Drosophila MESR4 Gene Ensures Germline Stem Cell Differentiation by Promoting the Transcription of bag of marbles
Abstract
1. Introduction
2. Materials and Methods
2.1. Drosophila Stocks and Genetics
2.2. Heat Shock
2.3. Immunohistochemistry
2.4. Quantitative PCR
3. Results
3.1. MESR4 Promotes GSC Differentiation in a Cell Autonomous Manner
3.2. MESR4 Regulates Germ Cell Differentiation at the Pre-CB Stage
3.3. MESR4 Is Required for the Transition from the Pre-CB to the CB Stage
3.4. MESR4 Promotes the Transcription of Bam
3.5. The PHD Domain Is Dispensable for MESR4 Function
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Morrison, S.J.; Kimble, J. Asymmetric and Symmetric Stem-Cell Divisions in Development and Cancer. Nature 2006, 441, 1068–1074. [Google Scholar] [CrossRef] [PubMed]
- Lin, H. The Stem-Cell Niche Theory: Lessons from Flies. Nat. Rev. Genet. 2002, 3, 931–940. [Google Scholar] [CrossRef] [PubMed]
- Dansereau, D.A.; Lasko, P. The Development of Germline Stem Cells in Drosophila. Methods Mol. Biol. 2008, 450, 3–26. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, R. Germline Stem Cells: Origin and Destiny. Cell Stem Cell 2012, 10, 729–739. [Google Scholar] [CrossRef]
- Spradling, A.; Fuller, M.T.; Braun, R.E.; Yoshida, S. Germline Stem Cells. Cold Spring Harb. Perspect. Biol. 2011, 3, a002642. [Google Scholar] [CrossRef]
- Lin, H.; Spradling, A.C. Germline Stem Cell Division and Egg Chamber Development in Transplanted Drosophila Germaria. Dev. Biol. 1993, 159, 140–152. [Google Scholar] [CrossRef]
- Ohlstein, B.; McKearin, D. Ectopic Expression of the Drosophila Bam Protein Eliminates Oogenic Germline Stem Cells. Development 1997, 124, 3651–3662. [Google Scholar] [CrossRef]
- Song, X.; Wong, M.D.; Kawase, E.; Xi, R.; Ding, B.C.; McCarthy, J.J.; Xie, T. Bmp Signals from Niche Cells Directly Repress Transcription of a Differentiation-Promoting Gene, Bag of Marbles, in Germline Stem Cells in the Drosophila Ovary. Development 2004, 131, 1353–1364. [Google Scholar] [CrossRef]
- Ables, E.T.; Drummond-Barbosa, D. Cyclin E Controls Drosophila Female Germline Stem Cell Maintenance Independently of Its Role in Proliferation by Modulating Responsiveness to Niche Signals. Development 2013, 140, 530–540. [Google Scholar] [CrossRef]
- De Cuevas, M.; Spradling, A.C. Morphogenesis of the Drosophila Fusome and Its Implications for Oocyte Specification. Development 1998, 125, 2781–2789. [Google Scholar] [CrossRef]
- Mathieu, J.; Cauvin, C.; Moch, C.; Radford, S.J.; Sampaio, P.; Perdigoto, C.N.; Schweisguth, F.; Bardin, A.J.; Sunkel, C.E.; McKim, K.; et al. Aurora B and Cyclin B Have Opposite Effects on the Timing of Cytokinesis Abscission in Drosophila Germ Cells and in Vertebrate Somatic Cells. Dev. Cell 2013, 26, 250–265. [Google Scholar] [CrossRef] [PubMed]
- Xie, T. Control of Germline Stem Cell Self-Renewal and Differentiation in the Drosophila Ovary: Concerted Actions of Niche Signals and Intrinsic Factors. Wiley Interdiscip. Rev. Dev. Biol. 2013, 2, 261–273. [Google Scholar] [CrossRef] [PubMed]
- Morrison, S.J.; Spradling, A.C. Stem Cells and Niches: Mechanisms That Promote Stem Cell Maintenance throughout Life. Cell 2008, 132, 598–611. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Jin, Z.; Yu, Y.; Zhang, Y.; Yang, F.; Huang, H.; Cai, T.; Xi, R. A Progressive Somatic Cell Niche Regulates Germline Cyst Differentiation in the Drosophila Ovary. Curr. Biol. 2021, 31, 840–852.e5. [Google Scholar] [CrossRef]
- Tu, R.; Duan, B.; Song, X.; Chen, S.; Scott, A.; Hall, K.; Blanck, J.; DeGraffenreid, D.; Li, H.; Perera, A.; et al. Multiple Niche Compartments Orchestrate Stepwise Germline Stem Cell Progeny Differentiation. Curr. Biol. 2021, 31, 827–839.e3. [Google Scholar] [CrossRef]
- Xie, T.; Spradling, A.C. Decapentaplegic Is Essential for the Maintenance and Division of Germline Stem Cells in the Drosophila Ovary. Cell 1998, 94, 251–260. [Google Scholar] [CrossRef]
- Chen, D.; McKearin, D. Dpp Signaling Silences Bam Transcription Directly to Establish Asymmetric Divisions of Germline Stem Cells. Curr. Biol. 2003, 13, 1786–1791. [Google Scholar] [CrossRef]
- Casanueva, M.O.; Ferguson, E.L. Germline Stem Cell Number in the Drosophila Ovary Is Regulated by Redundant Mechanisms That Control Dpp Signaling. Development 2004, 131, 1881–1890. [Google Scholar] [CrossRef]
- Forbes, A.; Lehmann, R. Nanos and Pumilio Have Critical Roles in the Development and Function of Drosophila Germline Stem Cells. Development 1998, 125, 679–690. [Google Scholar] [CrossRef]
- Gilboa, L.; Lehmann, R. Repression of Primordial Germ Cell Differentiation Parallels Germ Line Stem Cell Maintenance. Curr. Biol. 2004, 14, 981–986. [Google Scholar] [CrossRef]
- Wang, Z.; Lin, H. Nanos Maintains Germline Stem Cell Self-Renewal by Preventing Differentiation. Science 2004, 303, 2016–2019. [Google Scholar] [CrossRef] [PubMed]
- Jin, Z.; Xie, T. Dcr-1 Maintains Drosophila Ovarian Stem Cells. Curr. Biol. 2007, 17, 539–544. [Google Scholar] [CrossRef] [PubMed]
- Park, J.K.; Liu, X.; Strauss, T.J.; McKearin, D.M.; Liu, Q. The MiRNA Pathway Intrinsically Controls Self-Renewal of Drosophila Germline Stem Cells. Curr. Biol. 2007, 17, 533–538. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Chen, D.; Duan, R.; Xia, L.; Wang, J.; Qurashi, A.; Jin, P.; Chen, D. Argonaute 1 Regulates the Fate of Germline Stem Cells in Drosophila. Development 2007, 134, 4265–4272. [Google Scholar] [CrossRef]
- Sanchez, C.G.; Teixeira, F.K.; Czech, B.; Preall, J.B.; Zamparini, A.L.; Seifert, J.R.K.; Malone, C.D.; Hannon, G.J.; Lehmann, R. Regulation of Ribosome Biogenesis and Protein Synthesis Controls Germline Stem Cell Differentiation. Cell Stem Cell 2016, 18, 276–290. [Google Scholar] [CrossRef]
- Flora, P.; McCarthy, A.; Upadhyay, M.; Rangan, P. Role of Chromatin Modifications in Drosophila Germline Stem Cell Differentiation. In Signaling-Mediated Control of Cell Division; Results and Problems in Cell Differentiation, 59; Springer: New York, NY, USA, 2017; pp. 1–30. [Google Scholar] [CrossRef]
- Vidaurre, V.; Chen, X. Epigenetic Regulation of Drosophila Germline Stem Cell Maintenance and Differentiation. Dev. Biol. 2021, 473, 105–118. [Google Scholar] [CrossRef]
- Sardi, J.; Bener, M.B.; Simao, T.; Descoteaux, A.E.; Slepchenko, B.M.; Inaba, M. Mad Dephosphorylation at the Nuclear Pore Is Essential for Asymmetric Stem Cell Division. Proc. Natl. Acad. Sci. USA 2021, 118, e2006786118. [Google Scholar] [CrossRef]
- Banisch, T.U.; Slaidina, M.; Gupta, S.; Ho, M.; Gilboa, L.; Lehmann, R. A Transitory Signaling Center Controls Timing of Primordial Germ Cell Differentiation. Dev. Cell 2021, 56, 1742–1755.e4. [Google Scholar] [CrossRef]
- Chen, D.; McKearin, D.M. A Discrete Transcriptional Silencer in the Bam Gene Determines Asymmetric Division of the Drosophila Germline Stem Cell. Development 2003, 130, 1159–1170. [Google Scholar] [CrossRef]
- Wissel, S.; Kieser, A.; Yasugi, T.; Duchek, P.; Roitinger, E.; Gokcezade, J.; Steinmann, V.; Gaul, U.; Mechtler, K.; Förstemann, K.; et al. A Combination of CRISPR/Cas9 and Standardized RNAi as a Versatile Platform for the Characterization of Gene Function. G3 Genes Genomes Genet. 2016, 6, 2467–2478. [Google Scholar] [CrossRef]
- Flora, P.; Schowalter, S.; Wong-Deyrup, S.; DeGennaro, M.; Nasrallah, M.A.; Rangan, P. Transient Transcriptional Silencing Alters the Cell Cycle to Promote Germline Stem Cell Differentiation in Drosophila. Dev. Biol. 2018, 434, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Van Doren, M.; Williamson, A.L.; Lehmann, R. Regulation of Zygotic Gene Expression in Drosophila Primordial Germ Cells. Curr. Biol. 1998, 8, 243–246. [Google Scholar] [CrossRef]
- Port, F.; Chen, H.-M.; Lee, T.; Bullock, S.L. Optimized CRISPR/Cas Tools for Efficient Germline and Somatic Genome Engineering in Drosophila. Proc. Natl. Acad. Sci. USA 2014, 111, E2967–E2976. [Google Scholar] [CrossRef] [PubMed]
- Jankovics, F.; Bence, M.; Sinka, R.; Faragó, A.; Bodai, L.; Pettkó-Szandtner, A.; Ibrahim, K.; Takács, Z.; Szarka-Kovács, A.B.; Erdélyi, M. Drosophila Small Ovary Gene Is Required for Transposon Silencing and Heterochromatin Organization, and Ensures Germline Stem Cell Maintenance and Differentiation. Development 2018, 145, dev170639. [Google Scholar] [CrossRef]
- Jankovics, F.; Henn, L.; Bujna, Á.; Vilmos, P.; Spirohn, K.; Boutros, M.; Erdélyi, M. Functional Analysis of the Drosophila Embryonic Germ Cell Transcriptome by RNA Interference. PLoS ONE 2014, 9, e98579. [Google Scholar] [CrossRef]
- Lavoie, C.A.; Ohlstein, B.; McKearin, D.M. Localization and Function of Bam Protein Require the Benign Gonial Cell Neoplasm Gene Product. Dev. Biol. 1999, 212, 405–413. [Google Scholar] [CrossRef]
- Kudron, M.M.; Victorsen, A.; Gevirtzman, L.; Hillier, L.W.; Fisher, W.W.; Vafeados, D.; Kirkey, M.; Hammonds, A.S.; Gersch, J.; Ammouri, H.; et al. The ModERN Resource: Genome-Wide Binding Profiles for Hundreds of Drosophila and Caenorhabditis Elegans Transcription Factors. Genetics 2018, 208, 937–949. [Google Scholar] [CrossRef]
- Marchler-Bauer, A.; Bo, Y.; Han, L.; He, J.; Lanczycki, C.J.; Lu, S.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; et al. CDD/SPARCLE: Functional Classification of Proteins via Subfamily Domain Architectures. Nucleic Acids Res. 2017, 45, D200–D203. [Google Scholar] [CrossRef]
- Jain, K.; Fraser, C.S.; Marunde, M.R.; Parker, M.M.; Sagum, C.; Burg, J.M.; Hall, N.; Popova, I.K.; Rodriguez, K.L.; Vaidya, A.; et al. Characterization of the Plant Homeodomain (PHD) Reader Family for Their Histone Tail Interactions. Epigenetics Chromatin 2020, 13, 3. [Google Scholar] [CrossRef]
- Xi, R.; Xie, T. Stem Cell Self-Renewal Controlled by Chromatin Remodeling Factors. Science 2005, 310, 1487–1489. [Google Scholar] [CrossRef]
- Buszczak, M.; Paterno, S.; Spradling, A.C. Drosophila Stem Cells Share a Common Requirement for the Histone H2B Ubiquitin Protease Scrawny. Science 2009, 323, 248–251. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Pan, L.; Wang, S.; Zhou, J.; McDowell, W.; Park, J.; Haug, J.; Staehling, K.; Tang, H.; Xie, T. Histone H3K9 Trimethylase Eggless Controls Germline Stem Cell Maintenance and Differentiation. PLoS Genet. 2011, 7, e1002426. [Google Scholar] [CrossRef] [PubMed]
- Xin, T.; Xuan, T.; Tan, J.; Li, M.; Zhao, G.; Li, M. The Drosophila Putative Histone Acetyltransferase Enok Maintains Female Germline Stem Cells through Regulating Bruno and the Niche. Dev. Biol. 2013, 384, 1–12. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xuan, T.; Xin, T.; He, J.; Tan, J.; Gao, Y.; Feng, S.; He, L.; Zhao, G.; Li, M. DBre1/DSet1-Dependent Pathway for Histone H3K4 Trimethylation Has Essential Roles in Controlling Germline Stem Cell Maintenance and Germ Cell Differentiation in the Drosophila Ovary. Dev. Biol. 2013, 379, 167–181. [Google Scholar] [CrossRef]
- Sun, J.; Wei, H.-M.; Xu, J.; Chang, J.-F.; Yang, Z.; Ren, X.; Lv, W.-W.; Liu, L.-P.; Pan, L.-X.; Wang, X.; et al. Histone H1-Mediated Epigenetic Regulation Controls Germline Stem Cell Self-Renewal by Modulating H4K16 Acetylation. Nat. Commun. 2015, 6, 8856. [Google Scholar] [CrossRef]
- Huang, A.M.; Rubin, G.M. A Misexpression Screen Identifies Genes That Can Modulate RAS1 Pathway Signaling in Drosophila Melanogaster. Genetics 2000, 156, 1219–1230. [Google Scholar] [CrossRef]
- Zhu, M.Y.; Wilson, R.; Leptin, M. A Screen for Genes That Influence Fibroblast Growth Factor Signal Transduction in Drosophila. Genetics 2005, 170, 767–777. [Google Scholar] [CrossRef]
- Seong, K.-H.; Tsuda, M.; Tsuda-Sakurai, K.; Aigaki, T. The Plant Homeodomain Finger Protein MESR4 Is Essential for Embryonic Development in Drosophila. Genesis 2015, 53, 701–708. [Google Scholar] [CrossRef]
- Matsuoka, S.; Hiromi, Y.; Asaoka, M. Egfr Signaling Controls the Size of the Stem Cell Precursor Pool in the Drosophila Ovary. Mech. Dev. 2013, 130, 241–253. [Google Scholar] [CrossRef]
- Morra, R.; Lee, B.M.; Shaw, H.; Tuma, R.; Mancini, E.J. Concerted Action of the PHD, Chromo and Motor Domains Regulates the Human Chromatin Remodelling ATPase CHD4. FEBS Lett. 2012, 586, 2513–2521. [Google Scholar] [CrossRef]
- Watson, A.A.; Mahajan, P.; Mertens, H.D.T.; Deery, M.J.; Zhang, W.; Pham, P.; Du, X.; Bartke, T.; Zhang, W.; Edlich, C.; et al. The PHD and Chromo Domains Regulate the ATPase Activity of the Human Chromatin Remodeler CHD4. J. Mol. Biol. 2012, 422, 3–17. [Google Scholar] [CrossRef] [PubMed]
- Bienz, M. The PHD Finger, a Nuclear Protein-Interaction Domain. Trends Biochem. Sci. 2006, 31, 35–40. [Google Scholar] [CrossRef] [PubMed]
- Peña, P.V.; Davrazou, F.; Shi, X.; Walter, K.L.; Verkhusha, V.V.; Gozani, O.; Zhao, R.; Kutateladze, T.G. Molecular Mechanism of Histone H3K4me3 Recognition by Plant Homeodomain of ING2. Nature 2006, 442, 100–103. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Kachirskaia, I.; Walter, K.L.; Kuo, J.-H.A.; Lake, A.; Davrazou, F.; Chan, S.M.; Martin, D.G.E.; Fingerman, I.M.; Briggs, S.D.; et al. Proteome-Wide Analysis in Saccharomyces Cerevisiae Identifies Several PHD Fingers as Novel Direct and Selective Binding Modules of Histone H3 Methylated at Either Lysine 4 or Lysine 36. J. Biol. Chem. 2007, 282, 2450–2455. [Google Scholar] [CrossRef]
- Mansfield, R.E.; Musselman, C.A.; Kwan, A.H.; Oliver, S.S.; Garske, A.L.; Davrazou, F.; Denu, J.M.; Kutateladze, T.G.; Mackay, J.P. Plant Homeodomain (PHD) Fingers of CHD4 Are Histone H3-Binding Modules with Preference for Unmodified H3K4 and Methylated H3K9. J. Biol. Chem. 2011, 286, 11779–11791. [Google Scholar] [CrossRef]





| Primer | Title 2 |
|---|---|
| MESR4_top | GGTAGCAGCGCTGGTGGTAT |
| MESR4_bottom | TGGCGATCGTCTAAGGATAAC |
| Primer | Sequence |
|---|---|
| Bam_fwd | CTGCACGGCGATTGCTTAGA |
| Bam_rev | GTGATCATGCAGGGATCTGAAC |
| Rp49_fwd | CCGCTTCAAGGGACAGTATCTG |
| Rp49_rev | ATCTCGCCGCAGTAAACGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szarka-Kovács, A.B.; Takács, Z.; Bence, M.; Erdélyi, M.; Jankovics, F. Drosophila MESR4 Gene Ensures Germline Stem Cell Differentiation by Promoting the Transcription of bag of marbles. Cells 2022, 11, 2056. https://doi.org/10.3390/cells11132056
Szarka-Kovács AB, Takács Z, Bence M, Erdélyi M, Jankovics F. Drosophila MESR4 Gene Ensures Germline Stem Cell Differentiation by Promoting the Transcription of bag of marbles. Cells. 2022; 11(13):2056. https://doi.org/10.3390/cells11132056
Chicago/Turabian StyleSzarka-Kovács, Alexandra Brigitta, Zsanett Takács, Melinda Bence, Miklós Erdélyi, and Ferenc Jankovics. 2022. "Drosophila MESR4 Gene Ensures Germline Stem Cell Differentiation by Promoting the Transcription of bag of marbles" Cells 11, no. 13: 2056. https://doi.org/10.3390/cells11132056
APA StyleSzarka-Kovács, A. B., Takács, Z., Bence, M., Erdélyi, M., & Jankovics, F. (2022). Drosophila MESR4 Gene Ensures Germline Stem Cell Differentiation by Promoting the Transcription of bag of marbles. Cells, 11(13), 2056. https://doi.org/10.3390/cells11132056

