Phytol Suppresses Osteoclast Differentiation and Oxidative Stress through Nrf2/HO-1 Regulation in RANKL-Induced RAW264.7 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Plant Materials
2.3. Phytol Isolation and Identification
Phytol
2.4. RAW 264.7 Cell Culture and Osteoclast Differentiation
2.5. Cell Viability and Confluency
2.6. Immunofluorescence Analysis
2.7. Cytosolic and Nuclear Protein Extraction
2.8. Cell Migration
2.9. TRAP Staining and Activity
2.10. Actin Ring and DAPI Staining
2.11. Osteoclastic Resorption
2.12. Intracellular ROS Measurement
2.13. Real-Time Quantitative PCR
2.14. Western Blot Analysis
2.15. siRNA Interference
2.16. Statistical Analysis
3. Results
3.1. Cell Viability and Phytol Confluency
3.2. Phytol Induces HO-1 Expression by Nrf2 Translocation Promotion
3.3. Inhibitory Effect of Phytol on RANKL-Induced Osteoclast Differentiation and Formation
3.4. Inhibitory Effect of Phytol on RANKL-Induced Osteoclast Function
3.5. Phytol Reduces the Expression of Osteoclast Marker Genes and Transcription Factors
3.6. Reduced Effect of Phytol on Oxidative Stress Markers in RANKL-Induced Osteoclasts
3.7. Phytol-Mediated Inhibition of Osteoclast Differentiation and Function Is Regulated through Nrf2
3.8. Phytol-Mediated Inhibition of Oxidative Stress Is Regulated through Nrf2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Weivoda, M.M.; Chew, C.K.; Monroe, D.G.; Farr, J.N.; Atkinson, E.J.; Geske, J.R.; Eckhardt, B.; Thicke, B.; Ruan, M.; Tweed, A.J.; et al. Identification of osteoclast-osteoblast coupling factors in humans reveals links between bone and energy metabolism. Nat. Commun. 2020, 11, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, D.; Liu, J.; Guo, B.; Liang, C.; Dang, L.; Lu, C.; He, X.; Cheung, H.Y.; Xu, L.; Lu, C.; et al. Osteoclast-derived exosomal miR-214-3p inhibits osteoblastic bone formation. Nat. Commun. 2016, 7, 10872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.; Deng, P.; Liu, Y.; Wu, Y.; Chen, Y.; Guo, Y.; Zhang, S.; Zheng, X.; Zhou, L.; Liu, W.; et al. Alpha-ketoglutarate ameliorates age-related osteoporosis via regulating histone methylations. Nat. Commun. 2020, 11, 5596. [Google Scholar] [CrossRef] [PubMed]
- Wilson, C. Oxidative stress and osteoporosis. Nat. Rev. Endocrinol. 2014, 10, 3. [Google Scholar] [CrossRef] [PubMed]
- Wells, P.G.; McCallum, P.G.; Chen, C.S.; Henderson, J.T.; Lee, C.J.J.; Perstin, J.; Preston, T.J.; Wiley, M.J.; Wong, A.W. Oxidative Stress in Developmental Origins of Disease: Teratogenesis, Neurodevelopmental Deficits, and Cancer. Toxicol. Sci. 2009, 108, 4–18. [Google Scholar] [CrossRef] [Green Version]
- Xue, P.; Hu, X.; Chang, E.; Wang, L.; Chen, M.; Wu, T.H.; Lee, D.J.; Foster, B.L.; Tseng, H.C.; Ko, C.C. Deficiency of optineurin enhances osteoclast differentiation by attenuating the NRF2-mediated antioxidant response. Exp. Mol. Med. 2021, 53, 667–680. [Google Scholar] [CrossRef]
- Kanzaki, H.; Shinohara, F.; Kajiya, M.; Kodama, T. The Keap1/Nrf2 protein axis plays a role in osteoclast differentiation by regulating intracellular reactive oxygen species signaling. J. Biol. Chem. 2014, 289, 23009–23020. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Zhu, X.; Wei, A.; Chen, F.; Gao, Q.; Lu, K.; Jiang, Q.; Cao, W. Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. Bone Res. 2021, 9, 15. [Google Scholar] [CrossRef]
- Kim, J.H.; Singhal, V.; Biswal, S.; Thimmulappa, R.K.; DiGirolamo, D.J. Nrf2 is required for normal postnatal bone acquisition in mice. Bone Res. 2014, 2, 14033. [Google Scholar] [CrossRef] [Green Version]
- Thanas, C.; Ziros, P.G.; Chartoumpekis, D.V.; Renaud, C.O.; Sykiotis, G.P. The Keap1/Nrf2 Signaling Pathway in the Thyroid—2020 Update. Antioxidants 2020, 9, 1082. [Google Scholar] [CrossRef]
- Lu, S.H.; Chen, T.H.; Chou, T.C. Magnolol Inhibits RANKL-induced osteoclast differentiation of raw 264.7 macrophages through heme oxygenase-1-dependent inhibition of NFATc1 expression. J. Nat. Prod. 2015, 78, 61–68. [Google Scholar] [CrossRef]
- Chen, K.; Qiu, P.; Yuan, Y.; Zheng, L.; He, J.; Wang, C.; Guo, Q.; Kenny, J.; Liu, Q.; Zhao, J.; et al. Pseurotin A Inhibits Osteoclastogenesis and Prevents Ovariectomized-Induced Bone Loss by Suppressing Reactive Oxygen Species. Theranostics 2019, 9, 1634–1650. [Google Scholar] [CrossRef]
- Ando, Y.; Nakazawa, H.; Miura, D.; Otake, M.; Umetsu, M. Enzymatic ligation of an antibody and arginine 9 peptide for efficient and cell-specific siRNA delivery. Sci. Rep. 2021, 11, 21882. [Google Scholar] [CrossRef]
- Sun, Y.X.; Li, L.; Corry, K.A.; Zhang, P.; Yang, Y.; Himes, E.; Mihuti, C.L.; Nelson, C.; Dai, G.; Li, J. Deletion of Nrf2 reduces skeletal mechanical properties and decreases load-driven bone formation. Bone 2015, 74, 1–9. [Google Scholar] [CrossRef]
- Ibáñez, L.; Ferrándiz, M.L.; Brines, R.; Guede, D.; Cuadrado, A.; Alcaraz, M.J. Effects of Nrf2 deficiency on bone microarchitecture in an experimental model of osteoporosis. Oxidative Med. Cell. Longev. 2014, 2014, 726590. [Google Scholar] [CrossRef] [Green Version]
- Liu, D.; Genetos, D.C.; Shao, Y.; Geist, D.J.; Li, J.; Ke, H.Z.; Turner, C.H.; Duncan, R.L. Activation of extracellular-signal regulated kinase (ERK1/2) by fluid shear is Ca(2+)- and ATP-dependent in MC3T3-E1 osteoblasts. Bone 2008, 42, 644–652. [Google Scholar] [CrossRef] [Green Version]
- Hyeon, S.; Lee, H.; Yang, Y.; Jeong, W. Nrf2 deficiency induces oxidative stress and promotes RANKL-induced osteoclast differentiation. Free Radic. Biol. Med. 2013, 65, 789–799. [Google Scholar] [CrossRef]
- Lee, S.; Ryoo, R.; Choi, J.H.; Kim, J.H.; Kim, S.H.; Kim, K.H. Trichothecene and tremulane sesquiterpenes from a hallucinogenic mushroom Gymnopilus junonius and their cytotoxicity. Arch. Pharm. Res. 2020, 43, 214–223. [Google Scholar] [CrossRef]
- Lee, S.R.; Kang, H.; Yoo, M.J.; Yu, J.S.; Lee, S.; Yi, S.A.; Beemelmanns, C.; Lee, J.; Kim, K.H. Anti-adipogenic pregnane steroid from a Hydractinia-associated fungus, Cladosporium sphaerospermum SW67. Nat. Prod. Sci. 2020, 26, 230–235. [Google Scholar]
- Lee, S.; Yu, J.S.; Phung, H.M.; Lee, J.G.; Kim, K.H.; Kang, K.S. Potential Anti-Skin Aging Effect of (-)-Catechin Isolated from the Root Bark of Ulmus davidiana var. japonica in Tumor Necrosis Factor-α-Stimulated Normal Human Dermal Fibroblasts. Antioxidants 2020, 9, 981. [Google Scholar] [CrossRef]
- Lee, K.H.; Kim, J.K.; Yu, J.S.; Jeong, S.Y.; Choi, J.H.; Kim, J.C.; Ko, Y.J.; Kim, S.H.; Kim, K.H. Ginkwanghols A and B, osteogenic coumaric acid-aliphatic alcohol hybrids from the leaves of Ginkgo biloba. Arch. Pharm. Res. 2021, 44, 514–524. [Google Scholar] [CrossRef] [PubMed]
- Balakrishnan, A.; Arunambiga, S.; Praveena, A. Stevia as a Natural Sweetener: A Review. Cardiovasc. Hematol. Agents Med. Chem. 2020, 18, 94–103. [Google Scholar]
- Islam, M.T.; Ali, E.S.; Uddin, S.J.; Shaw, S.; Islam, M.A.; Ahmed, M.I.; Chandra Shill, M.; Karmakar, U.K.; Yarla, N.S.; Khan, I.N.; et al. Phytol: A review of biomedical activities. Food Chem. Toxicol. 2018, 121, 82–94. [Google Scholar] [CrossRef] [PubMed]
- Coleman, R.; Body, J.J.; Aapro, M.; Hadji, P.; Herrstedt, J. Bone health in cancer patients: ESMO Clinical Practice Guidelines. Ann. Oncol. 2014, 25, 124–137. [Google Scholar] [CrossRef] [PubMed]
- Maraka, S.A.; Kennel, K. Bisphosphonates for the Prevention and Treatment of Osteoporosis. BMJ 2015, 351, 3783. [Google Scholar] [CrossRef] [Green Version]
- Ibrahim, M.B.; Sowemimo, A.A.; Venables, L.; Koorbanally, N.A.; Awolola, G.V.; Sofidiya, M.O.; Odukoya, O.A.; Koekemoer, T.; van de Venter, M. Biological evaluation of phytoconstituents from Markhamia tomentosa ethanolic leaf extract. S. Afr. J. Bot. 2018, 115, 31–36. [Google Scholar] [CrossRef]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ. J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [Green Version]
- Alemu, T.W.; Pandey, H.O.; Salilew, W.D.; Gebremedhn, S.; Neuhof, C.; Tholen, E.; Holkerm, M.; Schellander, K.; Tesfaye, D. Oxidative and endoplasmic reticulum stress defense mechanisms of bovine granulosa cells exposed to heat stress. Theriogenology 2018, 110, 130–141. [Google Scholar] [CrossRef]
- Xue, P.; Hu, X.; Powers, J.; Nay, N.; Chang, E.; Kwon, J.; Wong, S.W.; Han, L.; Wu, T.H.; Lee, D.J.; et al. CDDO-Me, Sulforaphane and tBHQ attenuate the RANKL-induced osteoclast differentiation via activating the NRF2-mediated antioxidant response. Biochem. Biophys. Res. Commun. 2019, 511, 637–643. [Google Scholar]
- Zhen, G.; Dan, Y.; Wang, R.; Dou, C.; Guo, Q.; Zarr, M.; Liu, L.N.; Chen, L.; Deng, R.; Li, Y.; et al. An antibody against Siglec-15 promotes bone formation and fracture healing by increasing TRAP+ mononuclear cells and PDGF-BB secretion. Bone Res. 2021, 9, 47. [Google Scholar] [CrossRef]
- Oh, E.; Lee, H.Y.; Kim, H.J.; Park, Y.J.; Seo, J.K.; Park, J.S.; Bae, Y.S. Serum amyloid A inhibits RANKL-induced osteoclast formation. Exp. Mol. Med. 2015, 47, e194. [Google Scholar] [CrossRef] [Green Version]
- Matsubara, T.; Kinbara, M.; Maeda, T.; Yoshizawa, M.; Kokabu, S.; Takano, Y.T. Regulation of osteoclast differentiation and actin ring formation by the cytolinker protein plectin. Biochem. Biophys. Res. Commun. 2017, 489, 472–476. [Google Scholar] [CrossRef]
- Liang, Z.; Xue, Y.; Wang, T.; Xie, Q.; Lin, J.; Wang, Y. Curcumin inhibits the migration of osteoclast precursors and osteoclastogenesis by repressing CCL3 production. BMC Complement. Med. Ther. 2020, 20, 234. [Google Scholar] [CrossRef]
- AlQranei, M.S.; Aljohani, H.; Majumdar, S.; Senbanjo, L.T.; Chellaiah, M.A. C-phycocyanin attenuates RANKL-induced osteoclastogenesis and bone resorption in vitro through inhibiting ROS levels, NFATc1 and NF-κB activation. Sci. Rep. 2020, 10, 2513. [Google Scholar] [CrossRef] [Green Version]
- Kang, I.S.; Kim, C. NADPH oxidase gp91phox contributes to RANKL-induced osteoclast differentiation by upregulating NFATc1. Sci. Rep. 2016, 6, 38014. [Google Scholar] [CrossRef]
Target Gene | Sequence (5′→3′) | |
---|---|---|
dcstamp | Forward | TTTGCCGCTGTGGACTATCTGC |
Reverse | GCAGAATCATGGACGACTCCTTG | |
acp5 | Forward | CGTCTCTGCACAGATTGCAT |
Reverse | GAGTTGCCACACAGCATCAC | |
atp6d0v2 | Forward | TGTGTCCCATTCTTGAGTTTGAGG |
Reverse | AGG GTCTCCCTGTCTTCTTTGCTT | |
ctsk | Forward | TGTATAACGCCACGGCAAA |
Reverse | GGTTCACATTATCACGGTCACA | |
sod | Forward | AACCAGTTGTGTTGTCAGGAC |
Reverse | CCACCATGTTTCTTAGAGTGAGG | |
cat | Forward | AGCGACCAGATGAAGCAGTG |
Reverse | TCCGCTCTCTGTCAAAGTGTG | |
gapdh | Forward | ACAGTCCATGCCATCACTGCC |
Reverse | GCCTGCTTCACCACCTTCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, E.-N.; Trang, N.M.; Kang, H.; Kim, K.H.; Jeong, G.-S. Phytol Suppresses Osteoclast Differentiation and Oxidative Stress through Nrf2/HO-1 Regulation in RANKL-Induced RAW264.7 Cells. Cells 2022, 11, 3596. https://doi.org/10.3390/cells11223596
Kim E-N, Trang NM, Kang H, Kim KH, Jeong G-S. Phytol Suppresses Osteoclast Differentiation and Oxidative Stress through Nrf2/HO-1 Regulation in RANKL-Induced RAW264.7 Cells. Cells. 2022; 11(22):3596. https://doi.org/10.3390/cells11223596
Chicago/Turabian StyleKim, Eun-Nam, Nguyen Minh Trang, Heesun Kang, Ki Hyun Kim, and Gil-Saeng Jeong. 2022. "Phytol Suppresses Osteoclast Differentiation and Oxidative Stress through Nrf2/HO-1 Regulation in RANKL-Induced RAW264.7 Cells" Cells 11, no. 22: 3596. https://doi.org/10.3390/cells11223596
APA StyleKim, E.-N., Trang, N. M., Kang, H., Kim, K. H., & Jeong, G.-S. (2022). Phytol Suppresses Osteoclast Differentiation and Oxidative Stress through Nrf2/HO-1 Regulation in RANKL-Induced RAW264.7 Cells. Cells, 11(22), 3596. https://doi.org/10.3390/cells11223596