; Powell, A.D.; Brandner, S.; Jefferys, J.G.R.; Collinge, J. Targeting Cellular Prion Protein Reverses Early Cognitive Deficits and Neurophysiological Dysfunction in Prion-Infected Mice. Neuron 2007, 53, 325–335. [Google Scholar] [CrossRef] [Green Version]
- Castle, A.R.; Gill, A.C. Physiological Functions of the Cellular Prion Protein. Front. Mol. Biosci. 2017, 4, 19. [Google Scholar] [CrossRef] [Green Version]
- Legname, G. Elucidating the Function of the Prion Protein. PLOS Pathog. 2017, 13, e1006458. [Google Scholar] [CrossRef] [Green Version]
- Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Front. Mol. Neurosci. 2017, 10, 77. [Google Scholar] [CrossRef] [Green Version]
- De Mario, A.; Peggion, C.; Massimino, M.L.; Viviani, F.; Castellani, A.; Giacomello, M.; Lim, D.; Bertoli, A.; Sorgato, M.C. The Prion Protein Regulates Glutamate-Mediated Ca2+ Entry and Mitochondrial Ca2+ Accumulation in Neurons. J. Cell Sci. 2017, 130, 2736–2746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Mario, A.; Castellani, A.; Peggion, C.; Massimino, M.L.; Lim, D.; Hill, A.F.; Sorgato, M.C.; Bertoli, A. The Prion Protein Constitutively Controls Neuronal Store-Operated Ca2+ Entry through Fyn Kinase. Front. Cell. Neurosci. 2015, 9, 416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lazzari, C.; Peggion, C.; Stella, R.; Massimino, M.L.; Lim, D.; Bertoli, A.; Sorgato, M.C. Cellular Prion Protein Is Implicated in the Regulation of Local Ca2+ Movements in Cerebellar Granule Neurons. J. Neurochem. 2011, 116, 881–890. [Google Scholar] [CrossRef] [PubMed]
- Lim, D.; Bertoli, A.; Sorgato, M.C.; Moccia, F. Generation and Usage of Aequorin Lentiviral Vectors for Ca2+ Measurement in Sub-Cellular Compartments of Hard-to-Transfect Cells. Cell Calcium 2016, 59, 228–239. [Google Scholar] [CrossRef] [PubMed]
- Butcher, S.P.; Henshall, D.C.; Teramura, Y.; Iwasaki, K.; Sharkey, J. Neuroprotective Actions of FK506 in Experimental Stroke: In Vivo Evidence against an Antiexcitotoxic Mechanism. J. Neurosci. 1997, 17, 6939–6946. [Google Scholar] [CrossRef] [Green Version]
- Cai, J.; Sun, Y.; Yin, Z.; Wang, D.; Shi, K.; Fu, Y.; Cao, X.; Ge, Y. Analysis of FK506-Mediated Functional Recovery and Neuroprotection in a Rat Model of Spinal Cord Injury Indicates That EGF Is Modulated in Astrocytes. Exp. Ther. Med. 2018, 16, 501–510. [Google Scholar] [CrossRef]
- Hong, H.-S.; Hwang, J.-Y.; Son, S.-M.; Kim, Y.-H.; Moon, M.; Inhee, M.-J. FK506 Reduces Amyloid Plaque Burden and Induces MMP-9 in AβPP/PS1 Double Transgenic Mice. J. Alzheimers Dis. 2010, 22, 97–105. [Google Scholar] [CrossRef] [Green Version]
- Labrande, C.; Velly, L.; Canolle, B.; Guillet, B.; Masmejean, F.; Nieoullon, A.; Pisano, P. Neuroprotective Effects of Tacrolimus (FK506) in a Model of Ischemic Cortical Cell Cultures: Role of Glutamate Uptake and FK506 Binding Protein 12 KDa. Neuroscience 2006, 137, 231–239. [Google Scholar] [CrossRef]
- Saganová, K.; Gálik, J.; Blaško, J.; Korimová, A.; Račeková, E.; Vanický, I. Immunosuppressant FK506: Focusing on Neuroprotective Effects Following Brain and Spinal Cord Injury. Life Sci. 2012, 91, 77–82. [Google Scholar] [CrossRef]
- Zawadzka, M.; Kaminska, B. A Novel Mechanism of FK506-Mediated Neuroprotection: Downregulation of Cytokine Expression in Glial Cells. Glia 2005, 49, 36–51. [Google Scholar] [CrossRef]
- Kraner, S.D.; Norris, C.M. Astrocyte Activation and the Calcineurin/NFAT Pathway in Cerebrovascular Disease. Front. Aging Neurosci. 2018, 10, 287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lim, D.; Rocchio, F.; Mapelli, L.; Moccia, F. From Pathology to Physiology of Calcineurin Signalling in Astrocytes. Opera Med. Physiol. 2016, 2, 122–140. [Google Scholar]
- Bollo, M.; Paredes, R.M.; Holstein, D.; Zheleznova, N.; Camacho, P.; Lechleiter, J.D. Calcineurin Interacts with PERK and Dephosphorylates Calnexin to Relieve ER Stress in Mammals and Frogs. PLoS ONE 2010, 5, e11925. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tosello, V.; Saccomani, V.; Yu, J.; Bordin, F.; Amadori, A.; Piovan, E. Calcineurin Complex Isolated from T-Cell Acute Lymphoblastic Leukemia (T-ALL) Cells Identifies New Signaling Pathways Including MTOR/AKT/S6K Whose Inhibition Synergize with Calcineurin Inhibition to Promote T-ALL Cell Death. Oncotarget 2016, 7, 45715–45729. [Google Scholar] [CrossRef] [PubMed] [Green Version]







| Antibodies | Dilution | House | Cat. |
|---|---|---|---|
| Anti-puromycin | 1:200 | Millipore | MABE343 |
| 12B2 | 1:400 | Central Veterinary Institute | / |
| Anti-GM130 | 1:500 | Transduction Laboratories | 610823 |
| Anti-BAP31 | 1:200 | Proteintech | 11200-1-AP |
| Antibodies | Dilution | House | Cat. |
|---|---|---|---|
| 94B4 | 1:1000 | Wageningen University & Research | mAbPrP94B4 |
| 12B2 | 1:500 | Central Veterinary Institute | / |
| Anti-β-Actin | 1:800 | Sigma | A1978 |
| Protein | Gene | Forward/Reverse | Accession No. |
|---|---|---|---|
| S18 | Rps18 | TGCGAGTACTCAACACCAACA CTGCTTTCCTCAACACCACA | NM_011296 |
| PrP | Prnp | GAACCATTTCAACCGAGCTGA TAGTCACAAAGAGGGCCAGC | NM_011170.3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dematteis, G.; Restelli, E.; Vanella, V.V.; Manfredi, M.; Marengo, E.; Corazzari, M.; Genazzani, A.A.; Chiesa, R.; Lim, D.; Tapella, L. Calcineurin Controls Cellular Prion Protein Expression in Mouse Astrocytes. Cells 2022, 11, 609. https://doi.org/10.3390/cells11040609
Dematteis G, Restelli E, Vanella VV, Manfredi M, Marengo E, Corazzari M, Genazzani AA, Chiesa R, Lim D, Tapella L. Calcineurin Controls Cellular Prion Protein Expression in Mouse Astrocytes. Cells. 2022; 11(4):609. https://doi.org/10.3390/cells11040609
Chicago/Turabian StyleDematteis, Giulia, Elena Restelli, Virginia Vita Vanella, Marcello Manfredi, Emilio Marengo, Marco Corazzari, Armando A. Genazzani, Roberto Chiesa, Dmitry Lim, and Laura Tapella. 2022. "Calcineurin Controls Cellular Prion Protein Expression in Mouse Astrocytes" Cells 11, no. 4: 609. https://doi.org/10.3390/cells11040609
APA StyleDematteis, G., Restelli, E., Vanella, V. V., Manfredi, M., Marengo, E., Corazzari, M., Genazzani, A. A., Chiesa, R., Lim, D., & Tapella, L. (2022). Calcineurin Controls Cellular Prion Protein Expression in Mouse Astrocytes. Cells, 11(4), 609. https://doi.org/10.3390/cells11040609

